Match the expression to the exponent rule. One rule will not be used.

Match The Expression To The Exponent Rule. One Rule Will Not Be Used.

Answers

Answer 1

Answer:

Step-by-step explanation:

from top down:

xᵃ⁻ᵇ

xᵃ⁺ᵇ

1

xᵃˣᵇ

1/xᵃ


Related Questions

When solving a polynomial equation by factoring, to which factors can we apply the zero-product property?

Answers

When solving a polynomial equation by factoring, we can apply the zero-product property to the factors that are equal to zero.

The zero-product property states that if the product of two or more factors is equal to zero, then at least one of the factors must be equal to zero. For example, if (x-2)(x+3) = 0, then either (x-2) = 0 or (x+3) = 0.

In the case of a polynomial equation, we can apply the zero-product property to the factors that are equal to zero in order to find the values of x that make the equation true.

For example, if we have the equation x^2 - 5x + 6 = 0, we can factor the left-hand side of the equation to get (x-2)(x-3) = 0. We can then apply the zero-product property to find that either (x-2) = 0 or (x-3) = 0, which means that x = 2 or x = 3 are the solutions to the equation.

In summary, when solving a polynomial equation by factoring, we can apply the zero-product property to the factors that are equal to zero in order to find the values of x that make the equation true.

Know more about polynomial here:

https://brainly.com/question/1496352

#SPJ11

Look at the coordinate plane. Determine if each point is placed correctly on the coordinate plane by selecting Yes or No. Coordinate plane with 6 points graphed. The locations of each point from the origin are as follows. Point A is 2 units left and 4 units up. Point B is 2 and one-half units right, 2 units up. Point C is 2 and one-half units right, 2 units down. Point D is 1 unit right, 3 units down. Point E is 1 unit left, 1 unit down. Point F is 2 units left, 2 and one-half units down. A (4, –2) Yes No B (212 , 2) Yes No C (212 , –2) Yes No D (1, 3) Yes No E (–1, 1) Yes No F (–2, -212 ) Yes No

Answers

The answer is A: Yes B: Yes C: Yes D: Yes E: Yes F: Yes. Each point is correctly placed on the coordinate plane.

What is coordinate plane?

A coordinate plane is a two-dimensional plane consisting of two axes (x and y) which intersect at a point called the origin. The x-axis, which runs horizontally, is referred to as the abscissa and the y-axis, which runs vertically, is referred to as the ordinate. The origin, which is the point of intersection of the two axes, is the point (0, 0).The coordinate plane is also known as the Cartesian plane, named after mathematician René Descartes.

Yes, Point A is located correctly on the coordinate plane at (4, –2). Yes, Point B is located correctly on the coordinate plane at (2 1/2, 2). Yes, Point C is located correctly on the coordinate plane at (2 1/2, –2). Yes, Point D is located correctly on the coordinate plane at (1, 3). Yes, Point E is located correctly on the coordinate plane at (–1, 1). Yes, Point F is located correctly on the coordinate plane at (–2, –2 1/2).

To know more about Cartesian plane,

https://brainly.com/question/28574364

#SPJ1

#8
the results of a survey that asked 120 eighth graders if they prefer math or social studies are shown in the frequency table.

Answers

The relative frequency for the total number of boys in this survey, rounded to the nearest hundredth, is 0.43.

What is frequency ?

In statistics, frequency refers to the number of times a particular observation or value occurs in a given dataset or sample. It is often represented in a frequency table, which organizes the data by category or value and shows the number of occurrences for each.

To find the relative frequency for the total number of boys in this survey, we need to divide the number of boys who prefer math or social studies by the total number of students in the survey, which is 120.

Relative frequency of boys who prefer math = 43/52 ≈ 0.83

Relative frequency of boys who prefer social studies = 9/52 ≈ 0.17

Relative frequency of total number of boys = 52/120 ≈ 0.43

Therefore, the relative frequency for the total number of boys in this survey, rounded to the nearest hundredth, is 0.43.

To know more about frequency visit :

brainly.com/question/254161

#SPJ1

Write an algebraic expression for each word expression then evaluate the expression for these values of the variable 1, 6, 13.5. five the quotient of 100 and the sum of B and 24

Answers

Answer:

the quotient of 100 and the sum of B and 24

Step-by-step explanation:

The word expression is: "the quotient of 100 and the sum of B and 24"

The algebraic expression is: 100 / (B + 24)

To evaluate this expression for the values 1, 6, and 13.5, we substitute each value in turn for B and simplify:

When B = 1:

100 / (1 + 24) = 100 / 25 = 4

When B = 6:

100 / (6 + 24) = 100 / 30 = 3.33...

When B = 13.5:

100 / (13.5 + 24) = 100 / 37.5 = 2.666...

Therefore, the values of the expression for B = 1, 6, and 13.5 are approximately 4, 3.33, and 2.67, respectively.

ALGEBRAIC EXPRESSIONS AND EQUATIONS Evaluating a quadratic expression: Integers Evaluate the expression when b=5. b^(2)-7b+1

Answers

The expression b^(2)-7b+1 evaluates to -9 when b=5.

To evaluate the expression when b=5, we simply need to substitute the value of b into the expression and then simplify.

Here's how we do it step-by-step:

Step 1: Substitute the value of b into the expression:

b^(2)-7b+1 = (5)^(2)-7(5)+1

Step 2: Simplify the expression by following the order of operations (PEMDAS):

= 25-35+1

Step 3: Combine like terms:

= -9

So, the final answer is -9.

Therefore, the expression b^(2)-7b+1 evaluates to -9 when b=5.

For more about quadratic expression:

https://brainly.com/question/14083225

#SPJ11

Find m∠RTS. PLS HELP IN THE MIDDLE OF A TEST

Answers

Angle RTS is 25°
………..

`g\left(x\right)`represents the cost of a stuffed giraffe. The giraffe costs `\$15` and accessories cost `\$3.75` each. What does `g\left(5\right)=33.75` say about this situation?

Answers

The statement g(5) = 33.75 represents total cost of $33.75 when the purchase of a stuffed giraffe added to 5 accessories to it, the total cost

How to interpret the function notation

From the question, we have the following parameters that can be used in our computation:

g(x) = the cost of a stuffed giraffe.

The giraffe costs $15 and accessories cost $3.75 each.

This means that

g(5) = 33.75

Using the above as a guide, we have the following:

The statement g(5) = 33.75 means that if we purchase a stuffed giraffe and add 5 accessories to it, the total cost will be $33.75.

Read more about function at

https://brainly.com/question/28277110

#SPJ1

Solve using the quadratic f -9d^(2)+6=-6d Write your answers as intec form, or decimals rounded

Answers

The answer to the quadratic equation -9d^(2)+6=-6d is 11/20 and -11/20. To solve the given quadratic equation f -9d^(2)+6=-6d, we need to rearrange the terms and use the quadratic formula.

Step 1: Rearrange the terms to get the equation in the standard form of ax^(2) + bx + c = 0
-9d^(2) + 6d + 6 = 0

Step 2: Identify the values of a, b, and c.
a = -9
b = 6
c = 6

Step 3: Use the quadratic formula to find the solutions for d.
The quadratic formula is given by:

d = (-b ± √(b^(2) - 4ac))/(2a)

Substitute the values of a, b, and c into the formula:

d = (-(6) ± √((6)^(2) - 4(-9)(6)))/(2(-9))

Step 4: Simplify the expression inside the square root:

d = (-(6) ± √(36 + 216))/(-18)

d = (-(6) ± √(252))/(-18)

Step 5: Simplify the expression further:

d = (-(6) ± 15.87)/(-18)

Step 6: Solve for d using both the positive and negative values inside the square root:

d = (-(6) + 15.87)/(-18) = 0.55

d = (-(6) - 15.87)/(-18) = -0.55

So, the solutions for d are 0.55 and -0.55 or 11/20 and -11/20 using the quadratic formula to solve the given quadratic equation.

Know more about quadratic formula here:

https://brainly.com/question/11540485

#SPJ11

Choose the sample size and significance level that will lead to a test having the highest power. N=20 n=60 n=120 a=0. 01 a=0. 05 a=0. 10

Answers

The sample size of N=120 and significance level of α=0.01 would be the most likely to lead to the highest power.

To maximize statistical power, we want to select the sample size and importance degree in order to maximize the likelihood of detecting a real effect if one exists. Better pattern size and a decreased importance degree each tend to increase statistical energy.

Assuming a -tailed test and equal variances, we will use a power analysis to determine the sample size needed to acquire a favored degree of power. Based totally on the impact size we count on to examine, we will estimate the minimum sample size required for the take look to have 80% energy (that is regularly considered acceptable).

For instance, if we count on a small impact length (d=0. 2) and an importance level of α=0. 05, we might need a pattern size of about n=128 to reap 80% power. Growing the sample length in addition would retain increased strength, however, the marginal returns could diminish.

As for significance level, lower alpha degrees tend to cause higher strength due to the fact they lessen the possibility of a type I error (false wonderful), which frees up extra of the kind I error rate for detecting genuine outcomes. However, excessively low alpha tiers can boom the chance of kind ii errors (fake negatives), which decreases strength.

Learn more about sample size:

brainly.com/question/25894237

#SPJ4

Can the sides of a triangle have lengths 1, 11, and 11?

Answers

Answer:

yes

Step-by-step explanation:

there is a theorem that states that two sides of a triangle should be greater than its third which is true in this case

1+11=12  (12>11)

11+1=12  (12>11)

11+11=22 (22>1)

To calculate $51^2$, Alex mentally figures the value $50^2$ and adds 101. Alex subtracts a number from $50^2$ to calculate $48^2$. What number does she subtract?

Answers

Alex want to subtract 196 from . So here we have to know about basic mathematical calculation.

What is calculation?

Calculation is a mathematical process we take one or more input to get one or more output. For this we uses various operations like Addition , Subtraction, Multiplication, Division, Percentage etc.

In addition we add one or more no to other and get output.

Example : 5 + 4 + 6 = 15

In addition we subtract smaller by the bigger no.

Example : 5 -4 = 1

In Multiplication we multiply two or more number to get output.

Example : 5 x 4 x 6 = 120

In division we divide smaller number by the big one to take output.

Example : 12 / 6 = 2

So , In question, [tex]50^{2} - 48^{2} =196[/tex]

So, My answer is 196.

To learn more about Percentage, visit:

brainly.com/question/24877689

#SPJ9

The bar graph shows the results of spinning a spinner 100 times. Use the bar graph to find the experimental probability of spinning a number less than 3.

Answers

The experimental probability of spinning a number less than 3 is given as follows:

0.38.

How to calculate a probability?

A probability is calculated as the division of the desired number of outcomes by the total number of outcomes in the context of a problem/experiment.

The outcomes for this problem are given as follows:

Total outcomes: 100 outcomes.Desired outcomes: 20 + 18 = 38 outcomes in which a number less than 3 was spun.

Hence the experimental probability of spinning a number less than 3 is given as follows:

p = 38/100

p = 0.38.

Missing Information

The bars are given as follows:

1 = 20.2 = 18.3 = 22.4 = 21.5 = 19.

More can be learned about probability at https://brainly.com/question/24756209

#SPJ1

Let f(x)=2x+2 and g(x)=2x^2 +2x After simplifying, (f∘g)(x)=." Let f(x)=1/x-2 and g(x)=3/x +2. Find the following functions. Simplify your answers. f(g(x))= g(f(x))=

Answers

The function  f(g(x)) = x/(3+2x)-2 and g(f(x)) = (-x+2)/(1-2x) after simplifying.

The composition of two functions f and g is denoted by (f∘g)(x) and is defined as f(g(x)). In other words, we apply the function g to the input x, and then apply the function f to the result.

For the first part of the question, let f(x)=2x+2 and g(x)=2x²+2x. To find (f∘g)(x), we apply g(x) to the input x and then apply f(x) to the result:

(f∘g)(x) = f(g(x)) = f(2x²+2x) = 2(2x²+2x)+2 = 4x^2+4x+2

So, (f∘g)(x) = 4x^2+4x+2 after simplifying.

For the second part of the question, let f(x)=1/x-2 and g(x)=3/x+2. To find f(g(x)), we apply g(x) to the input x and then apply f(x) to the result:

f(g(x)) = f(3/x+2) = 1/(3/x+2)-2 = 1/(3+2x)/x-2 = x/(3+2x)-2

To find g(f(x)), we apply f(x) to the input x and then apply g(x) to the result:

g(f(x)) = g(1/x-2) = 3/(1/x-2)+2 = 3x/(1-2x)+2 = (3x+2-4x)/1-2x = (-x+2)/(1-2x)

So, f(g(x)) = x/(3+2x)-2 and g(f(x)) = (-x+2)/(1-2x) after simplifying.

learn more about of function here

brainly.com/question/28992757

#SPJ11

olve by Trinomial Factor (a)>(1) ob 22, 8:45:09 AM olve the quadratic by factoring. 3x^(2)+1=-25x-7 Answer: x

Answers

The solutions to the quadratic equation are x = -1/3 and x = -8.

To solve the quadratic equation 3x^2 + 1 = -25x - 7 by factoring, we first need to rearrange the equation so that all the terms are on one side of the equal sign:

3x^2 + 25x + 8 = 0

Next, we need to find two numbers that multiply to give us 8 (the constant term) and add to give us 25 (the coefficient of the x term). These numbers are 20 and 1, so we can factor the trinomial as follows:

(3x + 1)(x + 8) = 0

Now we can use the zero product property to set each factor equal to zero and solve for x:

3x + 1 = 0 or x + 8 = 0

x = -1/3 or x = -8

So the solutions to the quadratic equation are x = -1/3 and x = -8.

Learn more about quadratic equation

brainly.com/question/30098550

#SPJ11

Mrs. Beck buys 48 pieces of house siding. Each piece is 3.7 meters long.

Part A
Which equation represents the best estimate for the total length of siding Mrs. Beck buys?

Answers

The equation which represents the total length of the siding is given by A , where A = 50 x 4 = 200 meters

What do you mean by an Equation?

Equations are statements in mathematics that have two algebraic expressions on either side of the equals (=) sign.

It displays the similarity of the connections between the phrases on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are examples of the parts of an equation. When creating an equation, the "=" symbol and terms on both sides are necessary.

Given data ,

Let the total length of the siding be represented as A

Now , the value of A is

Let the number of pieces be n = 48 pieces

Let the length of each piece be l = 3.7 meters

Now , total length of the siding A = number of pieces x length of each piece

On simplifying the equations , we get

The total length of siding A = 48 x 3.7 = 177.6 meters

Now , n ≈ 50 pieces

l ≈ 4 meters

So , total length of siding A = 50 x 4 = 200 meters

Hence , the equation is A = 50 x 4 = 200 meters

To learn more about equations click :

https://brainly.com/question/10413253

#SPJ9

(1) Compute the following calculations: (a) 2 + 3i + 4 - 3i. (b) (3 + 2i)(1 - i). (c) 2 + 3i - (1 - i). (d) 2+3i / 1-i
(2) Suppose that f(x) is a polynomial. Suppose that x = 1 – 3i, x = 2 and x = 4 are roots of f(x). find of f(x).

Answers

1) a. 6     b. 5 - i     c. 1 + 4i    d.  -0.5 + 2.5i

2) x^3 - (7 - 3i)x^2 + (14 - 6i)x - (8 - 24i).

(1)
(a) 2 + 3i + 4 - 3i = 6 + 0i = 6


(b) (3 + 2i)(1 - i) = 3 + 2i - 3i - 2i^2 = 3 - i + 2 = 5 - i


(c) 2 + 3i - (1 - i) = 2 + 3i - 1 + i = 1 + 4i


(d) 2+3i / 1-i = (2+3i)(1+i) / (1-i)(1+i) = (2+2i+3i+3i^2) / (1-i+i-i^2) = (2+5i-3) / (1+1) = (-1+5i) / 2 = -0.5 + 2.5i


(2)

If x = 1 – 3i, x = 2, and x = 4 are roots of f(x),

then we can write f(x) as:
f(x) = (x - (1 - 3i))(x - 2)(x - 4)


Multiplying these factors out, we get:


f(x) = (x^2 - (1 - 3i)x - 2x + 2(1 - 3i))(x - 4)
f(x) = (x^2 - (3 - 3i)x + 2 - 6i)(x - 4)
f(x) = x^3 - (7 - 3i)x^2 + (14 - 6i)x - (8 - 24i)
So, the polynomial f(x) is x^3 - (7 - 3i)x^2 + (14 - 6i)x - (8 - 24i).

Learn more about polynomial

brainly.com/question/11536910

#SPJ11

NEEEED HELP NOWWWW!!!!!!!
. A circle centered at (0, 0) has a radius of 10. Point S on the circle has an x-coordinate of 6. What is the y-coordinate of point S? Explain your reasoning

Answers

Answer:

See explanation below

Step-by-step explanation:

S has x-coordinate of 6 => the distance from origin to x-coordinate is 6 units, which is one leg of the right triangle

Pythagorean theorem states that the sum of the squares on the legs of a right triangle is equal to the square on the hypotenuse.

c^2 = a^2 + b^2

with c = 10, a = 6

10^2 = 6^2 + b^2

b^2 = 100 - 36 = 64

b = √64 = 8

Point S can have 2 y-coordinates, one (+) and one (-) depending on the location of point S, so S can be either (6,8) or (6,-8)

Which is it????????////]//////.

Answers

The equation that represents the line of best fit for the scatterplot is given as follows:

B. y = -10x + 100.

How to define the linear function?

The slope-intercept definition of a linear function is given as follows:

y = mx + b.

In which:

m is the slope, representing the rate of change.b is the intercept, representing the value of y when x = 0.

From the graph, we have that:

The slope is negative, as when the input increases, the output decreases.The intercept is a value between 90 and 100, as there are two points on the graph when x = 0, (0, 90) and (0,100).

Hence option B is correct.

More can be learned about line of best fit at https://brainly.com/question/1441182

#SPJ1

if juan's taxi fare was $7.65 how many miles did he travel in the taxi

Answers

The number of miles travelled by Juan is 28 miles.

What is an equation?

An equation is a mathematical statement that shows that two mathematical expressions are equal.

For example, 3x + 5 = 14 is an equation, in which 3x + 5 and 14 are two expressions separated by an 'equal' sign.

Given that, a taxi fare is given by an expression, F = 2.25+0.20(m-1), where F is the taxi fare and m is the number of miles traveled,

We need to find the number of miles if the taxi fare is $7.65

Put F = 7.65 in equation given to find the value of m,

7.65 = 2.25+0.20(m-1)

5.4 = 0.20(m-1)

m-1 = 5.4 / 0.2

m-1 = 27

m = 28

Hence, the number of miles travelled by Juan is 28 miles.

Learn more about equations, click;

https://brainly.com/question/29657988

#SPJ1

The two legs of a right triangle are 11 inches and 24 inches.
Find the hypotenuse of the triangle

Answers

To find the hypotenuse of a right triangle, we can use the Pythagorean theorem, which states that the square of the hypotenuse is equal to the sum of the squares of the other two sides. The formula for the Pythagorean theorem is:
c^2 = a^2 + b^2
Where c is the hypotenuse, and a and b are the other two sides of the triangle.

In this case, we are given the lengths of the two legs of the triangle, 11 inches and 24 inches.
We can plug these values into the formula and solve for the hypotenuse:
c^2 = 11^2 + 24^2
c^2 = 121 + 576
c^2 = 697
c = √697
c ≈ 26.4 inches

Therefore, the hypotenuse of the triangle is approximately 26.4 inches.

To know more about hypotenuse refer here:

https://brainly.com/question/29407794

#SPJ11

5.24. Exercise. Make a ruler-and-compass construction of the lines tan- gent to a given circle that pass thru a given point.

Answers

Precise and accurate in your construction, using the ruler and compass correctly to create the desired lines.

To make a ruler-and-compass construction of the lines tangent to a given circle that pass through a given point, follow these steps:

1. Draw the given circle using a compass.
2. Mark the given point on the paper with a pencil.
3. Place the point of the compass at the given point and extend the compass until it touches the edge of the circle.
4. Draw a circle with the compass. This circle will intersect the given circle at two points.
5. Use a ruler to draw a line from the given point to each of the intersection points. These lines are the tangent lines to the given circle that pass through the given point.
6. Label the tangent lines and the given point for clarity.

By following these steps, you can create a ruler-and-compass construction of the lines tangent to a given circle that pass through a given point. Remember to be precise and accurate in your construction, using the ruler and compass correctly to create the desired lines.

Learn more about  ruler-and-compass

brainly.com/question/14811499

#SPJ11

Kehlani is trying to find the height of a radio antenna on the roof of a local building. She stands at a horizontal distance of 24 meters from the building. The angle of elevation from her eyes to the roof ((point AA)) is 20^{\circ} ∘ , and the angle of elevation from her eyes to the top of the antenna ((point BB)) is 41^{\circ} ∘ . If her eyes are 1.51 meters from the ground, find the height of the antenna ((the distance from point AA to point BB)). Round your answer to the nearest tenth of a meter if necessary.

Answers

The antenna's height is 12.1 meters, as stated throughout the announcement.

What does building type mean?

Building type refers to a grouping of buildings according to their purpose, location, and style that serves as the standard for evaluating and categorizing variants. Buildings must be categorized as either support, civic, commercial, industrial, or residential. Any kind of fella construction is a structural. It could be anything: a dam or a bridge, for instance. In contrast, a building is a closed construction with walls and a roof. Once more, the more precise phrase is "building," although "structure" is far more generic.

Based on the graph.

[tex]$$\begin{aligned}& \overline{O H}=\overline{C D}=1.51 \mathrm{~mm} . \\& \overline{O C}=24 \mathrm{~m} . \\& \angle O C A=20^{\circ} . \quad \angle O C B=41^{\circ} .\end{aligned}$$[/tex]

In RT [tex]$\triangle A O C_,$[/tex]

[tex]$$\begin{aligned}& \tan 20^{\circ}=\frac{A_0}{O C}=\frac{A_0}{24} \\& \text { So } A_0=\tan 20^{\circ} \times 24=8.74 \mathrm{~m}\end{aligned}$$[/tex]

In Rt ΔOBC.

[tex]$$\begin{aligned}\tan 41^{\circ} & =\frac{O B}{O C}=\frac{O B}{24} \\O B & =\tan 41^{\circ} \times 24=20.86 \mathrm{~m} .\end{aligned}$$[/tex]

[tex]A B=O B-O A=20.86-8.74=12.12 \mathrm{~m} \approx 12.1 \mathrm{~m} .[/tex]

To know more about Building visit:

https://brainly.com/question/27243378

#SPJ1

Answer:

12.1

Step-by-step explanation:

I got the question right

Rosie is 6 years older than Mia. In 4 years, Rosie will be three times Mia's present age. How old is Mia now?

Answers

Answer:

Let's assume that Mia's present age is x.

According to the problem, Rosie is 6 years older than Mia, so Rosie's present age is x + 6.

In 4 years, Mia's age will be x + 4, and Rosie's age will be (x + 6) + 4 = x + 10.

The problem also states that Rosie's age in 4 years will be three times Mia's present age, so we can write the equation:

x + 10 = 3x

Simplifying this equation, we can subtract x from both sides to get:

10 = 2x

Dividing both sides by 2, we get:

x = 5

Therefore, Mia is currently 5 years old. To check, we can verify that in 4 years, Rosie will be three times Mia's age:

Rosie's age in 4 years = (5 + 6) + 4 = 15

Mia's age in 4 years = 5 + 4 = 9

Rosie's age in 4 years is indeed three times Mia's age, so our solution is correct.

Krystal throws a rappelling rope at a speed of 10 m/s down a 50 m cliff.

When will the rope hit the ground?

Use the drop-down to put the correct order to solve for when the rope will hit the ground.

Answers

With speed = 10 m/s, the rope will hit ground after 3.36 seconds.

What exactly is speed?

Speed is a measure of how fast an object is moving, usually measured in units of distance per unit time, such as meters per second (m/s) or kilometers per hour (km/h). It is a scalar quantity, meaning it only has magnitude and no direction.

Mathematically, speed is defined as the distance an object travels per unit time. The formula for calculating speed is:

Speed = Distance / Time

where Distance is the distance traveled by the object, and Time is the time taken to cover that distance.

Now,

To find when the rope will hit the ground, we can use the kinematic equation:

y = vi * t + (1/2) * a * t²

where:

y = 50 m (the height of the cliff)

vi = 10 m/s (the initial velocity of the rope)

a = 9.8 m/s² (the acceleration due to gravity, acting downward)

t = time it takes for the rope to hit the ground

We can solve for t by setting y=50 and solving for t:

50 = 10t + (1/2) * 9.8 * t²

50 = t(10 + 4.9t)

t = 50/14.9=3.36 s

Therefore, the rope will hit the ground after 3.36 seconds.

To know more about speed visit the link

https://brainly.com/question/7359669

#SPJ1

can someone please translate in whatever language u use and do the math task for me me because i am struggling​

Answers

Answer:

the paper is too blurry i would help if i could.

Step-by-step explanation:

9. The sum of the squares of n standard gaussians is known as a Chi square and denoted by xh. In other words, if Z1, Z2, ..., , Zn are independent N(0, 1) then, x2 z +Z2 ...+22 where d over = means the two sides have the same distribution, i.e. they show the same values with the same probabilities. Use the CLT to find P(xż5 > 30). The closest value is, (A) 0.18 (B) 0.24 (C) 0.20 (D) 0.22 (E) 0.16

Answers

The sum of the squares of n standard gaussians is known as a Chi square and denoted by x2. In other words, if Z1, Z2, ..., Zn are independent N(0, 1) then x2 = Z1^2 + Z2^2 + ... + Zn^2.  to use the Central Limit Theorem (CLT) to find P(x2 > 30). The closest value is (C) 0.20 The correct option is C) 0.20

The CLT states that the sum of a large number of independent and identically distributed random variables will be approximately normally distributed. In this case, the sum of the squares of n standard gaussians (x2) will be approximately normally distributed with mean n and variance 2n.

Therefore, we can standardize x2 to find the probability that it is greater than 30:

Z = (x2 - n) / sqrt(2n)

We want to find P(x2 > 30), which is equivalent to P(Z > (30 - n) / sqrt(2n)). Using the standard normal table, we can find the closest value to this probability. The closest value is (C) 0.20. Therefore, the answer is (C) 0.20.

To learn more about Central Limit Theorem here:

https://brainly.com/question/18403552#

#SPJ11

Knowledge Check Find the least common denominator of (2x)/(7x-21) and (1)/(2x-6)

Answers

The least common denominator of the two fractions (2x)/(7x-21) and (1)/(2x-6) is 14(x-3).

To find the least common denominator of the two fractions (2x)/(7x-21) and (1)/(2x-6), we need to find the least common multiple of the denominators 7x-21 and 2x-6.

Step 1: Factor the denominators.
7x-21 = 7(x-3)
2x-6 = 2(x-3)

Step 2: Identify the common factors.
Both denominators have the factor (x-3).

Step 3: Multiply the unique factors together.
7 * 2 * (x-3) = 14(x-3)

Step 4: The least common denominator is 14(x-3).

To know more about least common multiple  click on below link:

https://brainly.com/question/30060162#

#SPJ11

Gina Wilson unit7 homework 3

Answers

When two straight lines or rays intersect at a single endpoint then an angle is created. The vertex of an angle is that location where two points are come together.

What is the Supplementary angle?

The sum of angles equal to 180° is called Supplementary Angle.

Complementary Angle, Sum of the angle is equal to 90°.

a. (10x + 7) + (4x + 5) = 180 ( Supplementary angle )

14x + 12 = 180

14x = 180 -12

x = 12

10x + 7 = 127°

4x + 5 = 53°

c. (5x -11) + (8x -3) = 90 ( Complementary Angle )

13x - 14 = 90

13x = 90 + 14

x = 8

5x - 11 = 29°

8x - 3 = 61°

To learn more about Supplementary angle , visit :

https://brainly.com/question/30759856

#SPJ1

The equation is only a good model of the relationship when the outdoor tempeture is 55

Answers

a) When the number of chirps per minute, c = 110, then the outdoor temperature is 67.5°F.

b) If outdoor temperature is, f at least 55° F, then 60 chirps we can expect to hear in a minute at that temperature.

c) The graph for linear function, f = (1/4)c + 40, is present above.

d) The cofficient of linear function/ equation represents the slope of linear equation.

A function is a relationship that exists between two variables, where one variable depends on the other.

Independent variables, are input values and represent the horizontal axis of the cartesian plane.Dependent variable: Its result is the evaluation of the function with the values of the input values. The linear relationship is of the form: f(x) = mx + b, where m is the slope of the line, b is the intersection with the y-axis, or

The linear equation is f = (1/4)c + 40 ----(1)

where, c--> the number of chirps per minute, that the tree cricket makes is linearly dependent on f.

f--> the temperature in Fahrenheit.

a) When number of chirps per minute,c = 110. We have to determine the outdoor temperature in degrees Fahrenheit. Substitute the value c = 110 in equation (1),

=> f = 1/4×110 + 40

=> f = 27.5 + 40

=> f = 67.5

So, required value is 67.5° F.

b) The outdoor temperature is, f at least 55° F, i.e., f = 55° F

Substitute f value in equation (1),

=> 55 = (1/4)c + 40

=> 55 - 40 = (1/4)c

=> (1/4)c = 15

=> c = 4× 15

=> c = 60

c) On the coordinate plane, graph that represents the relationship between the number of chirps, c and the temperature, f is attached in above figure.

d) The cofficient 1/4 in linear equation represents the slope of equation, df/dc that is change in outdoor temperature (°F) per crickets chirp in minutes. Hence, the required cofficient represents slope.

For more information about linear function, visit :

https://brainly.com/question/2248255

#SPJ4

Complete question:

In places where there are crickets, the outdoor temperature can be predicted by the rate at which crickets chirp. One equation that models the relationship between chirps and outdoor temperature is f = (1/4)c + 40, where c is the number of chirps per minute and f is the temperature in degrees Fahrenheit.

a). Suppose 110 chirps are heard in a minute. According to this model, what is the outdoor temperature?

b) The equation is only a good model of the relationship when the outdoor temperature is at least 55∘F. (Below that temperature, crickets aren't around or inclined to chirp.) How many chirps can we expect to hear in a minute at that temperature?

c) On the coordinate plane, draw a graph that represents the relationship between the number of chirps and the temperature.

d) Explain the cofficient 1/4 in equation tells us about relationship.

>
1
retest QUIZ ON VOLUMES AND CIRCLES
A triangular prism and a triangular pyramid have the same base and height. What is true about the volumes of the triangular prism
and the triangular pyramid?
OA. The triangular prism has a volume one-third the volume of the triangular pyramid.
OB. The triangular pyramid has a volume one-half the volume of the triangular prism.
OC. The triangular pyramid has a volume three times the volume of the triangular prism.
Tools
OD. The triangular pyramid has a volume one-third the volume of the triangular prism.

Answers

The  true about the volumes of the triangular prism and the triangular pyramid is D; triangular pyramid has a volume one-third the volume of the triangular prism.

What is a triangular prism?

Suppose a triangle. Now, strech it up so as to make a stack of triangles up above another. This new 3d object is called a triangular prism.

Usually, about triangular prism, we talk about the triangular prism, whose stack goes straight up, thus, we talk about a right triangular prism.

In order for us to know the volume of the triangular pyramid, first we need to know the ratio of the volume of triangular prism and the volume of the triangular pyramid.

Take a traingle as a base then take 3 triangles such that each of them are connected to one-one side of the first traingle and when they're taken together, they form a closed object, called as a triangular pyramid.

Volume of the pyramid = 1/3 volume of the prism.

Learn more about volumes of prisms here:

https://brainly.com/question/16909441

#SPJ1

The triangular pyramid has a volume one-third the volume of the triangular prism .

Correct option is D.

What is volume?

Volume is the measure of the capacity that an object holds. Volume can also be defined as the amount of space occupied by a 3-dimensional object. The volume of a solid like a cube or a cuboid is measured by counting the number of unit cubes it contains. The best way to visualize volume is to think of it in terms of the space enclosed/occupied by any 3-dimensional object or solid shape.

Given,

A triangular prism and a triangular pyramid have the same base and height.

Let the height be h unit and area of base be x square unit

Volume of triangular prism

= base area × height

= Ah cubic unit

Volume of triangular pyramid

= (1/3)× base area × height

= (1/3)Ah

= (1/3) volume of triangular prism

Hence, volume of triangular pyramid is one-third of  volume of triangular prism.

Learn more about volume here:

https://brainly.com/question/1578538

#SPJ1

Other Questions
Record yourself giving a performance of as much of "Chatter at a Royal Ball" as you cminutes if you need, and when you are ready, just click on the record button. You canREPLAY.*Note: This is a practice activity. Completing this activity will not only prepare you forimportantly, it will enhance your language ability. This activity will not count towards yo The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers?