Answer:
the correct option is:
A virus that can be transmitted through arthropods such as ticks, flies, and mosquitoes is considered an arbovirus.
2. Some arboviruses can move through the bloodstream and infect the brains of human and animal arboviruses. This manifestation of the disease is called encephalitis.
Explanation:
Arboviruses are very dangerous for humans, some do not generate painful bites, others are hematofogous (they feed on human blood) and others are nocturnal, which bite humans at night without their perceiving it.
Diseases of these viruses that are transmitted by vectors such as arthropods cause encephalitis, cardiac, pulmonary disorders, etc.
An example of this is the Chagas disease that is generated by the transmission of the Vinchuca arthropod.
Which of these statements best sums up evolution?
rapid change in species’ habits and features
rapid development of vestigial structures in a species
change in a population through new species being made
change in a population through genetic variation over time
Answer:
change in a population through genetic variation over time
Explanation:
took the test
Assume that white color is dominant over yellow color in squash. If pollen from the anthers of a heterozygous white-fruited plant is placed on the pistil of a yellow-fruited plant, show using ratios the genotypes and phenotypes you would expect the seeds from this cross to produce. 1. Genotypes 1/2 Ww 1/2 Ww 1:1 ratio | Phenotypes All white 1:0 ratico
2. Genotypes 1/2 wW 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio
3. Genotypes- 3/4 Ww 1/4 ww 1:1 ratio | Phenotypes 3/4 white 1/4 yellow- 1:1 ratio
4. Genotypes-1/2 ww 1/2 ww = 1:1 ratio l Phenotypes-1/2 white 1/2 yellow-1:1 ratio
Answer:
2. Genotypes 1/2 Ww 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio
Explanation:
This question involves a single gene coding for fruit color in squash. The allele for white color (W) is dominant over the allele for yellow color (w).
If a heterozygous white-fruited plant (Ww) is crossed with a yellow-fruited plant (ww), the following gamete combinations will be produced by each parent:
Ww- W and w
ww- w and w
Using these gametes in a punnet square (see attached image), offsprings with genotypes: Ww and ww will be produced in the ratio 1:1
(1/2) Ww will be phenotypically white-fruited
(1/2) ww will be phenotypically yellow-fruited
Hence, the seed offsprings of this cross will possess:
Genotypes 1/2 Ww, 1/2 ww in 1:1 ratio
Phenotypes 1/2 white, 1/2 yellow in 1:1 ratio
Shelly, an eight-year-old child from a low-income family, is displaying symptoms such as growth failure, diarrhea, and pneumonia. Which of the following is Shelly most likely suffering from?
a. Iron deficiency
b. Folate deficiency
c. Iodine deficiency
d. Vitamin A deficiency
e. Zinc deficiency
Answer:
The correct answer is e.
Explanation:
Zinc is an essential intracellular trace element most abundant in the human body, which participates in important structural and catalytic regulatory functions, it is an integral part of many tissues, being essential for the synthesis of biomolecules such as DNA and proteins, as well as for degradation of the same. The deficiencies of any nutrient may be due to a decrease in its intake, an increase in the body's needs and therefore, its requirements, or a decrease in the bioavailability of the nutrient due to the way in which it is found in food. Zinc deficiency causes multisystemic, sometimes fatal, manifestations if not detected and corrected early. Symptoms of severe zinc deficiency are slowing or disruption of growth and development, delayed sexual maturation, characteristic skin rashes, chronic and severe diarrhea, impaired immune system, poor wound healing, loss of appetite, decreased sensitivity to the touch, night blindness, inflammation, opacity of the corneas and behavioral problems.
Which correctly describes malignant tumors?
Answer:
Malignant means that the tumor is made of cancer cells, and it can invade nearby tissues. Some cancer cells can move into the bloodstream or lymph nodes, where they can spread to other tissues within the body—this is called metastasis.
Which of the following sources would be most likely to have reliable data
describe how a cell acquires the O2 the cell needs for its metabolic processes and how a cell gets rid of the CO2 that is doesn't need and can actually be harmful to the cell?
Answer:
Cells absorb oxygen and release CO2 via the bloodstream. Please find below detailed explanation
Explanation:
Oxygen and carbondioxide (CO2) are the major gaseous substances involved in celluar respiration. Aerobic celluar respiration, which is the process by which cells obtain energy, requires oxygen to occur. The oxygen initially gets breathed in as a constituent of air, which later passes through air sacs and gets attached to hemoglobin in red blood cells. Hemoglobin transports oxygen throughout the cells of the body.
After the process of celluar respiration is done, carbondioxide (CO2) is released back into the bloodstream, which carries it to the lungs. The CO2 is released when we breathe out.
Cilia in cells along the trachea ad nasal passage secrete blank which traps dirt and particles from the air
Answer:
Yes it secretes blank to trap and particles from the air
Identify the type of system used for mass production. Tommy owns a toy factory and uses a in which all the machines and workers at workstations process each manufactured item in the same order. This system is suitable for mass production.
In the process of urine formation:_____.
a. first filtrate is formed, then tubular fluid, then urine.
b. tubular fluid is formed, then filtrate, then urine.
Answer:
b i think is your answer
Explanation:
Briefly explain what was done in the experiment where pigeons could choose which button to peck in the Skinner box. How does this relate to self-control?
In this experiment, Skinner placed a pigeon inside a box that contained a button that when pressed released water or food. This pigeon went through periods of deprivation of water and food, but over time, he realized that when he pecked the button he had access to these two elements. Skinner called this behavior operant behavior, which is the behavior that occurs controlled by its consequences.
Although Skinner did not specifically study self-control, with this experiment, we can make a connection between operant behavior and self-control, since both are behaviors shown as a way to change the environment in which they are inserted, but this change also affects them.
what is a protron needed for
Answer:
Function in the atom
Explanation:
The protons inside an atom's nucleus help bind the nucleus together. They also attract the negatively charged electrons, and keep them in orbit around the nucleus. The number of protons in an atom's nucleus determines which chemical element it is.
2. Exocrine glands, such as sweat glands, secrete fluids
glands secrete hormones directly into the bloodstrea
3. The _______ gland plays an important role in puberty
4. Epinephrine, triggering the "fight or flight" response
glands, which sit on top of the kidneys.
5. Most glands that secrete hormones operate using fe
When hormone concentrations are high, the gland w
the hormone.
6. Many cells produce chemicals called_____ hormon
impact inflammation and reproduction.
7. The gland that helps regulate growth, body temperat
lod the
Answer:
pituitary gland
Prostaglandins
oestrogen and testosterone
Explanation:
The pituitary gland plays an important role in puberty. Puberty refers to the time in which a boy or girl sexually mature. Many cells produce chemicals called Prostaglandins hormone which impact inflammation and oestrogen and testosterone are the hormones which is responsible for the maturation of eggs in female and sperm in male. these hormones plays a vital role in the growth and development of human body.
Answer:
1.Hormones
2. endocrine
3. pituitary
4. adrenal
5. less
6. prostaglandins
7. thyroid
8. Steroidal hormones enter the cell directly and interact with DNA inside the nucleus. These hormones change gene expression, affecting the RNA that is produced and the proteins that are translated in a cell. Nonsteroid hormones do not enter the cell. Instead, they bind to specific receptors on the outside of the cell membrane. This triggers molecules called secondary messengers, such as cAMP, to begin their work of relaying information in the cell, where other chemicals, messengers, and proteins are involved to create a cellular response.
Explanation:
Penn Foster
3. List the molarities at which water exited the potato strips. Why did water move out of the potato strips? Were these solutions hypotonic, hypertonic, or isotonic?
Answer:
The water came out of the strips of the potatoes because a process of balance and oxygen balance called osmosis occurs.
Explanation:
The potato was subjected to a hypertonic environment and it is considered hypotonic, that is why the water seeks to go out to the outside in order to generate that it finds a balance in relation to a solvent solvent.
The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the ________ muscle.
Answer:
The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the Longissimus muscle
Explanation:
The Longissimus is a group made of three muscles: longissimus capitis, longissimus cervicis and longissimus thoracis. It has the length of the vertebral column.
It is placed in the back, and as the statement says, it originates on the sacrum and transverse of each vertebra. Each of them originates at the transverse elements and insert in the costal ones.
What are the different alleles available for the cross shown in this Punnett square? a and a A and a A and A
Answer:
A and a
Explanation:
Answer:
b
Explanation:
Question
Select the correct answer.
Which of the following conditions would likely lead to the slowest rate of weathering?
a dry, temperate region with few hills or valleys
a steep mountain in a region with a cold climate
a hilly region that receives heavy, acidic precipitation
a region with heavy rainfall, where temperatures vary greatly
Submit
The condition above which would likely lead to the slowest rate of weathering is region with heavy rainfall, where temperatures vary greatly.
What is weathering?Weathering simply refers to the deterioration of rocks, soils and minerals substances through contact with water or even biological organisms.
So therefore, the condition above which would likely lead to the slowest rate of weathering is region with heavy rainfall, where temperatures vary greatly
Learn more about weathering:
https://brainly.com/question/2341950
SPJ1
Answer:
A dry temperate region with few hills or valleys
Explanation:
this is right on plato
how many lactobacillyus present in 1 lire of curd packet
A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.
hope it helps
Which type of organism developed first?
al
answer: algae
explanation: because the were the first ones to adapt with water and land...
Why do hurricanes lose strength once they reach the land?
O A. Hurricanes can't replenish their water from the ground.
B. Hurricanes gain strength from the warmth of the ocean water.
C. Hurricanes lose strength when they reach a warm front on land.
D. Friction with the ground stops hurricane spinning.
Answer: b
Explanation: cause hurricanes gain strength from water
Hurricanes lose strength once they reach the land because hurricanes gain strength from the warmth of the ocean water. The correct answer is option B.
A hurricane is a large, rotating storm that forms over tropical or subtropical waters. Hurricanes are characterized by strong winds, heavy rain, and storm surges, which can cause significant damage and loss of life.
Hurricanes gain strength from the warmth of the ocean water. This is why hurricanes tend to lose strength once they reach land. When a hurricane is over the ocean, it draws its energy from the warm water, which causes the air to rise and creates a low-pressure area. This low-pressure area then draws in more warm, moist air from the surrounding area, which fuels the hurricane and causes it to intensify.
Once a hurricane moves over land, it loses its source of warm water and can no longer draw in the moisture it needs to maintain its strength. This causes the hurricane to gradually weaken and dissipate.
Since, hurricanes gain strength from the warmth of the ocean water, it loses its source of warm water and eventually its strength. Option B is the correct answer.
Learn more about hurricanes here:
https://brainly.com/question/33034641
#SPJ6
A Maximum-Minimum thermometer has two stems which record the highest and lowest temperatures during a period of time. A small metallic piece in each stem indicates the temperature. A. 55o C, 35o C, 45o C B. 45o C, 25o C, 35o C C. 55o C, 25o C, 35o C D. 45o C, 25o C, 30o C 4. M
Answer:
The correct option is A: 55° C, 35° C, 45° C
Explanation:
The Six's thermometer is a device to record maximum and minimum values of temperature within a given period of time. It is a glass tube in a U shaped manner that contains mercury, which is dependent on the expansion of alcohol in order to register a maximum reading. It is made use of for the purpose of meteorology, horticulture etc.
The metallic piece in each stem indicates the temperature of 45°C, 25°C, 35°C. That is option B.
A maximum-minimum thermometer is an instrument used to measure both the minimum and maximum temperature of a given area for a period of time.
The maximum-minimum thermometer is used in the following fields:
Horticulture: This is useful in the sustainable production of cultivated food and ornamental plants as temperature of the area in use needs to be monitored.Meteorology: This is useful in this field to monitor the temperature of different locations.The range for a maximum-minimum thermometer is -30°C to 50°C.
Therefore, the metallic piece in each stem will indicate the temperature of 45°C, 25°C, 35°C which is within the range.
Learn more about thermometers here:
https://brainly.com/question/25034625
HELP ASAP DUE NOW PLSSS HELP 10 points and brainlist Which arrows show matter moving from a producer to an omnivore? Select all that apply.
Answer:
my best guess is number answer 2 and answer 4
because crows love to eat desert woodrats and for the last one i watched it in national geo, its like a cycle grass hopper died by a mouse dies by a rattle snake.
A teenager throws a 7.26 kg rock into a lake, trying to make a big splash. If the rock is travelling at a speed of 7.5 m/s, how much kinetic energy does the rock have?
Explanation:
K.E = 1/2mv²
1/2 x 7.26 x 7.5²= 204.19j
Which of the following answers correctly lists the four main types of macromolecules?
A.
DNA, RNA, triglycerides, water
B.
Monosaccharides, water, DNA, triglycerides
C.
Water, oxygen gas, ammonia, carbon
D.
Carbohydrates, lipids, proteins, nucleic acids
Answer:
D. carbohydrates, lipids, proteins, and nucleic acids[tex]hope \: it \: helps[/tex]
Answer:
D
Explanation:
They are the main types of macromolecules
The type of teeth seen in blank are usually broad and flat
Answer:
MolarsExplanation:
Molars are the teeth furthest back in our mouth. Their broad, flat surfaces help grind food as we eat...
hope this answer correct :)
Which statement best describes the relationship of photosynthesis and energy? 1. The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose. 2.The process of photosynthesis is energy-releasing because the process converts light energy into free energy that can be used for cell functions. 3.The process of photosynthesis is energy-conserving because no energy is used throughout the process of forming glucose and oxygen molecules. 4.The process of photosynthesis is energy-wasting because photosynthesis is an inefficient process that depletes the cell of energy stored in the bonds of glucose.
Answer:
3 is appropriate statement that describes photosynthesis
the correct answer for this question is 1. The process of photosynthesis is energy-storing because the process converts light energy into chemical energy, which is stored in the bonds of glucose.
Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.
Answer:
Option A
Explanation:
DNA sequence: GTCACCGGTCTATACATAAGC.
If the bases of codon 5 under a mutation of C to T, the outcome would be?
Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.
If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.
Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.
In 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal. The article was titled “Environmental Hypotheses of Hominin Evolution.” In his paper, Potts claimed that great variations in environmental conditions over time were responsible for the adaptability of humans and the success of our species. Which would most likely be found in his paper?
This question is incomplete because the options are missing; here is the missing section:
Which would most likely be found in his paper?
A. A review of modern human anatomical structure.
B. Evidence of changing environmental conditions, with references.
C. The reasons competing hypotheses are wrong.
D. His opinion of what will happen to the survival of the human race.
The answer to this question is B. Evidence of changing environmental conditions, with references.
Explanation:
In texts such as scientific articles, the central point is expressed by the main claim or hypothesis as this is supported and explained through evidence in the articles. This means Potts article focuses on the environmental changes and how these contributed to the human species adaptability.
Due to this, it is expected the article explains the changes in environmental conditions, and the connection of these to adaptability. Moreover, because this is a scientific article all ideas should be supported with evidence collected by the author including references to other reliable sources. Thus, "evidence of changing environmental conditions, with references" is expected to be found in this article.
Answer: B
Explanation: I took the test :)
Hemoglobin is the blood protein responsible for the transport of oxygen. Carbon monoxide disturbs oxygen transport by
Answer:
Answered below
Explanation:
Hemoglobin is found in the red blood cells and is responsible for the transportation of oxygen from the lungs to the various body cells.
Oxygen binds to hemoglobin because it has a high affinity for it. This aids its transportation. When it gets to the cells it unbinds and get transported into the cell for use in energy production.
Carbon monoxide is an odourless, dangerous gas which has more affinity for hemoglobin than oxygen. Therefore when carbon monoxide is inhaled, it quickly binds to hemoglobin, thereby displacing oxygen. It binds to hemoglobin for a longer period and due to this, the body does not get any oxygen and cells begin to die.
Symptoms of carbon monoxide poisoning include dizziness, headaches, fatigue and coma.
CH 7 What will be the effect if a
toxin make a pore ( o ) in the
inner membrane of the
mitochondria
Answer:
Mitochondria is known as the powerhouse of the cell as it provides energy to the cell for performing different functions.
If a toxin causes pore in the inner membrane of the mitochondria and increases the permeability of the mitochondrial membranes. The permeability of mitochondrial membranes leads to mitochondrial swelling and causes cell death through necrosis and apoptosis.
Classify the following organisms into their respective kingdoms (i) Yeast (ii) Penicillium (iii) Rhizobium (iv) Mushroom (v) Amoeba (vi) fish
Answer:
(i) Yeast- Kingdom Fungi
(ii) Penicillium- Kingdom Fungi
(iii) Rhizobium- Kingdom Eubacteria
(iv) Mushroom- Kingdom Fungi
(v) Amoeba- Kingdom Protista
(vi) fish- Kingdom Animalia
Explanation:
Living organisms were classified into a large group called KINGDOM, which represent the largest and most generic grouping consisting of organisms that share a few similarities. The kingdoms that living organisms were classified into are as follows: Plantae, Animalia, Fungi, Protista, Eubacteria, Archaebacteria, etc.
Based on the question, the mentioned organisms are classified into the following kingdoms:
(I) Yeast: Yeast is a unicellular microbe classified under the Kingdom Fungi due to possession of chitin in its cell wall and other similar features with members of kingdom Fungi.
ii) Penicillium- Penicillium is a genus classified under the Kingdom Fungi.
(iii) Rhizobium- Rhizobium is a genus of prokaryotic organism (lack membrane-bound nucleus and organnelles) classified under the Kingdom Eubacteria.
(iv) Mushroom- Mushrooms are saprophytic (heterotrophic) species of organisms classified under the Kingdom Fungi.
(v) Amoeba- Amoeba is a genus of unicellular eukaryotes classified under the Kingdom Protista.
(vi) fish- Fishes are organisms classified under the Kingdom Animalia