jamal is 8 miles away from his house.he rides his bike home toward home at a speed of 12mph how far away from home is he after a half hour

Answers

Answer 1

Answer:

2 miles

Step-by-step explanation:

12 mph would be 6 miles in a half hour

8 - 6 = 2 miles


Related Questions

Claire is working two summer jobs, making $7 per hour washing cars and making $15 per hour clearing tables. In a given week, she can work at most 9 total hours and must earn a minimum of $90. If xx represents the number of hours washing cars and yy represents the number of hours clearing tables, write and solve a system of inequalities graphically and determine one possible solution.

Answers

Claire must work 4 hours cleaning tables and 5 hours washing cars to earn more than $ 90.

Since Claire is working two summer jobs, making $ 7 per hour washing cars and making $ 15 per hour clearing tables, and in a given week, she can work at most 9 total hours and must earn a minimum of $ 90, to determine one possible solution the following calculation must be performed:

15 x 9 = 135 135 - 90 = 45 45/7 = 6.42 6 x 7 + 3 x 15 = 42 + 45 = 87 5 x 7 + 4 x 15 = 35 + 60 = 95

Therefore, at a minimum, Claire must work 4 hours cleaning tables and 5 hours washing cars to earn more than $ 90.

Learn more in https://brainly.com/question/18954219

What is the solution to the equation startroot 2n+28 endroot -4 startroot n endroot =0 n=2 n=4 n=7 n=14

Answers

the answer is 7 because yeah

Answer:

C

Step-by-step explanation:

EDGE

HELP ASAP PLEASE!!!!!!!1

Answers

I’m not sure but the third side it’s supposed to be more than the 5 and 7 and I think that the third side it’s 12 so the answer it’s A I think

Which of the following is not a real number?
O A. V-3
O B. 4
O C. 15
OD. VO

Answers

A

Step-by-step explanation:

Because it's a complex number

please help 3/4x 2 1/7

Answers

Answer:

1 17/28 or 1.6071428571429 round: 1.61 in decimal form.

What is the absolute value of -7? How far is it from zero?

Answers

It is 7 away from zero

Answer: The absolute value is -7 and is -7 far away from 0.

Step-by-step explanation:

graph 3x+6y=18 In the box below, enter the y value when x = 2.

Answers

Answer:

y = 2

Step-by-step explanation:

3x + 6y = 18

3(2) + 6y = 18

6 + 6y = 18

Since 18 - 6 = 12, y will equal 2.

6 + 6(2) = 18

6 + 12 = 18

The coordinates to graph the equation would be (2, 2).

Hope it helps!

How many miles did a plane travel if it flew
455 mph in three hours

Answers

Answer:

1,365 miles

Step-by-step explanation:

455 mph times 3 hours equals to 1,365.

Eight figures are below. Which ones are polygons?


Type your answer as a list, separated by commas. For example, if you believe A, B, and C are polygons, type A, B, C.

Answers

Answer:

A,C,D is the answer

Answer:

C. is the answer................

Which of the following points is in the solution set of y>x2+7x-14​

Answers

Answer:

Observation : No two such factors can be found !! Conclusion : Trinomial can not be factored. Equation at the end of step 1 : x2 - 7x - 14 = 0. Step 2 : Parabola, Finding the Vertex: 2.1 Find the Vertex of y = x2-7x-14

Can you help me fast!!

Answers

Answer is in a photo. I couldn't attach it here, b[tex]^{}[/tex]ut I uploaded it to a file hosting. link below! Good Luck!

bit.[tex]^{}[/tex]ly/3tZxaCQ

U would need 4ft of outdoor carpet for the hole

Find the total surface area of this cone.
Leave your answer in terms of .
15 cm
78 cm
SA = [ ? 17 cm?

Answers

Answer:

SA = 200π cm²

Step-by-step explanation:

The slant height l is the hypotenuse of the right triangle inside the cone

The triangle is an 8- 15- 17 ( Pythagorean triple ) with l = 17

Then

SA = πrl + πr²

     =(π × 8 × 17) + (π × 8²)

     = 136π + 64π

     = 200π cm²

Answer:

in the right angle triangle,

p=15cm

b=8cm

[tex]h = \sqrt{15 {}^{2} + 8 {}^{2} } \\ = \sqrt{125 + 64} \\ = \sqrt{289} \\ = 17cm \\ sa = \pi \: rl + b \\ = \pi \: 8 \times 17 + \pi \: r {}^{2} \\ = 136\pi + 64\pi \\ = 200\pi[/tex]

I really need the answer ASAP

Answers


I think it’s a but I could be wrong

Help me now or else

Answers

Answer:

the answer is C

Step-by-step explanation:

Answer:

c. -3.8

Step-by-step explanation:

i hope this helps, have a nice day :)

A survey of 11 students showed that 8 liked science, 7 liked mathematics, and 4 liked both. How many students just liked science

Answers

Answer:

4 I guess..........not sure but my answer is 4

Naman purchases 3 vases for an upcoming event for m dollars each. Each vase is charged an addition 5% sales tax. Which expressions can Naman use to express the total cost of the 3 vases? Select each correct answer. 3.05m 3(m+0.05m) 3.15m 3m + 0.05m

Answers

The two that have 0.05 in it

Write a fraction to represent the probability of rolling a two.

Answers

Answer:

1/6

Step-by-step explanation:

if you want to roll a 2 from a six sided dice then you have six different outcomes. If you want a two then you have a 1 out of six chance of getting the two

Answer:

thats id correct 1/6

Step-by-step explanation:

the possible out come of rolling a 2 out of six is 1/6

I need help please!

Answers

Answer:

Tell me you address right now!!!

Step-by-step explanation:

I am gonna call police for help!

Given YZ tangent to circle J at point y, and angle WYX=104, what is angle WXY

Answers

Answer:

Step-by-step explanation:

What is the solution to this equation?
-1.6x=80
O A X-50
Ов. х = -5
O c. X= 50
O D. X= 5

Answers

Answer:-50

Step-by-step explanation:

-1.6x=50

for x

x=50/-1.6

x=-50

how many 33 are in 232 ?​

Answers

Answer:

7

Step-by-step explanation:

so simple like that you gona divide it

-3x + 2 = -13 what is x?

Answers

Answer:

x = 5

Step-by-step explanation:

have a nice day

brainliest?

I'm not sure of the question but that's the picture

Answers

Answer:

The answer is the first one

Step-by-step explanation:

[tex]46.2 \: {ft}^{2} [/tex]

Yha it is bad question :)

I hope that is useful for you

need help with this !

Answers

Answer:

(-2,14) Hope this helps! Have a great day!!!

number 7 pls im dead I need help

Answers

Answer:

c

Step-by-step explanation:

divide the two numbers.

Identify the slope (m) and y-intercept (b): 3x + 2y = -4
1. m = 3/2 b = -4
2. m = -3/2 b = 2
3. m - 2/3 b = 4
4. m = -3/2 b = -2

Answers

Answer:

4.

Step-by-step explanation:

Derek's car averages 30 miles per gallon. Which is closest to the amount of gas he will use traveling 454.5 miles?

Answers

Answer:

15.15

Step-by-step explanation:

30(g)=454.5 miles

then solve for g

g = 15.15

Give Brainllest

Answer:15 gallons

Step-by-step explanation:

A video game that normally sells for $80 is on sale for $68. What is the percent of discount for the sale price?
A) 18%
B) 17%
C) 15%
D)12%

Answers

Answer:

C

Step-by-step explanation:

68 - 80 / 80

= - 12 / 80

= - 3 / 20

= - 15%

What is the product of ( 7 − 3 i ) × ( 4 + i ) ?

Answers

Answer: 31-5i

Step-by-step explanation:

28+7i-12i-3i^2

28-5i+3

31-5i

Answer:

31 - 5i

Step-by-step explanation:

(7 - 3i) * (4 + i)

Step 1: Multiply complex numbers 7 − 3i and 4 + i like you multiply binomials.

7 * 4 + 7i - 3i * 4 - 3i²

Step 2: By definition, i² is -1.

7 * 4 + 7i - 3i * 4 - 3 ( - 1)

Step 3: Do the multiplications.

28 + 7i - 12i + 3

Step 4: Combine the real & imaginary parts.

28 + 3 + (7 - 12)i

Step 5: Do the additions.

31 - 5i

The product of (7 - 3i) and 4 + i is 31 - 5i.

Can someone please answer this please for god's sake

Answers

Answer:

x = 36 degrees

y = 48 degrees

Step-by-step explanation:

The two given triangles are congruent

Hence, we can say that the interior angles are equal

We shall use the angle markings on each of the triangles

Using the markings, we can see that y is 48 degrees

Now, let us find the last angle measure of the first triangle

Mathematically, the sum of angles in a triangle is 180

Thus;

108 + 48 + A = 180

A = 180 - 48 - 108

A = 180 - 156 = 24

Now, the measure 2x-y is equal to this;

Hence;

2x -y = 24

2x = 24 + y

we have that y = 48

2x = 24 + 48

2x = 72

x = 72/2

x = 36 degrees

Other Questions
the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion? Which of the following is the definition of geometric sequence?A. an ordered set of numbersB. an element in a sequenceC. a sequence in which terms are given by multiplying the previous term by a common ratioD. a sequence in which terms are not given by multiplying the previous term by a common ratio escride otra vez este texto pero con los verbos en pretrito perfectoMe levanto (1) a las ocho, preparo (2) un caf y me ducho (3). Salgo (4) de casa a las 8.30, tardo (5)cuarenta minutos en llegar a la universidad; en el autobs leo (6); el autobs va (7) lleno de gente y es (8)muy incmodo.Estoy (9) en la facultad desde las 9.30 hasta las 14.00, pero no voy (10) a todas las clases porque estoy(11) cansada. Despus, como (12) con mi amiga Helena y ms tarde tomamos (13) un caf en la cafeterialde la facultad. Vamos (14)........ a la biblioteca y estudiamos (15)..un rato.Vuelvo (16) a mi casa a las 20.00; veo (17) la tele un rato, ceno (18) y juego (19) un poco con mi ordenador.Hablo (19) por telfono con mi novio y me acuesto (21) a las 24.00. Question poIn an auditorium, a charity show is conducted in order to raise at least $3,000. The auditorium canaccommodate up to 180 spectators. Tickets cost $12 for students and $20 for adults. Identify the system ofinequalities and the corresponding graph that determine whether the charity will reach its goal. Is each ion stable? Explain. Pleaaaaaaseeee10 pointsIn the playing card deck below what is the chance of pulling 4 face cards without replacing the cards in between pulls? Answer in decimal form rounded to the 6th digit after thedecimal anybody help? reporting fake answers tysm!! The match was __________ live all over the world why weren't Spanish explorations successful in North America many promoters of a hypothetical conserved gene have mostly adenines and thymines. what is the most likely reason for this high proportion of adenines and thymines?