It's easy to use our new online swim finder.simply select the swimming pool you want to visit ,....the time you want,and ...the paymebt method

Answers

Answer 1

The blanks must be filled in with the words "at" and "select." This will form the sentence "Select the swimming pool you want to visit, at the time you want, and select the payment method."

How to identify the necessary words?Reading the sentence.Understanding the context of the sentence.Identifying how to make the sentence coherent.

The first blank requires the reader to use a suitable preposition to keep the text coherent. In this case, the reader should know that to refer to time, the preposition used must be "at."

The second blank requires the reader to use context clues, understanding the concept of the sentence and the word that can fit in the sentence while maintaining that concept.

Learn more about context clues:

https://brainly.com/question/20263792

#SPJ1


Related Questions

In what way is lucas sithole unique and special

Answers

Answer:

Lucas Sithole was a unique and special artist known for his work in the medium of wood sculpture. He was a pioneering figure in the art world and was one of the first black artists in South Africa to achieve significant international recognition. Sithole's sculptures are known for their intricate designs, which often incorporate elements of traditional African art, as well as his innovative use of materials, such as the incorporation of found objects into his pieces. His work is celebrated for its combination of traditional and modern influences, as well as its powerful commentary on issues of identity, culture, and history.

Explanation:

What is the meaning of "a dreary and unforgiving haven"?

Answers

"A dreary and unforgiving haven" describes the unfavorable location of Hvalfjordur fiord in Iceland, which was considered a base by the navy due to its gloomy, harsh, and difficult conditions.

What is the location of Hvalfjordur?

Hvalfjörður is a fjord located in southwest Iceland, approximately 30 kilometers (19 miles) north of Reykjavik. The fjord is famous for its natural beauty, with high cliffs and stunning waterfalls, as well as its historical significance. During World War II, the fjord served as a base for the Allied forces, including the United States Navy, who used the location to provide protection for convoys traveling between North America and Europe. Today, the area is a popular destination for tourists who come to hike, fish, and take in the breathtaking scenery.

To learn more about Iceland, click

https://brainly.com/question/9046834

#SPJ1

You should be familiar with the different forms of argument diagrams and be able to draw or recognize the correct diagram for an extended argument passage.

Answers

By diagramming the logical connections between premises and conclusion, the structure of arguments can be more clearly analyzed.

What kinds of argument diagrams are there?

Hurley diagrams, Toulmin diagrams, regular argument diagrams, and argument maps are the four different types of argument diagrams. Let's think about a counterargument and a supporting argument each of them can represent in order to see how they differ.

What purposes do argument diagrams serve?

Description: By defining the components of an argument, breaking down arguments into their component elements, and creating diagrams to illustrate the relationships between those components, argument diagramming serves as an introduction to studying and understanding arguments.

To know more about  argument diagrams visit:-

https://brainly.com/question/14271478

#SPJ1

Brainstorm ways to intervene in the following situations. Please be detailed in explaining interventions.
• Grade Schools: Hispanic and Latino groups are increasingly moving into what was an all-White
neighborhood. Teachers notice that tensions are increasing between these groups of students and that
they rarely mix.
Workplace: A manager noted that in group meetings, the men tend to dominate the conversation and the
women have a difficult time getting a word in edgewise.
• Community: In a town where there is a great disparity of wealth, community members are arguing a great
deal over the funding a new library. One wealthy citizen is known to have said, "Just buy the books you
need. The library is for losers." Poorer members of the community are outraged.
• Peers: A group of children are ostracizing one of their peers for "dressing weird." He or she is wearing a
garment that has religious significance.

Answers

The best ways to intervene in the given situations are given below:

The Intervention and Conflict Resolution

Grade Schools:

Intervention: Organize multicultural activities and events to encourage interaction between students from different cultural backgrounds. Teach children about diversity and encourage empathy and understanding. Provide sensitivity training for teachers and staff to promote cultural competency.

Workplace:

Intervention: Implement a structured meeting format that encourages equal participation and contributions from all members. Offer training and education on unconscious biases and gender-based communication differences. Encourage and recognize women's contributions in the workplace.

Community:

Intervention: Facilitate community meetings to discuss and negotiate the library's funding and purpose. Encourage a community-based decision-making process that considers the needs of all members. Provide educational programs to promote the value of libraries and address misconceptions.

Peers:

Intervention: Educate the children about religious and cultural diversity and respect for differences. Encourage inclusivity and acceptance by promoting open communication and positive reinforcement. Provide counseling or mediation for children who exhibit bullying behaviors.

Read more about conflict resolution here:

https://brainly.com/question/24769299

#SPJ1

How does the author introduce the
event that happened in Donora,
Pennsylvania, in 1948?

Answers

Answer:

The 1948 Donora smog k*lled 20 people and caused respiratory problems for 6,000 of the 14,000 people living in Donora, Pennsylvania, a mill town on the Monongahela River 24 miles (39 km) southeast of Pittsburgh. The event is commemorated by the Donora Smog Museum.

Explanation:

why have two different types of stanzas been used to structure " Brennan on the moor"


























'

Answers

Answer:

The different types of stanzas used in "Brennan on the moor" serve different purposes in the poem. The first stanza is written in quatrains, with a rhyme scheme of ABAB, and provides a narrative introduction to the story of Brennan. The second and third stanzas, on the other hand, are written in a different form, with a different rhyme scheme (CDCD) and meter. This change in form and meter creates a shift in the mood of the poem and serves to emphasize the central theme of the poem, which is the tragic ending of Brennan's life. The use of different types of stanzas also helps to break up the narrative structure of the poem, creating a more dynamic and engaging reading experience.

Explanation:

Use at your own discretion.

identify the three degrees of comparison below

Answers

Answer:

In English grammar, there are three degrees of comparison and they are, Positive Degree of Comparison. Comparative Degree of Comparison. Superlative Degree of Comparison.

What was the soft drink Pepsi originally introduced as?​

Answers

Answer:

Pepsi was originally introduced as [tex]\purple{\sf{\underline{Brad's~ Drink}}}[/tex].

Pepsi was originally introduced as "Brad's Drink" in 1898 by Caleb Bradham, a pharmacist from New Bern, North Carolina. Bradham invented the drink as a digestive aid and originally marketed it as such. He renamed it "Pepsi-Cola" in 1899, and the drink was eventually marketed as a refreshing beverage.

Read the passage.
We’re Going to Mars!

Part A

What is a central idea of "We're Going to Mars!"?
Responses

Life on Mars will be uncomfortable because Mars is too cold for humans.

Studying Mars will help scientists learn more about Earth.

Studying Mars should take priority over other scientific studies.

Conditions on Mars are changing to become more suitable to support life.


Question 2

Part B

Which detail best supports the answer to Part A?
Responses


“It would be an important moment in the history of humanity, ranking up there with the discovery of ‘The New World’ and the moon landing.”

“If SpaceX, a private company dedicated to space travel and exploration, has any say in it, humans will reach Mars as early as 2022.”

“However, evidence suggests that life may have existed in bacterial form billions of years ago.”

“Also, studying sediments, rocks, and soils, as well as volcanoes and meteoroid impact sites, can help scientists study details of Earth’s evolution.”

Answers

The thrill and anticipation surrounding the possibility of visiting the planet Mars is the core theme of "We're Going to Mars!". The statement implies that people think it is both possible and desirable for humans to explore and colonize Mars.

What is the interest of space exploration?

The growing interest in space travel and the ongoing initiatives to advance human knowledge and capacities outside of Earth's atmosphere are both reflected in this key theme. The phrase can also be seen as a call to action, urging people to adopt the spirit of exploration and adventure that is required to accomplish such a challenging objective.

The main message of "We're Going to Mars!" is that humankind faces a big and exciting challenge in the exploration and settlement of Mars, a challenge that we should welcome with joy and optimism.

To know more about core theme, click on the link below:

https://brainly.com/question/14615432

#SPJ9

What is one of the main driving forces behind the Emancipation Proclamation?
Be sure to use evidence from the text to support your answer.

Answers

The issue of slavery persisted as one of the main causes of the battle, which ultimately prompted US President Abraham Lincoln (who represented the Northern states) to issue the renown Emancipation Proclamation.

What was the Emancipation Proclamation's primary motivation?

President Lincoln demonstrated his political acumen by cunningly defending the Emancipation Proclamation as a "fit and necessary war measure" in order to undermine the Confederacy's use of slaves in the war effort.

What justifications were there for the Emancipation Proclamation?

Lincoln finally issued the Emancipation Proclamation for what reason? to try and bolster the Union army, free the slaves, and undermine the economic might of the South. The Emancipation Proclamation also provided the Union hope when it was desperately needed, enabling them to continue fighting.

To know more about Emancipation Proclamation visit:

https://brainly.com/question/2824390

#SPJ1

What is the diet of gray wolves

Answers

they prefer to eat large hoofed mammals such as deer, elk, bison, and moose. They also hunt smaller mammals such as beavers, rodents, and hares.

Answer:

Explanation:Gray wolves hunt cooperatively in packs and are able to take down prey larger than they are including caribou, moose, deer and bison. Wolves will also occasionally catch smaller prey such as beaver, rabbit, and fish, and will sometimes eat berries. Gray wolves eat around three to four pounds of food per day.

Before the 19th Century, the "Living Room" was originally called the...

Answers

Answer:

parlour room

Explanation:

parlour room is what we called the living room in 19th

Answer:

Before the 19th Century, the "Living Room" was originally called the [tex]\purple{\sf{\underline{Parlour~ Room}}}[/tex].

Which of the following is a downside to working with slides?

They're difficult to transport.
They're difficult to see from more than a few feet away.
The audience is often distracted by slides.
Technical problems may make slides unusable.

Answers

Answer:

Explanation:

Technical problems may make slides unusable at sometimes.

Which passage from the article best supports the idea that singing in
rhythm is uncommon among animals?
A. If animals formed rock 'n' roll bands, Indris would be the lead
singers. Indris are a kind of lemur.
B. ...indris slow down the music at the end of their songs.
Humans often do the same to give the song a big finish.
C. Indris can also sing in harmony. They perform together in pairs
and big groups.
D. ...indris can keep a beat while singing. What other animals can
do that? Only birds and the indris' toe-tapping distant cousins:
people.

Answers

The passage that best supports the idea that singing in rhythm is uncommon among animals is D. "...indris can keep a beat while singing. What other animals can do that? Only birds and the indris' toe-tapping distant cousins: people." This passage explicitly states that only birds and humans, in addition to indris, are able to keep a beat while singing, implying that this is a rare ability among animals.

discuss,in two well-motivated sentences, the importance of universities conducting impact studies before admitting students for a new academic year​

Answers

Answer:

Explanation: A common solution among universities attempting to increase their student enrollment figures is analyzing, adjusting, and implementing their marketing and recruitment plans. However, efforts to achieve such goals should consider converting existing applicants that already have been admitted, but failed to enroll. According to the College Board, during the 2012–2013 academic year, colleges in the United States had a national average of below 50 percent when it came to fully enrolling admitted applicants for both selective and non-selective schools.[1] The study defined a non-selective college as a school that accepts 75 percent or more of its applicants and a selective college is one that admits 50 percent or less of its applicants. The national average for a non-selective school to ever enroll its admitted students is 41 percent; whereas for selective schools it is substantially lower at only 18 percent.[2] Such statistics can also be viewed by universities challenged with increasing enrollment as legitimate opportunities for improvement.

PART B: In Passage One, Which idea referred to in paragraph 4 provides the best context for determining the meaning of “permissive”?

A
the idea that the action of the school authorities might have been reasonable given the circumstances

B
the idea that some fears and apprehensions are not tied to specific disturbances but to a more general sense of insecurity

C
the idea that some people may be hesitant to express views that deviate from the views of the majority

D
the idea that we live in a society in which an individual has a right to express ideas that some other people may find offensive​

Answers

The  idea referred to in paragraph 4 that  provides the best context for determining the meaning of “permissive” is: D the idea that we live in a society in which an individual has a right to express ideas that some other people may find offensive​.

Which idea referred to in paragraph 4 provides the best context for determining the meaning of “permissive”?

In Passage One, the idea referred to in paragraph 4 that provides the best context for determining the meaning of "permissive" is option D.

The context in which the word permissive is used suggests that the school allowed the student to express his views without reprimand, even though some people found his ideas offensive. This suggests that the school was adopting a permissive approach to freedom of expression, allowing individuals to express views that may be controversial or offensive to others.

Learn more about permissive here:https://brainly.com/question/28133579

#SPJ1

For each section of the article, summarize Lexington's words (what Lexington says), and there describe what the writer accomplishes or does in that section. For the "says" part, write in first person, as if you were Lexington. For the "does" part, write in third person as you describe Lexington's moves as a writer. In the "main argument" section at the end, summarize
Lexington's central claim.

Answers

The key argument put forth by Lexington in his essay, 'The decline of the American summer Job' is that there is a drop in the number of summer jobs available to young people.

What does Lexington's main idea in the article?

Summer employment is declining, according to Lexington's article The Decline of the American Summer Work. The drop is seen in the 2016 data, which show that only 43% of young people were employed throughout the summer.

He makes an attempt to argue that opportunities for young people have decreased over time. The main forces behind this tendency, according to the author, are technological advancements and larger changes in the job sector. Also, more teenagers are participating in internships and other types of career-related employment over the summer, which can be more difficult and require higher levels of education and competitive experience.

To learn more about Lexington, visit:

https://brainly.com/question/30747113

#SPJ1

Many people believe that Shakespeare's play Macbeth was cursed, and that productions of the play or
saying the play's name will result in bad luck. Write an essay in which you both explain the beliefs and
details of the curse on Macbeth and evaluate the validity of this belief.

Answers

Many people in the theatre industry believe that Shakespeare's play Macbeth is cursed. It is believed that saying the name of the play inside a theatre brings bad luck, and that productions of the play are often plagued with accidents and mishaps. The origins of the curse are unclear, but there are several popular theories. Some people believe that the play's subject matter - which includes witchcraft, murder, and betrayal - has made it cursed. Others believe that the play's language and the demands it places on actors and directors have contributed to the curse.

Despite these beliefs, there is little evidence to support the idea that Macbeth is actually cursed. Many productions of the play have been successful and free from mishaps, and there are several explanations for why accidents might occur during a production of the play that have nothing to do with the supposed curse. For example, the play's themes and language are challenging, and it is possible that accidents occur simply because the actors and crew are under a lot of pressure.

Furthermore, the belief in the curse may actually be counterproductive, as it can cause people to be more anxious and fearful during productions of the play. This can lead to mistakes and accidents that might not have occurred otherwise.

Overall, while the belief in the curse of Macbeth is widespread, there is little evidence to support it. While accidents and mishaps can occur during productions of the play, these are likely due to other factors such as the play's challenging subject matter and language. The idea of the curse may actually be counterproductive, as it can cause people to be more anxious and fearful during productions, which can lead to more accidents and mistakes.

study the sentence below and and say how it differs from the initial antecedent anaphor pattern

* I turned the corner and almost stepped on it.There was a large snake in the middle of the path​

Answers

Explanation:

The sentence "There was a large snake in the middle of the path" is an example of an exophoric reference. This differs from the initial antecedent anaphor pattern because it does not refer back to a specific noun or phrase in the preceding sentence. Instead, it introduces new information that is not explicitly mentioned before in the text. In this case, the sentence introduces the presence of a large snake on the path and provides additional context to the preceding sentence, which describes the speaker's physical movement. Exophoric references are often used to establish spatial or temporal relationships between different parts of a text, and they rely on the reader's ability to infer meaning from contextual cues.

Answer:

The sentence you provided is a simple sentence that describes a particular event, in which the speaker turned a corner and almost stepped on a large snake on the path.

On the other hand, an antecedent-anaphor pattern involves the use of a pronoun (anaphor) to refer back to a previously mentioned noun (antecedent) in order to avoid repetition. For example, in the sentence "John went to the store. He bought some milk," "he" is the anaphor that refers back to "John" as the antecedent.

So, the sentence you provided differs from an antecedent-anaphor pattern in that it does not use a pronoun to refer back to a previously mentioned noun, but rather describes a new event that occurred after the initial event (turning the corner).

Explanation:

What perspective is conveyed by the playwright, Sophocles, through the following lines spoken at the end of the play?
And in the things that touch upon the Gods,
'Tis best in word of deed
To shun unholy pride;
A. The Gods will support a man if he shows pride in his work
B. Man should be proud of his devotion to the Gods.
C. A man should not be so self-righteous to think that there is no authority above him.
D. When it comes to following the decree of the Gods, actions speak louder than words.

Answers

We can see here that the perspective conveyed by the playwright, Sophocles, through the following lines spoken at the end of the play is:

C. A man should not be so self-righteous to think that there is no authority above him.

What is perspective?

Perspective refers to a particular point of view or way of looking at something. It can be influenced by a variety of factors, such as personal experiences, cultural background, beliefs, and values.

Perspective can also refer to the technique used in art to create the illusion of depth and three-dimensional space on a two-dimensional surface, such as a canvas or paper.

The lines suggest that one should not exhibit pride in a way that defies the Gods or their authority. Instead, it is best to be humble and recognize that there are higher powers that must be respected.

Learn more about perspective on https://brainly.com/question/13107415

#SPJ1

What poetic device does Yeats use in the following excerpt from "Down by the Salley Gardens"? She bid me take life easy, as the grass grows on the weirs; A. simile - a comparison of two unlike things using "like" or "as" B. onomatopoeia - a word that imitates the sound that it describes C. repetition - a repeated word or phrase that is used to emphasize a point D. personification - attributing human characteristics to something nonhuman​

Answers

C because it says grass grows which is two g’s

Read the excerpt from "Land for Free."



"Tomorrow is a very important day for our family. As you know, the name Bauer is the German word for peasant. My father was a peasant, his father was a peasant, and so were all the fathers before that. We have never been land owners, and I think it’s time to change that fact, but, sadly, my injury prevents me from racing well. You, Johann, though still a boy, are the best man for the job."



Based on this excerpt, what is Hans’s viewpoint about Johann?

Johann is capable of racing for land.
Johann is ready to have his own land.
Johann is too young to race for land.
Johann should not fear the race for land.

Answers

Answer:

Hans clearly holds Johann in high regard, believing he is the best man for the important task at hand. He recognises the potential of Johann to break away from the family's peasant roots and become a land owner. Despite Hans’ own injury preventing him from taking on this task, he is confident in Johann's ability to succeed

Explanation:

Answer:

i think the answer is A i dont fully know tho

Explanation:

on edge 2023

Does Henry provide valid reasoning for his argument that Britain's war preparations are meant for the colonists?
A.
No, because he doesn't show who the other possible enemies could be.
B.
Yes, because he uses a slippery slope argument to scare the audience.
C.
Yes, because he clearly shows the British are arming to attack the colonies.
D.
No, because he doesn't provide the evidence to support his argument.

Answers

According to Patrick Henry, the British are already preparing for war, the colonists have exhausted all options, and justice is on their (the colonists') side. These three arguments demonstrate that they must go to war.

Which of Henry's arguments do you find to be the strongest?

Henry's claim that he is willing to die for his beliefs is the one that most strongly supports his case. Speaking out against something is one thing, but putting your life in danger to uphold your beliefs is quite another.

What is the main goal of Henry's speech?

Henry admitted giving this speech with the intention of motivating Virginians to take action against British rule over the American Colonies. He also wanted to persuade the Commonwealth of Virginia.

To know more about Patrick Henry visit :-

https://brainly.com/question/511253

#SPJ1

Answer:It's B

Explanation:

What decision has the speakWhat does the speaker mean in the last two lines of the poem?

Many thrive on frugal fare / Who would perish of excesser made by the end of the poem?

Answers

It's crucial to recognize the difference between the primary concept and a summary while analyzing poetry, as well as how to identify the theme.

The poem "promises like pie crust" has a meaning, but what is it?

In the poem "Promises like Piecrust," partnerships are depicted as inevitable failures. The poem frequently brings up liberty and the difficulty to keep commitments, which may be an indication of a fear of making too many sacrifices for what seem to be insignificant gains.

What poem's message is being conveyed?

Poets are motivated to write poetry by a message. If you understand the poetry's meaning, you can find the message. Readers take away a message or piece of wisdom after reading the poem. How the reader can sum up, messaging poetry is very much influenced by the reader's perspective on a subject.

To know more about poem end visit:

https://brainly.com/question/2207837

#SPJ1

One of the most fruitful areas in which to discuss ethics is law. Consider the following.

Most states require motorcycle riders to wear helmets and for passengers in automobiles to wear seat belts.
Many cities ban smoking or vaping in indoor public places such as restaurants and even bars.
Some neighborhoods require residents to regularly keep the grass cut and maintain the appearance of their front yards.
Most cities have elaborate zoning laws that restrict what types of buildings may be constructed in a given area.
In your initial post, consider the ethics of one of the laws or regulations listed above and tell us why you believe that law is either justified or unjustified. Whether you feel the law or regulation is justified or unjustified, be sure to focus on the ethical reasoning that leads you to that belief. Because laws vary from state to state and city to city, feel free to do a little research and tell us about the local laws and regulations in your area, especially if they are unique or unusual. In your follow-up posts (at least two), reply to your fellow students or your instructor and engage in a thoughtful dialogue

Answers

I would like to talk about the ethics of one of the aforementioned laws or regulations, specifically the requirement that motorcycle riders wear helmets. Because it safeguards the rider's health and safety, I believe this law is justified.

Why Ethics is Law?

In the event of a motorcycle accident, wearing a helmet is an easy and effective way to lower the risk of serious head injuries. Even a minor head injury can have devastating long-term effects on the brain, a vital and fragile organ. The law is fostering a culture of safety and responsibility among motorcyclists by requiring riders to wear helmets.

In addition, wearing a helmet does not significantly limit a rider's ability to experience the freedom and excitement of motorcycle riding. Over the years, helmets have become more streamlined and comfortable, and there are numerous styles and protection options.

Some people contend that helmet laws restrict individual choice and freedom. However, in this instance, I believe that individual preferences should take precedence over the rider's safety and well-being. In the event of an accident, not only are motorcyclists at risk, but also other motorists and pedestrians.

To know more about Pedestrians, visit:

https://brainly.com/question/29646515

#SPJ1


"The Aims of The Spectator"
3. What moral aims are men-
tioned?
4. What does he especially wish
to do for the ladies?
"Sir Roger at Church"
1. In what ways does Addison
gently poke fun at Sir Roger?
2. How is Sir Roger a good exam-
ple to his tenants?
3. Describe Sir Roger's relations
with the chaplain.

Answers

Explanation:

The Aims of The Spectator"

The moral aims mentioned in "The Aims of The Spectator" include promoting virtue and morality, providing readers with useful knowledge and information, and improving the overall quality of writing and literature. The author states that he hopes to "correct any vice or imperfection" in society through his writing and to provide readers with a "true taste of morality."

The author especially wishes to provide the ladies with moral guidance and education, as he believes that women are often neglected in this regard. He hopes to "cultivate a female audience" and to provide women with the same opportunities for intellectual and moral development as men.

"Sir Roger at Church"

Addison gently pokes fun at Sir Roger by describing his eccentricities and quirks, such as his habit of counting the church bells and his tendency to be distracted by the children in the congregation. However, this humor is affectionate and respectful, highlighting Sir Roger's endearing qualities rather than mocking him.

Sir Roger is a good example to his tenants in several ways. He is generous and kind-hearted, providing financial support to those in need and taking a personal interest in the welfare of his tenants. He is also deeply religious, attending church regularly and supporting the local clergy.

Sir Roger's relations with the chaplain are characterized by mutual respect and affection. Sir Roger is supportive of the chaplain and values his spiritual guidance, while the chaplain admires Sir Roger's generosity and kindness. The two men have a close and affectionate relationship, which is reflected in their interactions both in and outside of church.

preposition find out

Answers

Note that the above appears like it is incomplete. However, note that "Find out" is a phrasal verb that means to discover or learn something. It consists of the verb "find" and the preposition "out."

Example: She wanted to find out what time the concert started.

What is a preposition and why is it important?

A preposition is a word that typically shows the relationship between a noun or pronoun and other words in a sentence.

It indicates location, direction, time, manner, and many other relationships. Prepositions are important because they help clarify the meaning of a sentence and make it easier to understand the relationships between the different parts of the sentence.


Note that the full question is unavailable, hence the general answer.

Learn more about prepositions:
https://brainly.com/question/4956879
#SPJ1

Please help me!

Do you think that Lord Capulet was correct in trying to impose his will on Juliet? Write an argument to support your position, AND a counter-argument to address at least one counterclaim. You must provide evidence from 3.5 articles as support. Your response should be 2 paragraphs

Answers

The evidence implies that Lord Capulet's attempts to control Juliet's life eventually resulted in tragedy, despite the fact that his actions can be considered as both well-intentioned and misguided. The balance between parental authority.

Why, in your opinion, would Lord Capulet compel Juliet to wed Paris against her will?

Response and justification Because it is the best way for Juliet to establish a more powerful social position and expand the family's influence in Verona, Lady Capulet wants Juliet to wed Paris. Women had to acquire stability through marriage at this time because they could not inherit their parents' wealth.

Lord Capulet and Juliet's dispute is about what?

Juliet and Lord Capulet argue-

Her father has threatened to disown Juliet because she won't get married. The Nurse, who also tries to persuade Juliet to wed Paris, takes care of Juliet when she begs her mother for assistance but she declines. Here, you may view the entire scene and see it being performed.

To know more about argumentative paragraph visit:

https://brainly.com/question/30773617

#SPJ1

Writing Improvement Exercises
Audience Benefits and the “You” View
YOUR TASK. Revise the following sentences to emphasize the perspective of the audience and the “you” view.
(ONLY EVEN ONES)



16. Because we have automated our mobile worker trip forms, we need all employees to use the SmartTrip travel reimbursement mobile app. This is the fastest way to be reimbursed.


17. We are issuing all our customers new chip-enabled credit cards to replace expired or lost cards and prevent increasingly costly payouts we have suffered from cyber fraud.



18. Our strict safety policy does not allow us to rent power equipment to anyone who cannot demonstrate sufficient skill in its use.



19. We’re asking that all employees fill out the online survey by April 1 so that we may develop a master schedule for summer vacations more efficiently.



20. Our app developers are excited to announce a new free app called FanMile that we believe will entice fans to share, like, and subscribe to your content.


21. To minimize the cost of having our coaches set up your team training sessions in our limited office space, we suggest conducting customized team training for your employees right in your own building.



22. We take pride in our national policy of selling name brands at discount prices. That’s why we can allow store credit, but we cannot give cash refunds on returned merchandise.
Conversational but Professional
YOUR TASK. Revise the following to make the tone conversational yet professional.

Answers

The sentences are revised to emphasize the perspective of the audience:

16. All employees must use the SmartTrip travel reimbursement mobile app as you have automated your mobile worker trip forms. This is the quickest method of reimbursement.

What is perspective in literature?

The narrator's point of view or stance on the plot's characters, events, and setting is known as perspective in literature. Perspectives might be first-person, second-person, or third-person. A protagonist or main character also serves as the narrator in first-person narratives. In fact, one method to describe news from the perspective of the audience is to consider its function in people's lives, in particular, by examining its distinct characteristics and capabilities.

17. You will issued a new chip-enabled credit cards to replace expired or lost cards and prevent increasingly costly pay-outs resulting from fraud.

18. Should you wish to rent power equipment, you must demonstrate your proficiency in its use.

19. Employees are requested to complete the attached online survey by April 1 to enable the development of a master schedule to efficiently manage their summer vacations.

20. Your content can now be shared, liked, and subscribed to via the new free app, FanMile.

21. You can now save costs on the location of your training class by having a customized class for your employees right in your own building.

22. You take pride in your national policy of selling name brands at discount prices, and hence can now receive store credit for returned merchandise.

To learn more about point of view, visit:

https://brainly.com/question/11983141

#SPJ1

REZUMAT papucul doamnei va rog dau coroana

Answers

Answer:

Question not clear

Explanation:

question not clear

Other Questions
When the Europeans arrived in Central America, most countries fell to Spanish rule except ______, which became a British colony. i need help 16 divided by 6032 full solution A jet flying at 200 m/s north accelerates at a rate of 18.2 m/s for 15 seconds. What is the jet's final velocity? The RNA sequence GGAUCUCUUGUAGAUCUGUUCUCUAAACGAAC lies in a section of the COVID-19 viral genome that sets up translation, which is the process of reading the RNA to create the proteins the virus needs to survive.(a) Use the webserver to predict the lowest energy structure of the sequence. Print out a picture of it. (b)What do you think the effect will be of the RNA being longer than the stretch you just similated? (c) Design an RNA sequence that folds into a single stem-loop. Run it through the RNAfold server and print a picture of your folded design. consider a political discussion group consists of 6 democrates, 3 republicans, and 5 independents. suppose that two group members are randomly selected, in succession, to attend the political convention. find the probability of selecting a independent then a democrat According to the Kaplan-Meier plot, amplification of more than 10 copies of myc in neuroblastoma (see fig. 4-11b), decreases disease-free survival by more than 80% post-treatment. Explain two mechanisms that may contribute to gene amplification of myc? Even though both lens cells and liver cells have numerous transcription factors that are present in both colls, the lens cell makes the crystallin protein (not albumin), whereas the liver cell makes albumin (not crystallin) Which of the following explains this cell specificity?A. Different specific transcription factors made in each cell determine which genes are expressedB. At fertilization, specific colls are destined for certain functionsC. The activators needed for expression of the crystallin gene are present in all cells.D. The promoters are different for the different genes How does the author's discussion of different death rates help readers understand the spread of the Black Death? Use evidence from the text in your responsepls i need help!! a rock rolling down a slope from rest covers a distance of 4 m in the first second. What distance will it covers in 3 sec? 5 3/10 = 5 ?/50If anyone can please help me with the rest what happened to some native Americans during the Jackson presidency ? In order for following to be consistent,-3x +4y +7z =-4-11x +24y +kz = -452x -5y -8z =9solve for k ?please show full steps Air passes over the top of an airplanewing at 170 m/s, and over the bottomat 130 m/s. What is the difference inpressure between the top andbottom of the wing? Scarlett and Roger sipped their drinks on the porch, discussing all the things they still had to do before the Easter holiday. As Roger finished her last bit of burger, he sighed, "I'm stuffed." He complained of having a burning sensation in his lower chest. "You probably ate too much. How about taking some antacid?" asked Scarlett. "I use it every time I get indigestion." Roger left to search the medicine cabinet. He eventually felt better. Roger got his body test results the next day. He glanced at them briefly and put the paper in his bag. "Maybe later I will get a better sense of what all this means," he said.'Roger's test results(at rest and fasting levels)TEST Roger's Result Normal RangeHeart rate 90 beats/min 60-100 beats/minBlood pressure 138/95 mm/Hg 120/80 mm/HgTotal cholesterol 242 mg/dL create a journal from the perspective of a citizen living in paris during the french revolution CAN SOMEONE HELP ME PLEASE ASAP write three rations that are equivalent to 6/9 Is this a function? Why or why not? Explain your reasoning for each part. How did Claudette Colvin's social status contribute to why civil rights groups didn't use her actions to inspire the bus boycott? Has your social status ever influenced the way people treat you? If so, describe the experience. According to the graph, in the United States how much land is used by cities compared to other land uses?A- Cities use one third as much of the land as forests.B- Cities use very little land compared to any other category.C- Cities use half as much land as agriculture.D- Most land is used by cities. Suppose when Sweetland (a hypothetical country) opens to trade, it imports computer software, a capital-intensive good.a. According to the HeckscherOhlin theorem, is Sweetland capital-abundant or labor-abundant? Briefly explain. (1 mark)b. What is the impact of opening trade on the real wage in Sweetland? Briefly explain. (2 marks)c. What is the impact of opening trade on the real rental on capital? Briefly explain. (2 marks).d. Which group (capital owner o