List two places (name the country and the direction; for example West of Chile or *
North of Spain) where there is a CONVERGENT boundary

Answers

Answer 1
Japan and the Philippines: Both are located in the western Pacific Ocean and the boundary between the Philippine Plate and the Pacific Plate is a convergent boundary. The Philippine Plate is subducting beneath the Pacific Plate, creating the deep Mariana Trench, which is the deepest part of the ocean.

The Andes Mountains in South America: The boundary between the South American Plate and the Nazca Plate is a convergent boundary. The Nazca Plate is subducting beneath the South American Plate, creating the Andes Mountains, which stretch over 4,300 miles along the western coast of South America.

What is a convergent boundary?

A convergent boundary is a type of tectonic boundary where two plates of the Earth's lithosphere move towards each other and collide, resulting in the deformation and destruction of the plates. This type of boundary can occur between two continental plates, between an oceanic plate and a continental plate, or between two oceanic plates.

Learn about convergent boundary here https://brainly.com/question/2007348

#SPJ1


Related Questions

Description of Entry for soil

Answers

Soil is a mixture of organic and inorganic materials that forms the uppermost layer of the Earth's crust. It is a complex, three-dimensional matrix of mineral particles, organic matter, water, air, and living organisms. Soil provides critical habitat for various microorganisms, insects, plants, and animals, making it a key component of terrestrial ecosystems.

How is soil formed?

Soil is formed through weathering, which breaks down rocks and other materials into smaller particles. Various factors, including temperature, moisture, wind, and the activities of living organisms, influence this process. Over time, layers of organic matter accumulate on the soil's surface, creating a rich environment for plant growth.

What is the function of soil?

Soil has several important functions, including supporting plant growth, regulating water flow, and cycling nutrients. It also plays a key role in carbon sequestration, helping mitigate climate change's impacts by storing carbon in the form of organic matter.

To learn more about humus, visit here:

https://brainly.com/question/19831951

#SPJ1

. What is the mole ratio of Na₂CO3 to Al₂(CO3)3?

Answers

The mole ratio of Na₂CO3 to Al₂(CO3)3 can be determined by comparing the coefficients in the balanced chemical equation for the reaction involving these two compounds.

What is mole ratio?

Mole ratio is a term used in chemistry to describe the relationship between the amount of two or more substances in a chemical reaction. It is the ratio of the number of moles of one substance to the number of moles of another substance involved in the reaction.

A mole is a unit of measurement used in chemistry to quantify the amount of a substance. One mole of any substance contains Avogadro's number of particles, which is approximately 6.02 x 10^23 particles. Therefore, a mole ratio describes the relative amounts of substances in terms of the number of moles.

The mole ratio of Na₂CO3 to Al₂(CO3)3 can be determined by comparing the coefficients in the balanced chemical equation for the reaction involving these two compounds.

However, since a reaction is not specified, I can't give you an exact answer.

Learn more about mole ratio here https://brainly.com/question/16806688

#SPJ1

Energy in Chemical Reactions II: Reflect

Write a reflective about your learning in this unit. Your reflection should be at least three sentences. Use the following sentence starters as a guide.

- I feel confident about modeling how the energy in a reaction will change, because…
- To try to make sure to consider all of the bonds involved in a change from reactants to products, one strategy I used was…
- If I am not sure about the bond, energies and potential energies in a reaction, one strategy, I can use is…
- If I am not sure about how the energy moves between the system and the surroundings in a reaction on strategy, I can use it…

Answers

Energy in chemical reactions involves the process in which it is absorbed to break bonds, and energy is evolved as bonds are made.

What is a Chemical reaction?

This is referred to as a process in which one or more substances, the reactants, are converted to one or more different substances, the products.

According to the modern view of chemical reactions, bonds between atoms in the reactants must be broken, and the atoms or pieces of molecules are reassembled into products by forming new bonds. All chemical reactions involve energy changes ad in some reactions, we are able to observe these energy changes as either an increase or a decrease.

Read more about Energy here https://brainly.com/question/19666326

#SPJ1

A solution is prepared by adding 750.0 mL of 4.00 x 10^-33 M Ce(NO3)3 to 300.0 mL of 2.00 x 10^-2 M KIO3. Will Ce(IO3)3 (Ksp = 1.9 × 10^-10) precipitate from this solution?​

Answers

Ce(IO3)3 will not precipitate from the solution.

Solution explained.

To determine if Ce(IO3)3 will precipitate from the solution, we need to calculate the concentration of Ce3+ and IO3- ions in the solution, and then use the solubility product constant (Ksp) to determine if a precipitate will form.

First, let's calculate the number of moles of Ce(NO3)3 added to the solution:

nCe(NO3)3 = (750.0 mL) (4.00 x 10^-33 mol/L) = 3.00 x 10^-30 mol Ce(NO3)3

Next, let's calculate the number of moles of KIO3 in the solution:

nKIO3 = (300.0 mL) (2.00 x 10^-2 mol/L) = 6.00 x 10^-3 mol KIO3

Since KIO3 is a strong electrolyte, it will dissociate completely in solution, giving us the same number of moles of IO3- ions:

nIO3- = 6.00 x 10^-3 mol

Since Ce(NO3)3 is also a strong electrolyte, it will dissociate completely to give us 3 times the number of moles of Ce3+ ions:

nCe3+ = 3.00 x 10^-30 mol x 3 = 9.00 x 10^-30 mol

Now, let's calculate the concentration of Ce3+ ions:

[Ce3+] = (9.00 x 10^-30 mol) / (1050.0 mL) = 8.57 x 10^-34 M

Finally, we can calculate the ion product (IP) of Ce(IO3)3:

IP = [Ce3+] [IO3-]^3 = (8.57 x 10^-34)^1 (6.00 x 10^-3)^3 = 7.34 x 10^-41

Comparing this value to the Ksp of Ce(IO3)3 (1.9 × 10^-10), we see that IP << Ksp.

Therefore, Ce(IO3)3 will not precipitate from the solution, and the solution will remain homogeneous.

Learn more about solution below.

https://brainly.com/question/17206790

#SPJ1

You have sweetened iced tea with sugar, and ice cubes are present, How many phases are present?

Answers

The number of phases present is two.

Phases present in a system

There are two phases present in sweetened iced tea with sugar and ice cubes. The first phase is the liquid phase of the tea, which contains water, sugar, and other dissolved substances.

The second phase is the solid phase of ice cubes, which contains solid water molecules. These two phases are in contact with each other, and the sugar molecules in the liquid phase are dissolved in the water molecules.

The ice cubes, being a solid, do not dissolve in the liquid phase but coexist with it in the same container.

More on phases of a system can be found here: https://brainly.com/question/30270780

#SPJ1

Calculate the number of moles of NaCl contained in 5L of a 2.2M solution.

Answers

The number of moles of NaCl contained in 5 L of a 2.2 M solution is 11 moles

How do i determine the number of moles?

The molarity of a solution gives a relationship between volume and mole of substance. The mathematical relationship is given below:

Molarity = number of mole / Volume

With the above formula, we can determine the number of mole of NaCl in the solution. Details below:

Volume of solution = 5 LMolarity of solution = 2.2 MNumber of mole of NaCl =?

Molarity = number of mole / Volume

Cross multiply

Number of mole = molarity × volume

Number of mole of NaCl = 2.2 × 5

Number of mole of NaCl = 11 moles

Thus, the number of moles of NaCl is 11 moles

Learn more about number of mole:

https://brainly.com/question/20522500

#SPJ1

Subatomic particles worksheet

Answers

Answer:

I'd be happy to help with a worksheet on subatomic particles! Here are some potential questions:

1. What are the three subatomic particles found in an atom, and what are their respective charges and locations within the atom?

2. Which subatomic particle determines the identity of an atom?

3. What is the relationship between an element's atomic number and the number of protons in its nucleus?

4. What is an isotope, and how do isotopes of an element differ from each other?

5. What is the difference between an ion and an atom?

6. Describe the process of beta decay and the subatomic particles involved.

7. What is the difference between a molecule and an atom, and how are they related?

8. What is a quark, and what role do they play in subatomic particles?

9. Explain the concept of wave-particle duality and its relevance to subatomic particles.

10. What are the four fundamental forces in the universe, and which subatomic particles are involved in each force?

Explanation:

How many moles of oxygen molecules (O2) are in 63.996 g of o2

Answers

Answer:

1.99875 or 2mols

Explanation:

use the formula moles = mass/molar mass where; the molar mass = mass number of an element

Approximately how long will it take for 75 percent of the initial amount of C25H30N3. +(aq) to react?

A. 75 sec.

B. 225 sec.

C. 300 sec.

D. 600 sec

Answers

to react will be, B. 225 Seconds

Approximately 225 sec, it will take for 75 percent of the initial amount of C[tex]_{25}[/tex]H[tex]_3[/tex]ON[tex]_3[/tex]⁺(aq) to react. Therefore, the correct option is option B.

What is absorbance?

The logarithm of a ratio of incident over transmitted radiant power throughout a sample is known as absorbance. As an alternative, absorbance can be characterized simply "the negative logarithm with one less absorptance, as determined on a homogeneous sample," for samples that scatter light.

In several technical fields, the phrase is used to describe how experimental measurement data are quantified. Although the phrase refers to measuring how much light is absorbed, it is frequently confused with measuring how much light is "lost" to either a detector system by other methods. Approximately 225 sec, it will take for 75 percent of the initial amount of C[tex]_{25}[/tex]H[tex]_3[/tex]ON[tex]_3[/tex]⁺(aq) to react.

Therefore, the correct option is option B.

To know more about absorbance, here:

https://brainly.com/question/23938376

#SPJ2

Your question is incomplete but most probably your full question was,

Approximately how long will it take for 75 percent of the initial amount of C25H30N3. +(aq) to react?

A. 75 sec.

B. 225 sec.

C. 300 sec.

D. 600 sec

I need help with the rest . I’m giving 30 points

Answers

Ammonia and phosphoric acid are the reactants for the reaction 9, for the formation of Ammonium Phosphate.

What are ionic reactions?

Ionic reaction is the reaction of ions that are anions and cations to form a compound in a medium in which they are dissolved. When ions of water-soluble salts interact with each other in aqueous medium results in the formation of water-insoluble salts.

9) 3NH₃ + H₃PO₃ → (NH₄)₃PO₄

10) CaCO₃ + HCl → CaCl₂ + H₂CO₃

11) SnO₂ + HCl → SnCl₂ + H₂O

12) Ca(OH)₂ + HNO₃ → Ca(NO₃)₂ + H₂O

13) C₃H₅O(COOH)₃ + 3KOH → C₃H₅O(COOK)₃ + 3H₂O

14) 2Mg + C₃H₅O(COOH)₃ → (C₃H₅O(COO)₃)Mg₂ + H₂

15) H₃PO₄ + 3KOH → K₃PO₄ + 3H₂O

Therefore, Ammonia and phosphoric acid are the reactants for the reaction 9, for the formation of Ammonium Phosphate.

Learn more about ionic reactions, here:

https://brainly.com/question/29556253

#SPJ1

What type of solution would you have if you have a sealed container with 100g of
water and 0.15g of dissolved CO2 at 40°C?
unsaturated
saturated
supersaturated

Answers

The type of solution would you have if you have a sealed container with 100g of water and 0.15g of dissolved CO₂ at 40°C is a saturated solution.

What is saturated solution?

A saturated solution is a solution that has dissolved as much solute as it is capable of dissolving. In a saturated solution, no more solute can be dissolved at a given temperature. We can make an saturated solution by keep on dissolving solute until no more solute can be dissolved.

Given,

mass of water = 100g

mass of dissolved CO₂ = 0.15g  

Solubility = (weight of solute ÷ weight of solvent)×100

Solubility = (0.15 ÷ 100)×100 = 0.15g

Therefore, the type of solution would you have if you have a sealed container with 100g of water and 0.15g of dissolved CO₂ at 40°C is a saturated solution.

Learn more about solutions, here:

https://brainly.com/question/30665317

#SPJ1

Answer:

saturated

Explanation:

What is the pH 0f 10^-4 moles of HCl

Answers

The answer for this question would be pH=3.0

Hope this helps :)

pH of HCl solution is 4.

What is pH?

pH may be defined as a measure of free acidity.

More precisely, pH is defined as the negative log of the hydrogen ion concentration.

                                                      pH = - log [H⁺]

The range of pH extends from zero to 14.

A pH value of 7 is neutral, because pure water has a pH value of exactly 7. Values lower than 7 are acidic; values greater than 7 are basic or alkaline.

Given,

Moles of HCl = 10⁻⁴

We know that, pH = - log [H⁺]

                         pH = - log (10⁻⁴)

                            pH = 4

                     

Therefore, H⁺ concentration in a solution with a pH of 3.75 is 1.7 × 10⁻⁴

Learn more about pH, here:

brainly.com/question/15289741

#SPJ1

What is the percent composition of magnesium hydroxide in this substance?

Answers

In magnesium hydroxide, magnesium makes up 41.7% of the compound by mass, and oxygen makes up 55.1% of the compound by mass. The remaining percentage would be hydrogen.

What is Percentage Composition?

Percentage composition refers to the relative mass of each element in a chemical compound expressed as a percentage of the total molecular mass of the compound. In other words, it is the percentage by mass of each element present in a compound.

To determine the percent composition of magnesium hydroxide in a substance, we need to know the mass of magnesium hydroxide in the substance and the total mass of the substance.

Without knowing the substance in question, we cannot determine the mass of magnesium hydroxide. However, we can use the chemical formula of magnesium hydroxide (Mg(OH)2) to calculate the mass percent of magnesium and oxygen in the compound.

The molar mass of magnesium hydroxide is:

24.31 g/mol (for Mg) + 2(15.999 g/mol) (for 2 O) + 2(1.008 g/mol) (for 2 H) = 58.32 g/mol

The mass percent of magnesium in magnesium hydroxide is:

(24.31 g/mol / 58.32 g/mol) x 100% = 41.7%

(2 x 15.999 g/mol / 58.32 g/mol) x 100% = 55.1%

Therefore, in magnesium hydroxide, magnesium makes up 41.7% of the compound by mass, and oxygen makes up 55.1% of the compound by mass. The remaining percentage would be hydrogen.

Learn more about Percentage Composition from given link

https://brainly.com/question/28984529

#SPJ1

Over the years, land used for grain production in this village has been subjected to aggressive farming practices such as over-watering and plowing. How have these activities most likely affected the land?


ANSWER PLS

Answers

Over-watering and aggressive plowing can have a variety of negative effects on the land used for crop production.

How are these activities likely to have impacted the land?

Some potential consequences of these practices include:

Soil erosion: Over-watering can cause soil erosion, which occurs when water runs off the land too quickly and carries soil particles with it. Aggressive plowing can also contribute to soil erosion by disturbing the soil structure and making it more susceptible to erosion.

Soil compaction: Aggressive plowing can compact the soil, making it more difficult for plants to grow and for water and nutrients to penetrate the soil.

Soil nutrient depletion: Over-watering can leach nutrients out of the soil, which can make it more difficult for plants to grow. Aggressive plowing can also contribute to soil nutrient depletion by disturbing the soil structure and breaking down organic matter.

Reduced biodiversity: Over-watering and aggressive plowing can reduce biodiversity by destroying habitats and reducing the number of beneficial microorganisms and insects in the soil.

Overall, these activities can have a negative impact on the health of the land and reduce its productivity over time. To mitigate these effects, it may be necessary to adopt more sustainable farming practices, such as conservation tillage and crop rotation, that help to preserve the health of the soil and maintain its productivity.

To learn more about crop production, visit: https://brainly.com/question/12775364

#SPJ1

An atom of oxygen has 10 neutrons and 10 electrons. what is its mass number?

Answers

The mass number of an atom is the sum of its number of its number of protons and number of neutrons. Hence the oxygen atom with 10 neutrons and 10 electrons has a 8 protons thus has the mass number of 18 .

What is mass number ?

Mass number if a basic measurement of an atom indicating the mass of the nucleons in the atom by their number. The mass number of an atom is the sum of its number of protons and number of neutrons.

The atomic number of an atom is the number of electrons in its neutral state. The number of electrons is equal to the number of protons in neutral state. Oxygen is 8th element having 8 protons and 8 electrons.

Oxygen can gain two electrons to achieve octet in its valence shell and can have total 10 electrons. However the number of protons is not changing. Hence if it has 10 neutrons, then its mass number is 10 +8 = 18.

Find more on mass number:

https://brainly.com/question/18803094

#SPJ9

a chemist produced 26.75 moles of potassium oxide in the lab . how many particles of potassium ocide is this ?

Answers

Answer:

1.610 x 10^25 particles

Explanation:

To calculate the number of particles in 26.75 moles of potassium oxide, we can use Avogadro's number, which relates the number of particles in a substance to its number of moles.

Avogadro's number is approximately 6.022 x 10^23 particles per mole. Therefore, we can calculate the number of particles in 26.75 moles of potassium oxide as:

26.75 moles x 6.022 x 10^23 particles/mole = 1.610 x 10^25 particles

Therefore, there are approximately 1.610 x 10^25 particles of potassium oxide in 26.75 moles of the substance.

The CCA Aquajack has a mass of 6000 kg and accelerates forward at a rate of 5.0 m/s^2. What is the force acting on the vehicle?

Answers

Answer:

F = 30,000 N

Explanation:

Newton's second law

F = m*a

F = 6000 kg * 5.0 m/s^2

F = 30,000 N

If the Antarctic plate is estimated to move 2.05 cm per year, how long did it take for the plate to move from point A to point B?

Answers

Assume that, the distance between A to B is 10 cm. Then the plate is moving 2.05 cm per year. Then it will take about 5 years to move a distance of 10 cm.

What is Antarctic plate movement ?

The continent of Antarctica, the Kerguelen Plateau, and a few isolated islands in the Southern Ocean and other nearby oceans are all part of the tectonic plate known as the Antarctic Plate.

The Antarctic plate started migrating the continent of Antarctica south to its present remote location when it split from Gondwana  which caused the continent to have a considerably colder climate. Extensional mid-ocean ridge systems almost fully surround the Antarctic Plate.

It is given that the plate moves a distance of 2.05 cm per year. Then if the distance between point A to B is 10 cm, it will take about 5 years to reach this distance.

Find more on plate movement:

https://brainly.com/question/16926233

#SPJ9

A 475 mg sample of the weak monoprotic acid dimethylglycine, N(CH3)2CH2COOH, is dissolved in some water. What is the minimum volume, in mL, of a 0. 100 M calcium hydroxide solution required to neutralize all of the acid?

Answers

The minimum volume of a 0.100 M calcium hydroxide solution required to neutralize all of the dimethylglycine is 41.2 mL.

The balanced chemical equation for the reaction between dimethylglycine and calcium hydroxide is:

N(CH3)2CH2COOH + Ca(OH)2 → Ca(N(CH3)2CH2COO)2 + 2H2O

From the equation, we can see that 1 mole of dimethylglycine reacts with 1 mole of calcium hydroxide. We can use this information to calculate the amount of calcium hydroxide required to neutralize the acid.

First, we need to determine the number of moles of dimethylglycine in the sample:

molar mass of dimethylglycine = 115.13 g/mol

number of moles = 475 mg / 1000 mg/g / 115.13 g/mol = 0.00412 mol

Since 1 mole of dimethylglycine reacts with 1 mole of calcium hydroxide, we need 0.00412 mol of calcium hydroxide to neutralize the acid.

Finally, we can use the molarity of the calcium hydroxide solution to determine the volume required:

moles of Ca(OH)2 = 0.00412 mol

volume of Ca(OH)2 solution = moles / molarity = 0.00412 mol / 0.100 mol/L = 0.0412 L

Converting this to milliliters:

volume of Ca(OH)2 solution = 41.2 mL

For such more questions on Dimethylglycine

https://brainly.com/question/14772337

#SPJ4

how can i find wavelength in a wave?

Answers

Wavelength (L) is calculated using: L = gT²/2π, here g=9.8 m/s2 and T is wave period in seconds.

What is wavelength?

Wavelength of a wave describes how long the wave is and the distance from the "crest" (top) of one wave to the crest of next wave is called wavelength. We can also measure from the "trough" (bottom) of one wave to trough of next wave and get the same value for the wavelength.

We measure wavelength in following ways:

Use photometer to measure the energy of wave.

Convert energy into joules (J).

Divide energy by Planck's constant, 6.626 x 10⁻³⁴, to get the frequency of  wave.

Divide speed of light, ~300,000,000 m/s, by frequency to get wavelength.

To know more about wavelength, refer

https://brainly.com/question/10750459

#SPJ9

The 4 main components of WHMIS 2015 are worker education and training, labelling, hazard identification and product classification and safety data sheets. Ture or false

Answers

The four main components of WHMIS 2015 of the system are worker education and training, labelling, hazard identification and product classification, and safety data sheets (SDS). The correct answer is True.

WHMIS 2015 is a comprehensive system designed to ensure the safe use, handling, storage, and disposal of hazardous chemicals in Canadian workplaces. Worker education and training are essential to ensure that workers understand the hazards associated with the chemicals they use and how to work safely with them. Labelling helps to identify hazardous products and communicate the hazards to workers, while hazard identification and product classification ensure that hazardous products are properly classified and labelled.

Finally, SDS provide detailed information on the hazards of a product and the precautions that need to be taken when working with it. All of these components work together to ensure that hazardous chemicals are handled safely and that workers are protected from harm.

For such more questions on WHMIS

https://brainly.com/question/29793753

#SPJ4

how would i solve this and what would the answer be?

Answers

The mass of Fe2S3 formed would be 12.0 g

The limiting reactant is iron (Fe)

The percent yield of iron (III) sulfide would be 108.4%

Stoichiometric problem

Fe + S -> FeS

From the equation, we see that one mole of Fe reacts with one mole of S to produce one mole of FeS. To determine the mass of FeS that can be formed, we need to determine which reactant is limiting and which is in excess.

Number of moles of Fe = mass / molar mass = 7.62 g / 55.845 g/mol = 0.136 moles

Number of moles of S = mass / molar mass = 8.67 g / 32.06 g/mol = 0.27 moles

We see that Fe is limiting because there are fewer moles of Fe than S. The stoichiometry of the reaction tells us that one mole of Fe produces one mole of FeS.

The mass of FeS that can be formed is:

mass = number of moles × molar mass

mass = 0.136 moles × 87.91 g/mol (molar mass of FeS)

mass = 12.0 g

percent yield = actual yield / theoretical yield × 100%

percent yield = 13.01 g / 12.0 g × 100%

percent yield = 108.4%

More on stoichiometric problems can be found here: https://brainly.com/question/28297916

#SPJ1

If 310.71 grams of 02 are produced, how many grams of Hg will also be produced

Answers

The answer to this question depends on the reaction that is taking place.

What is reaction?

Reaction is the process of responding to a stimulus. It is an instinctive response to an event, person, object, or situation. It can be conscious or unconscious, rational or irrational. Reactions can be physical (e.g. facial expressions, body language, etc.) or mental (e.g. thoughts, feelings, beliefs, attitudes, etc.). Reactions can vary from person to person, depending on the individual's beliefs and experiences. Reaction is often used to evaluate the success of a stimulus or to measure the intensity of a response.

If the reaction involves the combination of Hg and O2, then the amount of Hg produced will be the same as the amount of O2 produced, which in this case is 310.71 grams. However, if the reaction involves the decomposition of HgO2, then the amount of Hg produced will be twice the amount of O2 produced, which in this case would be.621.42 grams.

To learn more about reaction

https://brainly.com/question/25769000

#SPJ1

Pennies minted after 1982 are made of mostly zinc and are coated with a bit of copper. Describe what you would have to do to find the percent composition by mass of a penny. What would you need to know, and what would you do with that information

Answers

Knowing each element's mass and molar mass allows one to compute the percentage of zinc and copper that is present in a coin.

Why do you use the term "molar mass"?

The mass in grams from one mole of a chemical is its molar mass. A mole is the measurement of the number of things, such as atoms, molecules, and ions, that are present in a substance. Any material has 6.022 x 1023 molecules in a mole.

What is a molar mass, exactly?

A substance's molar mass is the volume of the material that contains one mole of the substance. Its basic definition seems to be the weight of a single mole of a substance. The atomic mass of the each substance then multiplied by the subscript of such a element inside the chemical formula to determine the molar mass.

To know more about molar mass visit:

https://brainly.com/question/22997914

#SPJ1

What is the correct answer please help

Answers

Bond A is considered to be a coordinate covalent bond because nitrogen provides a pair of electrons to be shared with hydrogen. That is option C.

What is a covalent bond?

A covalent bond is the type of bond that is formed when two different atoms share a pair of electrons in their outermost shell.

A dative or coordinate covalent bond is defined as the type of covalent bond where by the both electrons that are to be shared are supplied by the same atom.

Using ammonium for example, the pair of electrons shared between the ammonia and hydrogen ion is from the Nitrogen of ammonia.

Learn more about chemical bonds here:

https://brainly.com/question/29794367

#SPJ1

What is the molarity of a 0.5L sample of a solution that contains 60.0 g of sodium hydroxide (NaOH)

Answers

Answer:

3 mol/L

Explanation:

Molarity = No. of moles of solute/Volume of solution in L

Answer:

The molarity of the solution is 3.0 M.

Step by Step Explanation:

To find the molarity of a solution, we need to know the number of moles of solute (in this case, NaOH) and the volume of the solution.

The first step is to calculate the number of moles of NaOH in the solution:

number of moles = mass / molar mass

The molar mass of NaOH is the sum of the atomic masses of the constituent atoms:

NaOH = Na + O + H = 23.0 g/mol + 16.0 g/mol + 1.0 g/mol = 40.0 g/mol

number of moles = 60.0 g / 40.0 g/mol = 1.5 mol

Next, we need to determine the volume of the solution in liters:

volume = 0.5 L

Finally, we can calculate the molarity (M) of the solution using the formula:

Molarity = moles of solute / volume of solution

Molarity = 1.5 mol / 0.5 L = 3.0 M

Therefore, the molarity of the solution is 3.0 M.

Which one is each.

Mixture of 2 compounds, pure substance of 2 compounds, pure substance of 2 elements, mixture of an element and a compound, mixture of 2 elements.

Answers

As per the pictorial representation,the first image is of an element while the second one is that of a mixture of an element and a compound.

What is an element?

It is defined as a substance which cannot be broken down further into any other substance. Each element is made up of its own type of atom. Due to this reason all elements are different from one another.

Elements can be classified as metals and non-metals. Metals are shiny and conduct electricity and are all solids at room temperature except mercury. Non-metals do not conduct electricity and are mostly gases at room temperature except carbon and sulfur.

The number of protons in the nucleus is the defining property of an element and is related to the atomic number.All atoms with same atomic number are atoms of same element.

Learn more about element,here:

https://brainly.com/question/13025901

#SPJ1

Express 1,670,000,000 in scientific notation.

Answers

Answer:

1.67*10^9

Explanation:

Answer:1.67*10^9

Explanation:

Study the image.



Which best describes what the picture shows?

an organism
a community
a niche
a population

Answers

Answer:

No picture shown above?

3. Use the following masses of reactants and products to write balanced symbol equations.

a) 4.40 g of propane (C3H8) reacts with 16.0 g of oxygen to produce 13.2 g of carbon dioxide and 7.20 g of water.

b) 46.0 g of ethanol (C2H5OH) reacts with 112.0 g of oxygen to produce 88.0 g of carbon dioxide and 54.0 g of water.

c) 79.2 g of C14H30 is cracked to produce 40.0 g of C7H16, 17.6 g of C3H8 and 22.4 g of C₂H4.

Answers

Using the masses of reactants and products the balanced chemical equations are:

a)C₃H₈ + 5O₂ ⇒ 3CO₂ + 4H₂O

b) C₂H₅OH  + 3O₂ ⇒ 2CO₂ + 3H₂O

c) C₁₄H₃₀ ⇒ C₇H₁₆ + C₃H₈ + 2C₂H₄(cracking)

What is balanced chemical equation?

Equations are balanced when they have the same number of each element on both the reactant and product sides. Equations need to be balanced in order to express the conservation of mass rule appropriately.

To balance chemical equations, stoichiometric coefficients for the reactants and products are necessary. Because a chemical equation must adhere to the rules of conservation of mass and constant proportions, the reactant and product sides of the equation must have an equal number of atoms of each element.

What is cracking?

Long chain hydrocarbons, also known as kerogens, are complex chemical molecules that can be broken down into lighter, simpler molecules by a process called cracking. It results from the dissolution of carbon-carbon bonds. The presence of a catalyst and temperature are two elements that have a significant impact on the catalyst rate.

To know more about Conservation of mass, visit:

https://brainly.com/question/13383562

#SPJ9

Other Questions
A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math. Q: In the case of Pakistans economy, write down in your own words the implications of following two situations on the parameters (such as depreciation, population growth, productivity, saving rate) of the Solow Model.a. Situation 1: Extreme wave of Covid-19 leading towards mobility restrictions.b. Situation 2: Russian attack on Ukraine lead to more uncertainty. The company believes it will be able to hire a qualified individual for a $95,000.00 annual salary. The company pays $150.00 of each employees $400.00 monthly insurance premium. Determine the total annual salary and payroll tax expense for the employee, assuming the company does not have an IRS-approved health care plan. What happens when sample size is small and population S.D is unknown?i. Values on the Z row on the table (or Z values) can't be used.( note that Z is normal distribution)ii. we use the sample distributionA. i onlyB. i and ii onlyC. ii onlyD. None of the abov 1. Answer the following characteristics for BasidiomycotaFungi.A. ColorB. TextureC. FormD. SizeE. Starch storage (where) The monthly salary of Mr. Jha is Rs. 16,500. He spend his income in every month in the following ways:Food:- 20%, House:- 25%, Fuel:- 10%, Miscellaneous:- 15% (i) Find his monthly expenditure on each item. (ii) How much does he save every month? What advice does Pericles give to the parents of the deceased soldiers? What is the purpose of his advice? Given cost and price (demand) functions C(q) = 100q43,800 and p(q) = -29.860, what profit can the company ear by selling 40 items? It can expect to earn sin profit. (Round answer to nearest dollar) A skydiver is laying out a circular target for his next jump that has a diameter of 16 FEET. Which EXPRESSION can be used to determine the area of the target?Pls hurryyy thxxxxsss PLSSS HELP !! Sarah asked the students in her class if they had a pet cat. Of the students, 6 out of 20 had a pet cat. If there are360 students in the school, how many could be expected to have a pet cat? When in the Course of human events, it becomesnecessary for one people to dissolve the political bandswhich have connected them with another... a decentrespect to the opinions of mankind requires that theyshould declare the causes which impel them to theseparation.-Declaration of Independence,1776What does this quotation from the introduction of theDeclaration of Independence do?It explains what the rest of the document will doIt acknowledges the authority of the monarchy.OIt lists the rights that nature gives all menIt states the colonists' lack of respect for GreatBritain How many fatty acids are in a triglyceride triacylglycerol molecule? The writer wants to ensure that the organization of paragraphs effectively conveys the passages line of reasoning. In order to accomplish this goal, the fourth paragraph (sentences 11-13) should be placed Is this a complete sentence? Shutter speed creates different effects in photographs, slow shutter speeds are used for capturing details in dim light.