Jason biked 18 miles during 1.5 hours. How far would he bike in 2 hours maintaining the same speed.

Answers

Answer 1

Answer:

18.5

Step-by-step explanation:

1.5 plus 0.5 equals 2 hours so i added 18 plus 0.5 which equals 18.5 if correct please mark me brainlist if you want if not correct am very sorry. This is what i got.


Related Questions

find the value of x
help pleaee

Answers

Answer:

x = 180 - 57 - 79 = 44°

Your car uses 15 1/2 gallons of gasoline on a 310 mile trip

Answers

20.6

Explanation:
divide 310 miles by 15 gallons of gas
310/15=20.6

Rectangle ABCD has vertices A(–6, –2), B(–3, –2),
C(–3. –6), and D(–6, –6). The rectangle is translated so that the coordinates of the image are A’(–10, 1), B’(–7,1),
C’(–7, –3), and D’(–10, –3).
Which rule was used to translate the image?

Answers

Answer:

The rule is ( x - 4, y + 3)

Step-by-step explanation:

Residents in a city are charged for water usage every three months. The water bill is computed from a common fee, along with the amount of water the customers use. The last water bills for 40 neighborhood residents are displayed in the histogram below.

A histogram titled Neighborhood Monthly water bill has monthly water bill (dollars) on the x-axis and frequency on the y-axis. 100 to 125, 1; 125 to 150, 2; 150 to 175, 5; 175 to 200, 10; 200 to 225, 13; 225 to 250, 8.

Which interval contains the median water bill?

$150–$175
$175–$200
$200–$225
$225–$250

Answers

The interval which contains the median water bill is $200 - $225

The tabulated data :

Class interval ____ Frequency ___ Cummulative frequency

100 to 125, ________ 1 ___________ 1

125 to 150, 2 ______ 2 ___________3

150 to 175, 5 _______5 ___________8

175 to 200, 10 ______10 __________18

200 to 225, 13 _____13 __________ 31

225 to 250, _______ 8 __________40

The median class = Cummulative frequency / 2

The median class = 40 / 2

The class interval which contains the 20th frequency.

This is the 200 - 225 class

The interval which contains the median water bill is $200 - $225

Learn more : https://brainly.com/question/300591

Which of the following is three dimensional and indefinitely large ?

Answers

Complete question is;

Which of the following is three-dimensional and infinitely large?

A. A solid

B. A line

C. A plane

D. Geometric space

Answer:

D. Geometric space

Step-by-step explanation:

The answer is option D.

A one dimensional object has only length, a two dimensional object has length and breadth, while a 3 dimensional object has length, breadth and depth.

Thus, a line is a one dimensional object because it has just length.

A plane is a two dimensional object.

While a solid and geometric space are both 3 dimensional objects.

However, solid is finitely large while geometric space is infinitely large.

FSA Mathematics Practice Test Questions
Session 1
2.
What fraction is represented by point A on the number line shown?

Answers

There is no number line shown...
Brainliest would be nice

Which statements are true about the functions. Picture attached

Answers

Answer:

Option 1, 3, 4 are true

Step-by-step explanation:

Answer:

statement 1 3 and 4 are correct

A class contains 6 students with black hair, 8 with brown hair, 4 with blonde hair, and 2 with red hair.

Answers

Answer:

Step-by-step explanation:

If this class contains these types of hair color THEN the class will have

3/10 kids with black hair

1/10 kids have red hair

2/5 kids have brown hair

1/5 kids have blonde hair

_________________________

In total the class has 20 kids

It is found that the total number of students in the class is 20.

What is the unitary method?

The unitary method is a method for solving a problem by the first value of a single unit and then finding the value by multiplying the single value.

Given that class contains 6 students with black hair, 8 with brown hair, 4 with blonde hair, and also 2 with red hair.

If this class contains these types of hair colors of the students, then the class will have;

3/10 kids with black hair

1/10 kids have red hair

2/5 kids have brown hair

1/5 of kids have blonde hair

Total = 6 + 8 + 4 + 2 = 20

In total, the class has 20 students.

To learn more about the unitary method, please visit the link given below;

https://brainly.com/question/23423168

#SPJ2

The complete question is;

A class contains 6 students with black hair, 8 with brown hair, 4 with blonde hair, and 2 with red hair. What is the total number of students in the classes?

Please help Due in 3 Min!

Answers

The answer is 32 I really hope this helps with

What is the value of S3 for
20/9
20/3
65/9
65/3

Answers

Answer:

65/9

Step-by-step explanation:

Substitute 3 for the infinity sign above the sigma and solve with a calculator. Correct edge2021

Find the average of 62 ℓ, 28 ℓ, 45 ℓ and 33 ℓ.

Answers

Answer:

the average is 168

Step-by-step explanation:

Help! Will give Brainliest

Answers

Answer:

B

..................... ....

An expression is shown below:

f(x) = 2x^2 − x − 10

Part A: What are the x-intercepts of the graph of f(x)? Show your work. (2 points)

Part B: Is the vertex of the graph of f(x) going to be a maximum or minimum? What are the coordinates of the vertex? Justify your answers and show your work. (3 points)

Part C: What are the steps you would use to graph f(x)? Justify that you can use the answers obtained in Part A and Part B to draw the graph. (5 points)

Answers

Yo I got my phone call and wow

1.Charlie buys two circular pizzas.
The first pizza has a 12- The second pizza has a
inch diameter
14-inch diameter.
How much greater, in square inches, is the area of the second pizza than the first pizza?
Round your answer to the nearest tenth

Answers

Answer:

Step-by-step explanation:

Plz help this is due today i would have done it myself but i totally forgot about these so PLZ HELP AND NO LINKS AND NO GROSS PICTURES OR I REPORT.

Answers

Answer:

A,B,D

Step-by-step explanation:

What is the length of EF? (PLEASE HELP)




π

Answers

Answer: 8 pie

Step-by-step explanation:

8====>

The length of the given arc is determined as 2π.

option B is the correct answer.

What is the length of the arc EF?

The length of the arc EF is calculated by applying the formula for the length of an arc as shown below;

EF = θr

where;

θ is the angle subtended by the arcr is the radius of the sector

From the given diagram, the radius of the arc = 4, and the angle subtended by the arc = π/2

The length of the arc is calculated as follows;

EF = ( π/2 ) x 4

EF = 2π

Thus, the length of the given arc is determined by applying the formula for length of an arc.

Learn more about length of arc here: https://brainly.com/question/2005046

#SPJ1

The bedroom and office in the diagrams below are similar rectangles. The walls on the left sides in the diagram are proportional, and the walls on the top sides in the diagram are proportional. How long is the missing wall of the office (shown in red below)?

Answers

Answer:

D. 16.8

Step-by-step explanation:

The missing wall of the office would be; 16.8 feet long.

What is a proportion?

A proportion is a fraction of a total amount, and the measures are related using a rule of three.

The relations between variables, either direct or inverse proportional, can be built to find the desired measures in the problem.

We are given that bedroom and office in the diagrams below are similar rectangles.

It is given that the walls on the left sides in the diagram are proportional, and the walls on the top sides in the diagram are proportional.

Threfore, we get;

x/10 = 14 /12

Solving;

x = 14/12 (10)

x = 16.8

Hence, the value of the missing wall x is 16.8 feet.

More can be learned about proportions at;

brainly.com/question/24372153

#SPJ3

For which of the following sample sizes is the sample median most likely to be above $250,000?
A. n = 10
B. n = 50
C n = 100
D. n = 1000
E Impossible to determine without more information

Answers

Answer:

A. n=10

Step-by-step explanation:

your welcome

Answer:

n=100

Step-by-step explanation:

In a residential neighborhood, the median value of a house is $200,000. For which of the following sample sizes is the sample median most likely to be above $250,000?     That was the exact question I had on the quiz. I'm not sure why it is n=100, but I got it correct.

ANSWER THE QUESTION FOR BRAINLIEST
ANSWER THE QUESTION FOR BRAINLIEST

Answers

Answer:

-3/2

Step-by-step explanation:

the constant of variation is commonly known as k .

y/x= k

so -3/2 is your answer

Answer:

it is a

Step-by-step explanation:

Which of these situations can be represented by the opposite of -25 select all that apply

Answers

Answer:

Please give us the situations and then we can answer correctly. :)

A red die and a blue die are rolled. You win or lose money depending on the sum of the values of the two dice. If the sum is 6 or 10, you win $4. If the sum is 5, 9, or 12, you win $1. If the sum is any other value (2, 3, 4, 7, 8, or 11), you lose $2. Let X be a random variable that corresponds to your net winnings in dollars. What is the expected value of X

Answers

Answer:

The expected value of X is $0.0833.

Step-by-step explanation:

A probability is the number of desired outcomes divided by the number of total outcomes.

For each dice, there are 6 possible outcomes(values from 1 to 6). So for 2 dices, there are [tex]6^2 = 36[/tex] desired outcomes.

Desired outcomes:

Sum 5: (1,4), (2,3), (3,2), (4,1).

Sum 6: (1,5),(2,4),(3,3),(4,2),(5,1)

Sum of 9: (3,6), (4,5), (5,4), (6,3)

Sum of 10: (4,6), (5,5), (6,4)

Sum of 12: (6,6)

Probabilities:

5 + 3 = 8 outcomes in which the sum is 6 or 10, that is, 8/36 probability of winning $4.

4 + 4 + 1 = 9 outcomes in which the 5, 9, or 12, that is, 9/36 probability of winning $1.

36 - (8 + 9) = 36 - 17 = 19 remaining outcomes, that is, 19/36 probability of losing $2.

What is the expected value of X?

Multiplication of each outcome by its probability. So

[tex]E(X) = \frac{8}{36}*4 + \frac{9}{36}*1 - \frac{19}{36}*2 = \frac{8*4 + 9*1 - 19*2}{36} = \frac{32 + 9 - 38}{36} = \frac{3}{36} = 0.0833[/tex]

The expected value of X is $0.0833.

HIGH POINTS)Please help! (20 points)

Answers

Answer:

What the other person said

Step-by-step explanation:

Mr. & Mrs. Dargen spent $46.25 on a meal, about how much should they
leave for a 18% tip?

Answers

Answer:

$8.32

Step-by-step explanation:

I found one percent of 46.25 ( which was 0.4625) by dividing it by 100 then i multiplied that number by 18 in order to get how much the 18% tip would be.  From that I got 8.325 but since this is in a currency the answer would be 8.32

thats just how I do it there's other ways

10. Beth has a wooden box. The inside of the box is 5 inches wide, 8.25
inches long, and 4.5 inches tall.

Answers

Answer:

185.625in^2

Step-by-step explanation:

This is volume right?

5*8.25*4.5=

Find angle R as shown by the picture

I need an explanation
Will name brainliest

Answers

Answer: C. 39 degrees

Step-by-step explanation: Hope this help :D

Simplify.Solution may include surds
√3x²y².√2x​

Answers

√6x^3y^2

Step-by-step explanation:

Help I would love to give you a thanks

Answers

Answer:

Formula

Step-by-step explanation:

Answer:

formula because it gives you the number and tells you what to do.

Hurrry dont be bots A bag of marbles has 5 blue marbles, 3 red marbles, and 6 yellow marbles A marble is drawn from the bag at
random. How many possible outcomes are there?
BI
03
O 5
06
O 14

Answers

Answer:

14

Step-by-step explanation:

im so sorry that the other people's comments are making you feel uncomfortable :(

there are 14 marbles in total since:

5 marbles+3 marbles+6 marbles = 14 marbles

each marble has one chance of being pulled out, therefore, there are 14 different outcomes.

Airplane A is flying directly toward the airport which is 30 miles away. The pilot notices Airplane B 40 degrees to her right. Airplane B is also flying directly toward the airport. The pilot of Airplane B calculates that Airplane A is 30 degrees to his left. Based in that information, how far is Airplane B from the airport?

Answers

9514 1404 393

Answer:

  38.6 mi

Step-by-step explanation:

The law of sines applies.

  b/sin(B) = a/sin(A)

  a = b(sin(A)/sin(B)) = (30 mi)sin(40°)/sin(30°)

  a ≈ 38.6 mi

Airplane b is about 38.6 miles from the airport.

_____

We have used the usual convention that the side opposite an angle is named using the lower-case letter naming the angle. Here, the angles are named by the airplane designator (A or B).

Answer:

We have used the usual convention that the side opposite an angle is named using the lower-case letter naming the angle. Here, the angles are named by the airplane designator (A or B).

What is the area of a parallelogram that has the length of 3.5cm and the height of 2.3cm?

Answers

Area of parallelogram = bh

3.5 x 2.3
= 8.05cm
Other Questions
PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56