Place the rock layers in order from oldest to youngest in the blanks below. Type the letters as they
are shown.

Answer:

C

Explanation:

The principle of superposition states that the oldest sedimentary rock units are at the bottom, and the youngest are at the top. Based on this, layer C is oldest, followed by B and A. So the full sequence of events is as follows: Layer C formed.

What would happen if there is an obstruction in the vas deferens?​

Students are growing plants in pots on the windowsill of
their classroom. After spring break, a student notices
that one of the potted plants furthest from the
windowsill has changed shape, as shown below....Which
statement best explains why this plant grew at a
different angle? *

A) A plant growth hormone accumulates in the shaded side
of the stems, causing the lower leaves to fall off.

B) A plant growth hormone accumulates in the shaded side of the stems, stimulating those sides to grow faster and
bend toward the light.

C) A plant hormone accumulates in the unshaded side of
plant cells, causing the plants to grow. much faster

D)A plant hormone accumulates in the shaded side of plant
cells, stimulating the plants to produce more flowers.

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Rylee saw a cell under a microscope and drew what she saw. This cell is classified as —

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

There are three species of birds on an island. Bird A has a heavy bill for eating seeds.
Bird B has a pointed bill for eating insects. Bird C has a sharp bill for eating both insects
and seeds. If all insects on the island suddenly disappeared, which bird or birds would
be the LEAST affected?



Please help

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

5. Explain the process through which natural selection can lead to a new species of organism.

What are the goals of binomial nomenclature and systematics?

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

High blood pressure is a common and dangerous condition affecting about 75 million people in the United States. It is known as the "silent killer" because many people don't know they have it. This contributes to the disease being the second leading cause of death of Americans.

Which of the following lifestyles would increase the risk of high blood pressure?



Group of answer choices:

Living a calm sedentary lifestyle on an island that is hit by an occasional hurricane.

Losing weight after childbirth.

Attending water aerobics class 4 times a year.

Eating meals that include fruits, vegetables and grains.

How about decreasing the amount of water in blood affect blood pressure

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Tell me if you think caecilians are amphibians, reptiles, or fish.

What does "reliability" mean in these sentences?

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Essay Question: Which two species are more closely related?

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Which of the following best predicts and justifies how the proportion of the Tibetan population with big blood vessels living in the mountains will change over the next 1,000 years (assuming conditions remain stable)?

Question 2 options:

I predict that the proportion of individuals with big blood vessels living in the mountains will decrease because there is a variation in blood vessel size and those with the smaller blood vessels can store more red blood cells than larger vessels, so more oxygen can be moved to the body cells. Therefore, they have a better chance of surviving and passing this trait on to their offspring.


I predict that the proportion of individuals with big blood vessels living in the mountains will stay the same because there is a variation in blood vessel size and that variation will remain in a population. The is what is so cool about humans, we are all so unique.


I predict that the proportion of individuals with big blood vessels living in the mountains will increase because there is a variation in blood vessel size and those with the bigger blood vessels can deliver more oxygen to the body cells and therefore have a better chance of surviving and passing this trait on to their offspring.


I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Someone please help me !

Hello! could someone please do a 4 sentence quark poem

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.