Marisol bought a soda for $1.99 and 6 bags of chips, which cost "m" dollars each. Which equation represents
the total amont, T, that Marisol spent?

Answers

Answer 1

The equation which represents  the total amount, T, that Marisol spent is [tex]T = 1.99 + 6m[/tex]

Let the total amount spent be T.Let the cost of bags of chips be m.

Given the following data:

Cost of soda = $1.99

To find the equation which represents  the total amount, T, that Marisol spent:

Translating the word sentence into an algebraic expression, we have;

6 bags of chips = [tex]6m[/tex]

The total amount is equal to:

[tex]T = 1.99 + 6m[/tex]

Therefore, the equation which represents  the total amount, T, that Marisol spent is [tex]T = 1.99 + 6m[/tex]

Read more: https://brainly.com/question/13282374


Related Questions

the moons gravity is weaker than that of the earth

if a feather dropped on the moon falls 81.25 cm in 1 second, calculate the acceleration due to gravity on the moon, expressed in m/s/s

Answers

We want to find the moon's gravitational acceleration.

With the given information, we will see that the gravitational acceleration on the moon is: g = 1.625 m/s^2

We know that in a place with a gravitation acceleration g, if you drop something from a height H, the position equation of that object will be given by:

p(t) = (-g/2)*t^2 + H

In this case, we know that a feather falls 81.25cm in one second.

First, we can define H = 0 (because we can put the zero of the position where we want to)

Then if after one second the feather falls 81.25cm = 0.8125 meters, we need to solve:

p(1s) = -0.8125 m = (-g/2)*(1s)^2

Where the negative sign comes because the feather "falls" and we define the negative position as below.

Also notice that we did a change of units from centimeters to meters, by knowing that:

100cm = 1m

then:

81.25cm = 0.8125m

Now we just need to solve:

-0.8125 m = (-g/2)*(1s)^2

0.8125 m = (g/2)*(1s)^2

2*0.8125 m = (g)*1s^2

1.625 m = g*1s^2

(1.625 m)/(1 s^2) = g

We then can conclude that the moon's gravitational acceleration is:

g = 1.625 m/s^2

If you want to learn more,, you can read:

https://brainly.com/question/3009841

Prove the following relations: 1) (1 - cos²A) (1 + tan²A) = tan²A​

Answers

Step-by-step explanation:

(1 - cos²A)(1 + tan²A) = tan²A

1 + tan²A - cos²A - cos²A · tan²A = tan²A

1 + tan²A(1 - cos²A) - cos²A = tan²A

1 - cos²A + tan²A(sin²A) = tan²A

sin²A + tan²A(sin²A) = tan²A

sin²A (1 + tan²A) = tan²A

sin²A (sec²A) = tan²A

sin²A (1/cos²A) = tan²A

(sin²A)/(cos²A) = tan²A

tan²A = tan²A → Proved

Given that D, E, and F are the midpoints of their respective sides, and AC = 24, what’s the length of line segment DE?

Question options:

2 units

12 units

4 units

6 units

Answers

The ratio of their corresponding sides will remain constant. Then the measure of the side length DE is 12 units.

What is the triangle?

A triangle is a three-sided polygon with three angles. The angles of the triangle add up to 180 degrees.

Given that D, E, and F are the midpoints of their respective sides of the triangle and AC = 24.

Then the length of line segment DE will be

We know that the triangle ΔABC is similar to the triangle ΔDBE. Then we have

BC = 2BE

Then the ratio of their corresponding sides will be

 BE/BC = DE/AC

BE/2BE = DE/24

       DE = 24/2

       DE = 12

Then the correct option is B.

More about the triangle link is given below.

https://brainly.com/question/25813512

#SPJ1

Wes wants to spend under $15 on lunch. He decides to buy pizza slices, which cost $2.50 each and a two liter soda which costs $1.75. What is the maximum number of pizza slices Wes can buy?

Answers

The maximum number of slices of pizzas he can buy is 12


please screenshot and graph for me this makes no sense

Answers

Answer:

The x-axis

Step-by-step explanation:

This line means, the line going through [tex](1, 0)[/tex] with [tex]m=0[/tex] means there is a flat line(m=0, 0 slope) with a y-value of [tex]0[/tex] from the point given.

So, the line is [tex]y=0[/tex], i.e. the x-axis.

So, graph the x-axis and we're done!

Find four consecutive odd integers
such that twice the smallest
subtracted from three times the
largest is 63.​

Answers

Let:
x = smallest integer
x + 2 = second smallest integer
x + 4 = second largest integer
x + 6 = largest integer

Solving:
(3(x + 6)) - 2x = 63
3x + 18 - 2x = 63
x + 18 = 63
x = 45 (smallest integer)

Answer: The integers are 45, 47, 49, and 51.

Check:
(3*51) - (2*45) = 63
153 - 90 = 63
63 = 63
Are the integers consecutive and odd? Yes!

HELP PLEASESSSSDEDDnkdksksk

Answers

Answer:

x= -3

Step-by-step explanation:

The slope is -1 so starting at the y-intercept going backwards, follow the line till you find y=7 and look at the x

I don’t know but hope u have a good day and don’t let any1 ruin it

8th grade algebra pleas help

Answers

5/4 your welcome with your algebra

You save $35 a week for a year. How much do you have at the
end of the year? (Hint: Use 52 weeks
please help

Answers

35 times 52 = $1820

The length of the base of an isosceles triangle is x. The length of a leg is 5x – 3. The perimeter of the triangle is 60. Find x.
X

Answers

Answer:  x = 6

Step-by-step explanation:

The perimeter of the isosceles triangle = 2 leg + base

Since the perimeter = 60

then 60 = 2(5x - 3) + x

       60 = 10x - 6 + x

 60 + 6 = 11x

         6 = x

         

Answer: x = 6

Step-by-step Explanation:

The legs are both the same so 2(5x - 3) accounts for both. Then add x and simplify.

10x - 6 + x

11x - 6

Set equal to 60

11x - 6 = 60

11x = 66

x = 6

simplify -6/3 ÷ 2/-9​

Answers

Answer:

[tex] \frac{ - 6}{3} \times \frac{ - 9}{2} = \frac{6 \times 9}{6} = 9[/tex]

[tex] \frac{ - 6}{3} \div \frac{2}{ - 9} \\ = \frac{6}{3} \div \frac{2}{9} \\ = \frac{6}{3} \times \frac{9}{2} \\ = 2 \times \frac{9}{2} \\ = 9[/tex]

This rectangle has a perimeter of 40 meters and a length of 12 meters what is its area

Answers

Answer:

The answer is 84

Step-by-step explanation:

What would be the answer to the math equation e-mc2
(It is a subtraction sign) :)

Answers

[tex]e−mc {}^{2} [/tex]

Use the commutative property to reorder the terms

[tex]e - {c}^{2} m[/tex]

your video game scores are 64, -13, 73, -5, and 36. what were your lowest and highest scores

Answers

Answer: -13 and 64

ghjfgkhkf

Answer:

The lowest score was -13, and the highest score was 73.

Explanation:

No explanation needed.

Trey rented a truck for one day. There was a base fee of $17.95, and there was an additional charge of 96 cents for each mile driven. Trey had to pay $246.43
when he returned the truck. For how many miles did he drive the truck?
miles

Answers

Answer:

238 miles

Step-by-step explanation:

Subtract total cost with truck fee cost which makes it 228.48 then divide by the cost of each mile driven which is 96 cents, so it would be 238 miles

Hope this helps :)

I NEED HELP ASAP. BRAINLIEST TO THE CORRECT ANSWER.

Jane invests £300 at a simple interest rate of 4.5% per year. At the end of each year, Jane gives the interest to a charity Work out the least number of years it will take for the total amount given to the charity to be greater than £50. Show your workings.

Answers

Answer:

At least 4 years

Step-by-step explanation:

Simple interest is given by

I = Prt

so here, one year's interest is

I = 300(.045) = 13.5

Divide 50 by 13.5 and get 3.7 years...thus

she will need four years to donate 50...

Step-by-step explanation:

Interest Rate = (Simple Interest × 100)/(Principal × Time).

given

Principal(P) = 300

Interest Rate(I.R) = 4.5%

Simple Interest(S.I) = 50

required

Time(T)

I.R = (S.I × 100)

(P ×T)

T × I.R = (S.I × 100) ×T

I.R (P × T) × I.R

T = (S.I × 100)

(P × I.R)

= (50 × 100)

(300 × 4.5)

= 5000

1350

=3.7

Set up a proportion round to the nearest tenths. 26 is 380% of Wat number?

Answers

Answer:

10 percent is the answer

which table represents a function​

Answers

Answer:

The first one.

Step-by-step explanation:

Functions do not have repeating x values.

what is the remainder of this polynomial function?

Answers

Answer: C

Step-by-step explanation:

answerrrrrrrrrrrrrrrrrr plzzzzzzz

Answers

Answer:

X=24

Step-by-step explanation:

55-31 is 24

Answer:

x+31°=55°[alternate angle]

x=55°-31°

x=24°

answer

Simplify each expression using the properties of powers. Express your answers using only positive exponents.

Answers

Answer:

[tex] \frac{ {( - 3)}^{7} {(11)}^{9} {(13)}^{ - 3} }{ {( - 3)}^{5}(11) {(13)}^{ - 3} } \\ \\ \\ \\ \frac{ {( - 3)}^{2} {(11)}^{8} {(13)}^{ - 3} }{ {(13)}^{ - 3} } \\ \\ \\ \frac{ {( - 3)}^{2} {(11)}^{8} }{ {(13)}^{3}( \frac{1}{ {(13)}^{3} }) } \\ \\ \\ \frac{ {( - 3)}^{2} {(11)}^{8} }{1} \\ \\ \\ = {( - 3)}^{2} {(11)}^{8} [/tex]

I hope I helped you^_^

what is the answer for this 30≤x≤60.

Answers

Step-by-step explanation:

if you want it on a number line put a closed circle around the 30 and draw the line till 60 and put a closed circle.

A=D+qm, solve for q.........

Answers

Step-by-step explanation:

A=D+qm

qm = A - D

q =(A-D) /m

Answer:

q = (A - D)/m

Step-by-step explanation:

A = D + qm

A - D = qm

(A - D)/m = q

So, the solve for q is q = (A - D)/m

Find the domain and range!! ​

Answers

Answer:

Domain: [-2, ∞)

Range: [-4, ∞)

General Formulas and Concepts:

Algebra II

Coordinate Planes

Properties of coordinate planesDomain is the set of x-values that can be inputted into function f(x) Range is the set of y-values that are outputted by function f(x)Interval Notation/Inequality Notation

Step-by-step explanation:

According to the graph, we see that our x-value stretches from x = -2 to infinity. Since x = -2 is a closed dot, it is included in the domain:

[-2, ∞) or -2 ≤ x < ∞

According to the graph, we see that our y-value stretches from y = -4 to infinity. Since y = -4 is a closed dot, it is included in the range:

[-4, ∞) or -4 ≤ y < ∞

help pls i don’t know it!!!!

Answers

Hello!

Answer:

The answer is C

Step-by-step explanation:

I wrote it in to my graphing calculator

Hope this helps!

Please help me solve this ASAP

Answers

The answer is 3 in general
The answer is 3, using order of operations!

Find the product 3/5 divided 60

Answers

Answer: 1/100 or 0.01

Find the solution set of the following 1. (2x + 3)(2x – 1) = 10 2. (x + 8)^2 – 9x = 52 3. 15 + x(x + 2x) = 10 4. x(x – 4) = 32 5. 3x(x – 2) = 12x​

Answers

Answer: 12x

Step-by-step explanation:

(

2

+

3

)

(

2

1

)

=

1

0

2

(

+

8

)

2

9

=

5

2

3

1

5

+

(

+

2

)

=

1

0

4

(

4

)

=

3

2

5

3

(

2

)

=

1

2

Graph the line that represents the equation
y+2=1/2 (x+2)

Answers

Answer: your answer is correct because if you put that equation into y=mx+b form you get y=1/2x-1

so you start at -1 and go over 2 and up 1 and you woulld land on 2

so you would graph at (2,-1) i think

Which situation can be represented by the equation 4d + 5 = 29?

Answers

Answer:

d=6

Step-by-step explanation:

subtract 5 from both sides

then simplify what you get

then divide both sides by 4

then simplify to get answer

Other Questions
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. A die with 8 sides is rolled. What is the probability of rolling a number less than 3 8) Lisa and Jasmine are selling cheesecakes for a school fundraiser. Customers can buy pecancheesecakes and apple cheesecakes. Lisa sold 3 pecan cheesecakes and 7 apple cheesecakes for atotal of $130. Jasmine sold 12 pecan cheesecakes and 14 apple cheesecakes for a total of $338.Find the cost each of one pecan cheesecake and one apple cheesecake. 2. Which country began studies on bioterrorist weapons in the 1930s? Whatwas the program known as? How did other countries respond to this?3. Why is plague attractive as a bioterrorism weapon?4. How did the English use smallpox during the French and Indian War?5. Which country loaded botulism toxins into bombs? Why is botulism of lessconcern than anthrax or plague?6. What animal is tularemia most associated with? How can humans becomeinfected? In what ways might it be transferred to humans as a bioterrorismweapon?7. Why do you think countries or groups might use these diseases asbioterrorist weapons? What advantages would they have over other types why did some people turn toward democratic forms of government during this time i need help to pass math What was at the center of the Greek house?A. The family roomB. The kitchenC. The andronD. The courtyard Which quadrant point (0,2) is located in the coordinate plane