involuntary muscles work automatically, and you are not usually aware of their function. true false

Answers

Answer 1

The statement "involuntary muscles work automatically, and you are not usually aware of their function" is: True.

What are involuntary muscles?

Involuntary muscles are muscles that are not under conscious control. These muscles are responsible for actions that we do not consciously control, such as the beating of our heart, the flow of food through our digestive system, and the constriction of blood vessels. They are also known as smooth muscles.

The smooth muscle fibers of the stomach and intestines contract and move the food along by a process known as peristalsis. They also mix the food with digestive juices so that it can be broken down more easily. Smooth muscle tissue is also found in other organs like the bladder, uterus, and blood vessels.

The involuntary muscles work automatically without conscious control, such as heart rate, peristalsis, breathing, blinking, sweating, and pupil constriction.

To learn more about "involuntary muscles" here:

https://brainly.com/question/1015369#

#SPJ11


Related Questions

if an individual receives a faulty, mutated copy of a gene from his or her mother, that person will most likely acquire a genetic disorder. group of answer choices true false

Answers

If an individual receives a faulty, mutated copy of a gene from his or her mother, that person will most likely acquire a genetic disorder. This statement is true.

Genetic disorders are caused by mutations in one or more genes, which can be inherited from parents or occur spontaneously during a person's lifetime. Genes are basic units of heredity that are responsible for the transfer of characteristics from parents to offspring. Each gene is made up of a particular segment of DNA that determines the structure and function of a specific protein in the body.

A person's genetic makeup can determine their physical and behavioral characteristics, as well as their susceptibility to particular diseases. Mutations are changes that occur in the DNA sequence of a gene, resulting in a modified or disrupted protein product. Mutations can be either harmful, beneficial, or have no effect on the functioning of the body.

Mutated genes can be passed down from parents to their offspring and increase the likelihood of developing genetic disorders. To summarize, if an individual receives a mutated copy of a gene from their parents, they are more likely to acquire a genetic disorder. Hence, the given statement is true.

Learn more about the gene: https://brainly.com/question/1480756

#SPJ11

what are the the functions served by squeezing the fetus/newborn as it passes through the birth canal.

Answers

The squeezing of the fetus/newborn as it passes through the birth canal serves the functions of aiding the compression of the skull bones and facilitating the production of hormones necessary for the initiation of lactation.

Squeezing the fetus/newborn as it passes through the birth canal serves several functions. Firstly, it helps to remove fluids from the respiratory system, preparing the newborn to take its first breath. Secondly, the pressure exerted on the newborn's chest helps to expel any remaining amniotic fluid from the lungs. Thirdly, the compression of the newborn's head during delivery allows it to pass through the narrow birth canal, facilitating delivery.

Fourthly, the pressure on the newborn's body helps to stimulate the production of stress hormones, which can assist with the transition to life outside of the womb. Finally, the physical contact between the mother and newborn during delivery can promote bonding and attachment between the two.

To learn more about birth canal, here

https://brainly.com/question/31215808

#SPJ4

why do ions need membrane transport proteins to help them cross the plasma membrane?

Answers

These molecules are protected from the hydrophobic center of the membrane by facilitated transport proteins, which also provide a pathway for their passage.

They cannot, however, pass the phospholipid portion of the membrane on their own because they are charged or polar. Ions have charges, thus they require some sort of assistance to disperse through the phospholipid bilayer. They can't accomplish this on their own. There are proteins that are designed specifically to carry out specific tasks that can help the ions diffuse through the membrane because they are unable to do it on their own.

The lipid bilayer's solubility-diffusion property can be used for transport across the plasma membrane, or it can be mediated (via membrane proteins). Membrane proteins mediate ion transport (channels, carriers or pumps).

Learn more about membrane Visit: brainly.com/question/14499201

#SPJ4

why are traits such as human skin color and height not suitable for explaining the concept of simple dominance

Answers

Traits such as human skin color and height are not suitable for explaining the concept of simple dominance because they are controlled by multiple genes and are influenced by environmental factors. Simple dominance refers to the inheritance pattern of a single gene, where one allele completely masks the expression of the other allele. Skin color and height are polygenic traits, meaning they are controlled by multiple genes that interact with each other in complex ways. The expression of these traits is also influenced by environmental factors such as diet, exercise, and exposure to sunlight, which further complicates their inheritance pattern. Therefore, the concept of simple dominance does not apply to these traits.

Put the events of ventilation in a mammalian lung in order, from first to last.

Answers

The correct order of ventilation is: Inhalation > Air Distribution > Gas Exchange > Exhalation

The events of ventilation in a mammalian lung in order, from first to last are:

Inhalation: The diaphragm and external intercostal muscles contract, increasing the volume of the thoracic cavity and causing air to flow into the lungs.Air Distribution: Air travels through the bronchi and bronchioles to the alveoli, where gas exchange occurs.Gas Exchange: Oxygen diffuses from the alveoli into the capillaries surrounding the alveoli, while carbon dioxide diffuses from the capillaries into the alveoli.Exhalation: The diaphragm and external intercostal muscles relax, decreasing the volume of the thoracic cavity and causing air to flow out of the lungs.

To know more about ventilation

brainly.com/question/7017026

#SPJ4

Reinforced, threadlike pseudopods that can perform phagocytosis are generally characteristic of _____.
A) forams
B) water molds
C) dinoflagellates
D) oomycetes

Answers

Reinforced, threadlike pseudopods that can perform phagocytosis are generally characteristic of Forams.

What are pseudopods?                                                                                                                                                       Pseudopodia, also known as pseudopods, are protrusions of the cell membrane, particularly used by amoeboid cells for motility and phagocytosis. Pseudopodia are commonly used to differentiate between unicellular and multicellular organisms; the former is distinguished by its lack of cell-to-cell contact and the presence of pseudopodia.

Certain types of multicellular organisms, such as slime molds, form multinucleated amoeboids during their life cycle, while other organisms, such as animals and fungi, primarily rely on cell-to-cell contact rather than pseudopodia.

Pseudopodia are classified into four types, based on their structure and function:

LobopodiaFilopodiaReticulopodiaAxopodia.

What is phagocytosis?                                                                                                                                                           Phagocytosis, a type of endocytosis, is the process by which cells engulf and ingest other cells, debris, or molecules. It is a major mechanism utilized by the body to get rid of foreign particles such as bacteria, viruses, and dead cells. Phagocytosis is utilized by white blood cells (WBCs) for detecting and eliminating foreign substances in the body.

To know more about phagocytosis refer here:

https://brainly.com/question/11667538#

#SPJ11

which level of evidence relies on analyzing the physical traits common between organisms when developing from an embryo?

Answers

The level of evidence that relies on analyzing the physical traits common between organisms when developing from an embryo is embryology.

Embryology is the scientific study of embryos, which includes studying the early developmental stages of organisms. Embryology examines the physical characteristics that are common among organisms that develop from an embryo.

Embryos of different organisms often share many physical traits, such as the same order of developmental steps, the same basic body plan, and other similarities. By comparing the similarities between embryos of different organisms, researchers are able to gain insight into the evolutionary history of these organisms.


There are numerous fields in which embryology is useful. It is utilized in evolutionary biology, where the similarities and distinctions between organisms are used to determine evolutionary relationships between organisms. Embryology is utilized in clinical medicine to diagnose abnormalities in the early stages of pregnancy.

Embryology is the study of the development of embryos, particularly the first eight weeks after fertilization, from which point the term fetus is used. The study of embryology is useful in the medical field, particularly in the areas of anatomy and physiology, as well as developmental biology, comparative biology, and evolutionary biology.

To know more about embryology refer here:

https://brainly.com/question/13033870#

#SPJ11

The area of the brain behind the forehead that helps us to think, strategize, and control emotions is the______ O dendrites O prefrontal cortex O corpus callosum O myelination

Answers

The area of the brain behind the forehead that helps us to think, strategize, and control emotions is the prefrontal cortex. So the correct answer is the second option.

The prefrontal cortex is a part of the brain that is located at the front of the cerebral cortex. It serves as the brain's highest-level executive control center, responsible for behavioral and cognitive decision-making and social behavior. The prefrontal cortex is responsible for personality, and the ability to focus, make decisions, and communicate. The prefrontal cortex also plays a role in regulating emotions and impulsivity, as well as other forms of executive control. It is essential for planning and organizing behavior and emotions, especially in response to stressful events or external stimuli.

Learn more about prefrontal cortex: https://brainly.com/question/30562039

#SPJ11

which class of major histocompatibility molecules is specific to antigen-presenting cells?

Answers

They express MHC class II (HLA-II) molecules and include macrophages.

The immune cells that convey an antigen to a T-cell are known as professional antigen presentation cells (APCs). Dendritic cells, macrophages, B-cells, and certain activated epithelial cells are the three main types of professional APCs. They phagocytose or endocytose the antigen via receptor-mediated endocytosis before displaying a part of it on their membrane bound to a class II MHC protein. The interaction between the T cell and the antigen-class II MHC molecule complex on the membrane of the APCs causes the release of a second co-stimulatory signal, which activates the T cell.

The body's nucleated cells that express MHC-I molecules and give helper T cells antigen are represented by non-professional APCs. Professional APCs display antigens to both helper T cells and cytotoxic T cells and express both MHC-I (HLA-I) and MHC-II (HLA-II) molecules. The T-cell is often used by professional APCs to process foreign antigens. Their self-antigens are not visible. The endothelium and plasma both contain the von Willebrand factor (vWF), also known as factor VIII-related antigen. Maintaining hemostasis and playing a role in platelet adhesion.

To know more about macrophages click here:

https://brainly.com/question/29694085

#SPJ4

Fill The Blank? an allosteric effector molecule binds to ______ and cause a change in ___________.

Answers

An allosteric effector molecule binds to an enzyme and causes a change in its activity.

An allosteric effector molecule is a molecule that binds to an enzyme at a site different from the active site of the enzyme, altering the enzyme's shape and therefore its activity. An allosteric effector is a molecule that can bind to an allosteric site. An allosteric site is a region on the protein that is not the active site where effector molecules can bind. It changes the shape of the enzyme, which can either increase or decrease the enzyme's activity.

The molecule binds to a regulatory site other than the enzyme's active site in allosteric enzymes. The binding of the effector molecule results in a conformational change in the enzyme, which alters its shape, and the activity of the enzyme is affected in response to this change. Inhibitors are molecules that decrease an enzyme's activity, while activators are molecules that increase it

Allosteric inhibitors and activators have regulatory sites that differ from the active site of the enzyme. When the enzyme and the effector molecules bind, the activity of the enzyme is altered. Hence, an allosteric effector molecule binds to an enzyme and causes a change in its activity.

Learn more about allosteric effector molecule here: https://brainly.com/question/31113956

#SPJ11

Based on these cell models, which of
the following observations about DNA is
correct?
DNA is not found in cells.
DNA is larger than cells.
DNA is smaller than cells.
DNA is found outside the cell.

Answers

Answer:

DNA is smaller than cells.

Which is bigger, DNA or a gene?

DNA stands for deoxyribonucleic acid. It is the chemical name of the molecule making up our genes. One entire DNA molecule is called a chromosome. A normal human cell has 46 chromosomes, therefore 46 DNA molecules. We have 46 DNA molecules, but thousands of genes. Therefore, every chromosome contains many, many genes.

Think of it this way: one chromosome (one DNA molecule) is like a book and one gene is one page in the book.

The tails of animals can serve many important functions. They are mainly used in balance and locomotion. Many lizards have a fragile, detachable tail that will come off when they are attacked by predators, allowing them to escape.Why is the presence of a brightly colored, detachable tail an advantage for some lizards?
A. They are more likely to attract mates.
B. Predators more likely grab them by the tail:
C. It helps them blend into natural environtment
D. Predator likely to be frightened away by a brightly collored tail

Answers

The presence of a brightly colored, detachable tail is an advantage for some lizards because predators are likely to be frightened away by a brightly colored tail.                                                                                                                                The correct option is D.

What is a detachable tail?

A detachable tail is a tail that can be disconnected from the body when under pressure from a predator or other threats. This adaptation is primarily seen in lizards, which have the ability to shed their tails as a form of self-defense.

Why is the presence of a brightly colored, detachable tail an advantage for some lizards?

Bright coloration is an evolutionary adaptation that may indicate danger to potential predators. In some cases, it may help predators to avoid attacking. When a lizard's tail is brightly colored and detachable, it can be used as a defense mechanism.

The lizard can use its tail as a decoy to attract predators to the tail, which can then be shed, allowing the lizard to escape. Predators, seeing the brightly colored tail, may be frightened away by the apparent danger it represents to them.  

Another potential advantage of a brightly colored, detachable tail is that it may make it easier for the lizard to attract mates. This is because bright colors are often associated with sexual selection, which means that males with bright, attractive colors are more likely to be chosen by females during the mating process.

To know more about detachable tail refer here:

https://brainly.com/question/31180874#

#SPJ11

The chemiosmotic gradient of cellular respiration is an A) ion gradient made by the pumping of hydrogen ions across the inner membrane using the energy of electrons as they are transported down the electron transport chain. B) ion gradient made by the pumping of hydrogen ions across the outer membrane using the energy of electrons as they are transported down the electron transport chain. C) ion gradient made by the pumping of oxygen ions across the inner membrane using the energy of electrons as they are transported down the electron transport chain. D) ion gradient made by the diffusion of hydrogen ions across the inner membrane using the energy of electrons as they are transported down the electron transport chain.

Answers

The chemiosmotic gradient of cellular respiration is an (Option A) ion gradient made by the pumping of hydrogen ions across the inner membrane using the energy of electrons as they are transported down the electron transport chain.

What is chemiosmosis?

Chemiosmosis is the movement of ions from one place to another, usually across a membrane, caused by a chemical gradient. The movement of ions causes a transmembrane ion gradient, which can be utilized to generate adenosine triphosphate (ATP).

Chemiosmosis is a critical component of the electron transport chain in oxidative phosphorylation in the mitochondria. The energy released by the redox reactions is utilized to pump protons (H+) from the matrix to the intermembrane space, generating a proton gradient. The proton gradient is subsequently utilized by ATP synthase to create ATP.

Learn more about Chemiosmosis: https://brainly.com/question/29555943

#SPJ11

Which option is not a response to internal stimuil

Answers

The option that is not a response to an internal stimuli would be wearing sunglasses to protect eyes from UV rays.

In all the other options, the person who does a certain action also gets a feedback from his body which urges him to do that particular  action.

Option D is correct.

What is internal stimuli?

A stimulus is anything that can trigger a physical or behavioral change an example being the  vital signs changing due to a change in the body.

Other examples of internal stimuli includes:

a. eating when hungry

b. breathing hard when exercising because of a drop in oxygen levels

c. drinking when thirsty

Learn more about internal stimuli at:

https://brainly.com/question/25303355

#SPJ1

Complete question:

Which of these is not a response to internal stimuli?

a. eating when hungry

b. breathing hard when exercising because of a drop in oxygen levels

c. drinking when thirsty

d. wearing sunglasses to protect eyes from UV rays

Help me

The carrying capacity of a population is determined by its

A Population growth rate
B Natality
C Mortality
D Limiting factors

Answers

The carrying capacity of a population is determined by its limiting factors. Limiting factors are the environmental factors that limit the growth, distribution, or abundance of a population.

These factors include availability of resources like food, water, and shelter, competition, predation, disease, and environmental factors like temperature, rainfall, and natural disasters.

As the population size increases, the limiting factors become more pronounced and restrict the growth of the population. The carrying capacity is the maximum population size that an environment can sustain with the available resources and limiting factors.

Therefore, the carrying capacity is determined by the balance between the population growth rate, natality, and mortality rates and the availability of resources and limiting factors.

To know more about carrying capacity, visit:

https://brainly.com/question/30880725

#SPJ1

Which of the following statements about viruses Could be true? (Watch the wording carefully)A. Viruses are living because they can reproduce themselves.B. Viruses are not living because they don't evolve.C. Viruses are not living because they are cells.D. Viruses are not living because they experience mutations.E. Viruses are not living because they don't need to metabolize food.

Answers

The statement that could be true is E. Viruses are not living because they don't need to metabolize food.

Viruses are regarded as non-living because they lack many of the qualities that are used to describe living things, such as the capacity for independent reproduction, the ability to perform metabolic functions, and the ability to maintain homeostasis. Even if they change and mutate, this does not qualify them as being alive. Furthermore, viruses are not cells; rather, they are genetically-charged particles made of DNA or RNA that are encased in a protein coat and occasionally an outer envelope.

Viruses are known to cause numerous diseases in plants and animals alike. The infection caused by it is difficult to treat, thus disease is severe.

To know more about viruses click here

brainly.com/question/25236237

#SPJ4

a secondary structure motif in which regions of the polypeptide lie parallel to each other is called ____

Answers

The secondary structure motif in which regions of the polypeptide lie parallel to each other is called beta sheets.

In beta sheets, the polypeptide backbone forms a zigzag pattern, with adjacent strands held together by hydrogen bonds between the peptide bonds. This arrangement allows for a more rigid, extended structure than the alpha helix, which is another common secondary structure motif. Beta sheets are often found in the interior of globular proteins, and they can also form the basis for fibrous proteins like silk.

Beta sheets can be either parallel or anti-parallel, depending on the directionality of the polypeptide strands. In parallel beta sheets, the strands run in the same direction, while in anti-parallel beta sheets, the strands run in opposite directions. Anti-parallel beta sheets are generally more stable than parallel beta sheets, as the hydrogen bonds between adjacent strands are more linear.

Know more about beta sheets here: https://brainly.com/question/30480629

#SPJ4

what is the function of a stabilizer in muscular performance? causes opposite action to one desired cooperates with other muscles prevents undesirable action of contracting muscles supports body segment against pull of contracting muscle

Answers

The function of a stabilizer in muscular performance is to support body segments against the pull of contracting muscles. This prevents undesirable actions of contracting muscles, as well as cooperating with other muscles to produce the opposite action to the one desired.


A stabilizer in muscular performance refers to a muscle that supports the body segment against the pull of the contracting muscle. It is a muscle that causes an opposite action to the one desired while cooperating with other muscles. It also prevents the undesirable action of contracting muscles.

The function of stabilizers in muscular performance is to stabilize the joint during movements and prevent injuries. Stabilizer muscles are essential in that they help maintain posture and balance while providing support to joints during movements. They prevent unnecessary movements or motions that could cause injury to the joints. For example, in the shoulder joint, the rotator cuff muscles function as stabilizers by preventing excessive motion of the humerus, preventing injury to the joint.

The muscles that stabilize the spine are known as core stabilizers. They stabilize the spine during movement and provide a solid base for the extremities to push off during various activities. Therefore, stabilizers play an essential role in maintaining stability and preventing injuries during movements.

Learn more about muscles:

https://brainly.com/question/13920046

#SPJ11

Botanist have also discovered geosmins in some types of cacti that are pollinated by insects. How might this compound provide an advantage for the cacti?

Answers

The presence of geosmin in cacti that are pollinated by insects may provide multiple benefits to the plant, including increased attractiveness to pollinators, protection against pathogens and herbivores, and conservation of water.

What is Pollination?

Pollination is the process by which pollen, which contains the male reproductive cells of a plant, is transferred from the anther (male reproductive structure) of one flower to the stigma (female reproductive structure) of another flower of the same species, or to the same flower.

Pollination is a vital process for plant reproduction and the production of fruits and seeds. Pollination can occur through various means, including wind, water, or by animals such as birds, bees, butterflies, and other insects.

Geosmin is an organic compound that has a distinct earthy odor and is produced by certain types of bacteria, as well as some plants, including cacti. The presence of geosmin in cacti that are pollinated by insects may provide several advantages

Learn more about Pollination from the given link

https://brainly.com/question/30628535

#SPJ1

The intrinsic growth rate is the maximum per capita growth rate, most readily achieved when no environmental factors limit population increase.FalseTrue

Answers

The intrinsic growth rate is the maximum per capita growth rate, most readily achieved when no environmental factors limit population increase. The given statement is true.

Intrinsic growth rate is the maximum potential per capita growth rate of a population when resources are unlimited, and there is no competition. The intrinsic growth rate is represented by the symbol "r."

Intrinsic growth is a term used to describe a quantity that describes the rate at which a population grows if it is not influenced by environmental factors. In the absence of any limiting factors, populations are predicted to grow exponentially.

However, in nature, populations are limited by environmental factors such as the availability of food, water, and space.

For more such questions on growth rate, click on:

https://brainly.com/question/1078756

#SPJ11

Which phrases describe examples of mass movement? Check all that apply.

sediments settling on a mountain

soil mixed with water sliding off a cliff

rocks and debris rolling down a steep slope

rocks breaking into sediments as they fall to the ground

loosely connected rock and debris traveling down a steep hill

Answers

All of the phrases except for "sediments settling on a mountain" describe examples of mass movement.

Mass movement, also known as mass wasting, refers to the downslope movement of rocks, soil, and other debris due to the force of gravity. "Soil mixed with water sliding off a cliff" describes a type of mass movement called a mudflow, which is a mixture of water, soil, and rock that moves down a slope due to the weight of the material and the force of gravity. "Rocks and debris rolling down a steep slope" describes rockfall, which is the rapid free fall of rock from a cliff or steep slope. "Rocks breaking into sediments as they fall to the ground" describes rockslide, which is the rapid sliding of rocks and debris down a steep slope. "Loosely connected rock and debris traveling down a steep hill" describes a landslide, which is the rapid sliding of a large mass of rock or soil down a slope.

To know more about mass movement click here:

brainly.com/question/13020976

#SPJ4

i need an answer for these

Answers

The artifacts and their names are:

A, Air Bubble B, Seeds and PollenC, Plant Cells D, Fungal SporesWhy do plant cells have cell walls?

Plant cells have cell walls because they provide structural support and protection to the cell. Cell walls are rigid structures made up of cellulose, hemicellulose, and other polysaccharides that are arranged in a specific way to form a mesh-like structure.

This structure allows the cell to maintain its shape, even under stress or pressure, and prevents it from bursting or collapsing. The cell wall also helps to regulate the movement of substances in and out of the cell and protects it from pathogens and other harmful agents.

Learn more on plant cells here: https://brainly.com/question/913732

#SPJ1

Image transcribed:

IDENTIFYING ARTIFACTS

Match the following artifact with its image.

A.

B.

C.

D.

Fungal Spares

Plant Cells

Seeds and Pollen

Air Bubble

Help me i have to turn it in Tomorrow

Answers

Air pollution can be caused by air conditioners and refrigerators made before 1996 can release CFCS into the air.

What are the types of air pollution?

Air conditioners and refrigerators made before 1996 can release CFCS into the air. These compounds react with sunlight and destroy ozone molecules. This allows more harmful UV rays to reach Earth's surface, causing increased rates of skin cancer.

Another kind of air pollution caused by natural events such as volcanic eruptions or human activities such as burning fossil fuels is nitrogen compounds. Particulate matter is a mix of solid and liquid particles in the air. It can be caused by wood-burning stoves and forest fires. Indoor sources of this gas include burning fossil fuels to generate electricity or to run vehicles.

A third type of air pollution, photochemical smog, is a brownish haze in the sky when carbon compounds and sunlight react and form new substances. The last type of air pollution, acid precipitation, is rain or snow that has a lower pH than normal rainwater. It is also caused by burning fossil fuels.

Learn more about air conditioners at: https://brainly.com/question/24920322

#SPJ1

Determine whether each structure is homologous or homoplastic.a. Long snout of egg-laying echidna and placental giant anteaterb. Cactus spine and tree leafc. Flippers of dolphins and fins of fishd. Tailbone of human and tail of dogse. webbed feet of ducks and ottersf. true roots and root-like stems of plantsg. wings of bats and flippers of whales

Answers

Answer:

I’m confused

Explanation:

a ligand binds to a transmembrane protein, which causes a conformational change in the protein that is detected by an intracellular protein. the intracellular protein is an enzyme that adds phosphate groups to target proteins. the phosphorylated proteins cause a physiological change within the cell.this process is an example of .

Answers

The intracellular protein then adds phosphate groups to target proteins, leading to a physiological change within the cell. This process is known as signal transduction.

A ligand binds to a transmembrane protein, which leads to a conformational change in the protein that is detected by an intracellular protein. The intracellular protein then adds phosphate groups to target proteins, leading to a physiological change within the cell. This process is known as signal transduction.
This process is an example of signal transduction, specifically a receptor-mediated signal transduction pathway. Here's a step-by-step explanation:
1. A ligand binds to a transmembrane protein (receptor) on the cell surface.
2. The binding causes a conformational change in the protein structure.
3. This change is detected by an intracellular protein, which is an enzyme.
4. The enzyme, a kinase, adds phosphate groups to target proteins through phosphorylation.
5. The phosphorylated proteins cause a physiological change within the cell.
This entire sequence of events constitutes a signal transduction pathway.

For more such questions on signal transduction , Visit:

https://brainly.com/question/20372593

#SPJ11

the biological approach to therapy views psychological disorders as ______

Answers

The biological approach to therapy views psychological disorders as caused by abnormalities or imbalances in the brain and nervous system.

Biological therapy, also known as medication or medication therapy, is the most common and widely used treatment for mental health problems. Biological therapy seeks to address the biochemical imbalances and neurological problems that contribute to psychological and psychiatric disorders.

Biological therapy is based on the notion that psychological disorders are caused by abnormalities or imbalances in the brain and nervous system. Biological therapy entails the use of drugs to address the underlying chemical imbalances in the brain that cause psychological and psychiatric problems. Biological therapy has been shown to be particularly effective in treating severe depression, anxiety, bipolar disorder, and schizophrenia.

Medications such as antidepressants, antipsychotics, mood stabilizers, and anxiolytics are frequently used in biological therapy to address chemical imbalances and other neurological issues related to mental health problems.

To know more about Biological therapy here:
https://brainly.com/question/19976489#

#SPJ11

give an example of an internal stimuli response of a plant and of a human.

Answers

Internal factors that influence an organism's response are known as internal stimuli. One or more examples are: A decline in water levels which would evoke a thirst response.

An elevated quantity of carbon dioxide in the blood which might lead to a yawn, A lowered blood sugar level which would lead to a hungry reaction. For example, sunlight acts as a stimulation for plants that encourages them develop or move towards it.

Another example of stimulation is high temperatures that activate (stimulate) the sweat system in our body as a result of which our bodies cool down. External or internal stimuli are both possible. Your body's reaction to a medication is an illustration of an external stimulus.

Learn more about internal stimuli Visit: brainly.com/question/11557304

#SPJ4

What process do heterotrophs use to release energy?

Answers

Cellular respiration

What characteristic about the tundra biome listed below does not contribute to a reduction of carbon dioxide on Earth?

Answers

The characteristic about the Tundra biome listed below that does not contribute to a reduction of carbon dioxide on earth is the nutrient-poor soil.

One piece of evidence for the endosymbiotic theory is that the mitochondria and chloroplasts of eukaryotes _____.

self-replicate by binary fission, which is the way prokaryotes divide
have DNA similar to prokaryotes
synthesize proteins like prokaryotes
all of the above

Answers

The aforementioned facts support the endosymbiotic idea. Some of the organelles seen in eukaryotic cells may have originally been prokaryotic bacteria, according to the endosymbiotic theory or notion.

What support does the notion of endosymbiosis have in chloroplasts and mitochondria?

Both mitochondria and chloroplasts have circular, single-stranded DNA in addition to not having histone proteins or histones which is a great similarity between them. Prokaryotes are the only organisms that have single-stranded, circular DNA.

What is the strongest proof that mitochondria are an endosymbiotic organism?

The best proof we currently have for the common ancestry of mitochondria and chloroplasts is protein import. That is most likely the most convincing evidence we have for categorizing the number and type of secondary endosymbiotic interactions that the red plastid lineage has experienced during evolution.

To learn more about endosymbiotic theory visit:

brainly.com/question/29117311

#SPJ1

Other Questions
the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA Review of rsums is most valid when the content of the rsums is evaluated in terms of the elements of a job description. true/false What is transport in humans and plants and what is the difference? Which graph represents the solution to inequality which atomic particles are in a unique cloud outside of the nucleus of the atom? HELPPPPPPPPPPPP Plsss Solve 4^-2x 4^x = 641) Rewrite the equation using the same base. 2) Solve for x. Remember to show all work.PLEASE SHOW ALL WORK FOR BRAINLIEST PLEASEEE A buffer solution is prepared by adding NaH2PO4 to a solution of H3PO4. What happens if KOH is added? (1 point) one of the one-way functions used in public key cryptography is integer multiplication/factorization. multiplying two integers is easy, but factoring is hard. the number 3174277 is the product of two primes.what is the smaller of the two primes?what is the largest of the two primes? the second punic war a. saw the eventual victory of carthage over rome. b. saw hannibal invade italy from greece. c. won spain for rome and resulted in roman control over the western mediterranean. d. produced a great victory for the romans over hannibal at the battle of cannae. e. all of the above since conforming loans can be much more readily bought and sold in the secondary mortgage market, they carry a(n) interest rate than comparable nonconforming loans. a. higher b. equal c. more volatile d. lower PLEASE HELP WITH THESE TWO QUESTION 20 POINTSSSS Find the Value of X for 3, 4, 5, and 6, and tell whether or not these angles are adjacent or vertical. Remarkable identity fegley, incorporated, has an issue of preferred stock outstanding that pays a $5.60 dividend every year, in perpetuity. if this issue currently sells for $80.40 per share, what is the required return? cuvier's view that the extinction and the subsequent appearance of different creatires could be explained by a series of disasters and re-creations is called true or false: the product life-cycle theory suggests that mature industries tend to shift production out of the united states and into low-cost assembly locations. Need the area of the parallelogram what is the probability that you and your two friends will be chosen, but your name will be drawn first