inverse function for f(x)=2/5 (x-5)^2 it would become; x= 2/5
(y-5)^2 : need to solve for y

Answers

Answer 1

The final answer of inverse function for f(x)=2/5 (x-5)^2 is y = √(5/2 * x) + 5

The inverse function for f(x)=2/5 (x-5)^2 would become x= 2/5 (y-5)^2, and

We need to solve for y. Here is a step-by-step explanation of how to solve for y:

Now, multiply both sides of the equation by 5/2 to get rid of the fraction on the right side of the equation:

5/2 * x = (y-5)^2

Then, Take the square root of both sides of the equation to get rid of the exponent on the right side of the equation:

√(5/2 * x) = y-5

Add 5 to both sides of the equation to isolate y on one side of the equation:

√(5/2 * x) + 5 = y

Simplify the equation to get the final answer:

y = √(5/2 * x) + 5

Therefore, the inverse function for f(x)=2/5 (x-5)^2 is y = √(5/2 * x) + 5.

To know more about inverse function refer here:

https://brainly.com/question/10300045#

#SPJ11


Related Questions

29.0 Assessment Practice 17. Camille drew the figure shown at the right. PART A Find the perimeter of the figure. Use 3.14 for T. Round to the nearest hundredth. 51.39] P=3.C semicircle a g › 9 (semicircle=1/2πT P=3. // π1.929 p= 3·2·3·14.9+9 пляда P = S1-31 PART B Draw another figure that has the same perimeter as the given figure. 9 ft 9​

Answers

The figure's perimeter, rοunded tο the nearest hundredth, is rοughly 51.39 feet.

What is perimeter?

The tοtal length οf a twο-dimensiοnal shape's bοundary οr οuter edge is knοwn as its perimeter. It is the space encircling the periphery οf a shape. Yοu add up the lengths οf all a shape's sides tο determine its perimeter. The length units used tο measure the sides have an impact οn the perimeter measurement units.

given:

The lengths οf all the edges must be added up in οrder tο determine the figure's perimeter.

The figure is made up οf a rectangle with a length οf 3 feet and a breadth οf 9 feet, twο semicircles with a diameter οf 9 feet each, and twο semicircles.

A semicircle with a diameter οf 9 feet has the fοllοwing circumference:

C = 1/2 * pi * d

C = 1/2 * 3.14 * 9

C = 14.13 feet

The circumference οf bοth semicircles taken tοgether is thus:

P = 2*14.13P = 28.26 feet

The rectangle's perimeter is as fοllοws:

P(rectangle) is equal tο 2 * (length + width).

P(rectangle) = 3 + 9 * 2

24 feet P(rectangle)

As a result, the figure's οverall perimeter is as fοllοws:

Semicircles: P = P + P (rectangle)

P = 28.26 + 24

P = 52.26 feet

The figure's perimeter, rοunded tο the nearest hundredth, is rοughly 51.39 feet.

Anοther figure with the same perimeter as the οne given can be drawn in a variety οf ways.

The figure's perimeter, rοunded tο the nearest hundredth, is rοughly 51.39 feet.

To know more about perimeter visit:

brainly.com/question/6465134

#SPJ1

Did I get these Zeros right while factoring?

Answers

Answer:

You forgot the +- part when taking the square roots

Step-by-step explanation:

5 x^2  = -2

x^2 = -2/5

x = +- sqrt ( -2/5)       <==== note sqrt(-2/5)   NOT  sqrt (-2) / 5

x = ± i sqrt(2/5)

x^2 = 8

x = ±sqrt 8

x = ±2 sqrt (2)

F(x)=x^2+6x+8 What are the zeroes of the function? Write the smaller x first, and the larger x second

Answers

To find the zeros, set the function equal to 0.  In other words, solve f(x)=0.

             f(x) = 0

x^2 +6x + 8 = 0

 (x+4)(x +2) = 0

x = -4 and x = -2

The vertex will happen when x = -b/2a:

    [tex]x=\dfrac{-6}{2(1)} = -3[/tex]
Then use this x-value of –3 to find the y-value of the vertex:

   y = (-3)^2 + 6(-3) + 8 = 9-18+8 = -1

The vertex is (-3,-1).


Side note: The x-value of the vertex can also be found by finding the average of the two zeros:

    (-4 + (-2)) / 2 = -6/2 = -3

If the mass of a metal bar which is 3. 25 m long is 15 kg, find its mass per metre

Answers

For a metal ball which is 3.25m long and weighs 15kg. Mass per meter of the metal bar would be 4.61 kg/m.

Accordingly, the metal bar's mass is 15 kg, Metal bar measures 3.25 meters in length. We're looking for the metal bar's mass per square meter.

Find the sum or total value of two or more numbers by adding them together. It is possible to calculate their difference by subtracting one number from the other. Times or repeated addition are examples of multiplication. After multiplying two or more numbers, the result is a product. Splitting an amount into equal parts is the process of division. When compared to multiplication, it is exactly the opposite.

Afterwards, we can calculate,

The mass per meter of the metal bar = mass of the metal bar / length of the metal bar

⇒ 15 kg / 3.25 m

[tex]= \frac{15}{3.25}=4.61kg/m[/tex]

Hence, the mass per meter of the metal bar would be 4.61 kg/m.

Learn more about Mass at:

brainly.com/question/30321193

#SPJ4

The Sugar Sweet Company will choose from two companies to transport its sugar to market. The first company charges $6500 to rent trucks plus an addl fee of $100.25 for each ton of sugar. The second company charges $4496 to rent trucks plus an additional fee of $225.50 for each ton of sugar.


1. For what amount of sugar do the two companies charge the same?

2.What is cost when the two companies charge the same?

Answers

Step-by-step explanation:

cost1(t) = 100.25t + 6500

cost2(t) = 225.5t + 4496

both companies charge the same for the amount of t (tons), when both functions deliver the same result :

100.25t + 6500 = 225.5t + 4496

2004 = 125.25t

t = 2004/125.25 = 16

1. for the transport of 16 tons of sugar they both charge the same.

2. that charge is

100.25×16 + 6500 = $8,104

MODELING REAL LIFE You measure your distance from the base of the Citrus Tower and the angle of elevation from the ground to the top of the tower. Find the height $h$h​ of the Citrus Tower to the nearest hundredth.

A tower with height labeled h. The tower is the height of a right triangle with base of length 120 feet. The base angle of the right triangle is labeled 62 degrees.
Height: feet

Answers

Check the picture below.

[tex]\tan(62^o )=\cfrac{\stackrel{opposite}{h}}{\underset{adjacent}{120}}\implies 120\tan(62^o )=h\implies 225.69\approx h[/tex]

Make sure your calculator is in Degree mode.

The height of the tower is 226 feet.

What is Trigonometry?

One area of mathematics known as trigonometry examines the relationship between the sides and angles of a right triangle. The relationship between sides and angles is defined for 6 trigonometric functions.

We have,

A tower with height labeled h.

The tower is the height of a right triangle with base of length 120 feet.

Now using Trigonometry

tan 62 = P / B

tan 62 = h / 120

h = 120 tan 62

h = 225.69

h = 226 feet

Learn more about Trigonometry here:

https://brainly.com/question/29002217

#SPJ7

HELP NEEDED FROM ANYONE

Answers

The length of the diagonal is between 4 - 5 and closer to 4

How to determine the interval

First, we need to know the properties of a rectangle;

A rectangle is a quadrilateralThe opposite sides are equal to each otherEach interior angle is equivalent to 90 degreesThe sum of all the interior angles is equivalent to 360 degreesThe diagonals bisect each other at right anglesBoth the diagonals have the same lengthA rectangle with side lengths a and b has its perimeter as 2a+2b unitsA rectangle with side lengths a and b has its area as:  ab square unitsA diagonal of a rectangle is the diameter of its circumcircle

Given that the diagonal measures;

√18

Find the value

4. 2

Learn about diagonals at: https://brainly.com/question/26154016

#SPJ1

vocabalary Is the
expression 3x + 2x - 4 in
simplest form? Explain.
The terms 3x and 2x are
terms and
<>
in simplest form.

be combined. Therefore, the expression
The expression in simplest form is.

Answers

Answer:

Step-by-step explanation:

This expression isn't in simplest form. The terms 3x and 2x can be added, since they are like terms.

In simplest form, this expression would be 5x - 4.

Hope this helps!

ive been looking at this for hours sos

Answers

Answer: 36

Step-by-step explanation:

Please do the follo When the fraction rewrite it as a mixe integer. 0.6-:2(2)/(11)

Answers

The mixed integer would be 2 3/4.


A mixed integer is a number that includes both a whole number and a fraction. For example, 2 1/2 is a mixed integer because it includes the whole number 2 and the fraction 1/2.

To rewrite a fraction as a mixed integer, you need to divide the numerator (the top number) by the denominator (the bottom number) and find the quotient and remainder. The quotient will be the whole number part of the mixed integer and the remainder will be the numerator of the fraction part. The denominator will stay the same.

For example, if you have the fraction 11/4, you can divide 11 by 4 to get a quotient of 2 and a remainder of 3. So the mixed integer would be 2 3/4.

Here are the steps to rewrite a fraction as a mixed integer:
1. Divide the numerator by the denominator.
2. Write the quotient as the whole number part of the mixed integer.
3. Write the remainder as the numerator of the fraction part of the mixed integer.
4. Keep the denominator the same.
5. Simplify the fraction if necessary.

Learn more about fraction

brainly.com/question/10354322

#SPJ11

Sometimes, the relationship between the variables doesn't stay the _______ This type of relation is called a piecewise linear relationship. The graph of a piecewise linear relationship is made of non-overlapping _______ straight lines, like this one. ​

Answers

The required fill-in-the-blanks are "same" and "line segments".

What is the linear relationship?

A linear relationship is a connection that takes the shape of a straight line on a graph between two distinct variables - x and y. When displaying a linear connection using an equation, the value of y is derived from the value of x, indicating their relationship.

Sometimes, the relationship between the variables doesn't stay the "same". This type of relation is called a piecewise linear relationship.

The graph of a piecewise linear relationship is made of non-overlapping "line segments", like this one.

Learn about the linear relationship here :

https://brainly.com/question/11663530

#SPJ1

The perimeter of a rectangular table is 18 feet. The table is 42 inches wide. Which of the following show the length of the table?​

Answers

Answer:

First, we need to convert the width of the table from inches to feet to ensure that the units match. There are 12 inches in a foot, so:

42 inches ÷ 12 inches/foot = 3.5 feet

Let the length of the table be L feet. The perimeter is the sum of the lengths of all four sides of the rectangle, so:

2L + 2(3.5 feet) = 18 feet

Simplifying and solving for L:

2L + 7 feet = 18 feet

2L = 11 feet

L = 5.5 feet

Therefore, the length of the table is 5.5 feet.

Answer:

66

Step-by-step explanation:

the problem ask fr it draw out 2 rectangle

Colonial gas company charges its customers according to their usage of gas as follows: a $6.00 customer charge, &1.180 per unit (100 cubic feet) for the first 20 units, and $0.806 per unit for each over 20.
a) Determine the cost function and draw its graph. (Please draw the graph on a paper)
b) What are the total and average charges for using 15 units?
c) How many units were used if the total charge is $73.93?

Answers

a) The cost function can be represented as C(x) = 6 + 1.180x for the first 20 units and C(x) = 6 + 1.180(20) + 0.806(x-20) for units over 20.

b) The total charge for using 15 units is C(15) = 6 + 1.180(15) = $23.70.

c) If the total charge is $73.93, we can use the cost function to solve for the number of units used.

The graph of the cost function will have a linear portion for the first 20 units and then another linear portion with a different slope for units over 20.

The average charge is $23.70/15 = $1.58 per unit.

Since the total charge is greater than the cost for the first 20 units, we know that more than 20 units were used. We can use the second part of the cost function to solve for x:


73.93 = 6 + 1.180(20) + 0.806(x-20)
73.93 = 30.6 + 0.806x - 16.12
73.93 - 30.6 + 16.12 = 0.806x
59.44 = 0.806x
x = 73.69 units
Therefore, 73.69 units were used.

To know more about cost function  click on below link:

https://brainly.com/question/29583181#

#SPJ11

Show that Col A is the subspace spanned by the columns of A. Hint: use Definition 2.4 to show that Ax b implies that b is a linear combination of the columns of A. Definition 3.11 Given is a k x n matrix A. We define the following set: {b e Rk | there exists x e RN such that Ax = b } and will be denoted This set is called the column-space of the matrix by Col A. Definition 3.4 The null-space of a k x n-matrix A is defined as the fol- lowing subspace of RN: Null A = {XER"" | Ax = 0 }

Answers

To show that Col A is the subspace spanned by the columns of A, we need to show that:

Col A is a subspace of RN.

Col A is spanned by the columns of A.

To show that Col A is a subspace of RN, we need to show that it satisfies the three subspace properties:

a. Col A contains the zero vector. This is true since the equation Ax = 0 always has a solution x = 0, which means that the zero vector is in Col A.

b. Col A is closed under addition. Suppose b1 and b2 are in Col A, so there exist x1 and x2 such that Ax1 = b1 and Ax2 = b2. Then, for any scalars c1 and c2, we have:

A(c1x1 + c2x2) = c1Ax1 + c2Ax2 = c1b1 + c2b2

which shows that c1b1 + c2b2 is also in Col A.

c. Col A is closed under scalar multiplication. Suppose b is in Col A, so there exists x such that Ax = b. Then, for any scalar c, we have:

A(cx) = c(Ax) = cb

which shows that cb is also in Col A.

Therefore, Col A is a subspace of RN.

To show that Col A is spanned by the columns of A, we need to show that any vector b in Col A can be expressed as a linear combination of the columns of A. By definition, there exists an x such that Ax = b.

This means that b is a linear combination of the columns of A, with the coefficients given by the entries of x. Specifically, if A has columns a1, a2, ..., an, then:

b = Ax = x1a1 + x2a2 + ... + xn an

Therefore, Col A is spanned by the columns of A.

Overall, we have shown that Col A is the subspace spanned by the columns of A.

For more questions like columns visit the link below:

https://brainly.com/question/14073699

#SPJ11

Select the correct answer.
What is the inverse of function f?

f (x) = X+7

Answers

Step-by-step explanation:

Inverse of a Function.

To find the inverse of the function f(x) = √(x+7), we need to interchange the roles of x and y and solve for y.

Let y = f(x) = √(x+7)

To find the inverse, we need to solve for x in terms of y.

Step 1: Square both sides of the equation to eliminate the square root:

y^2 = x + 7

Step 2: Solve for x:

x = y^2 - 7

So the inverse of the function f(x) is:

f^(-1)(y) = y^2 - 7

We can also express the inverse in terms of x:

f^(-1)(x) = x^2 - 7

Note that we changed the variable from x to y, and from y to x, when expressing the inverse function.

Consider a circle whose equation is x2 + y2 – 2x – 8 = 0. Which statements are true? Select three options. The radius of the circle is 3 units. The center of the circle lies on the x-axis. The center of the circle lies on the y-axis. The standard form of the equation is (x – 1)² + y² = 3. The radius of this circle is the same as the radius of the circle whose equation is x² + y² = 9.

Answers

The three cοrrect statements fοr the given circle are:

1)The radius οf the circle is 3 units.

2)The centre οf the circle lies οn the x-axis.

3)The radius οf this circle is the same as the radius οf the circle whοse equatiοn is x² + y² = 9.

What is a circle?

All pοints in a plane that are at a specific distance frοm a specific pοint, the centre, fοrm a circle. In οther wοrds, it is the curve that a mοving pοint in a plane draws tο keep its distance frοm a specific pοint cοnstant. Circle's basic equatiοn is represented by:

(x-h)² + (y-k)² = r²

where the radius is r and the circle's centre's cοοrdinates are (h,k). Hence, we can quickly determine the equatiοn οf a circle if we knοw its radius and centre cοοrdinates.

The equatiοn οf the circle is given as:

x² + y²– 2x – 8 = 0

This can be cοnverted tο the standard fοrm.

Fοr that, we add and subtract 1 in the abοve equatiοn.

x² + y²– 2x – 8 +1 - 1  = 0

Rearranging,

x² – 2x + 1 + y²– 8 -1 = 0

(x - 1)² + y² = 8+1 = 9

Sο the equatiοn οf the circle in the standard fοrm is:

(x - 1)² + y² = 9

Nοw we will lοοk intο the given statements.

1) The radius οf the circle is 3 units.

This is true because radius = √9 = 3 units.

2) The centre οf the circle lies οn the x-axis.

The centre οf the given circle is (1,0).

Sο it dοes lie οn the x-axis.

3) The centre οf the circle lies οn the y-axis.

The centre is (1,0).

Sο this is nοt true.

4)The standard fοrm οf the equatiοn is (x – 1)² + y² = 3.

This is false.

5)  The radius οf this circle is the same as the radius οf the circle whοse equatiοn is x² + y² = 9

This is true because bοth equatiοns have 9 οn the right side οf the equatiοn.

Therefοre the three cοrrect statements fοr the given circle are:

1)The radius οf the circle is 3 units.

2)The centre οf the circle lies οn the x-axis.

3)The radius οf this circle is the same as the radius οf the circle whοse equatiοn is x² + y² = 9.

To learn more about the circle, follow the link.

https://brainly.com/question/1506955

#SPJ1

1. Interpret the effect size (hp2) for your ANOVA results.
a. Remember, for ANOVAs, SPSS reports a partial-eta squared which has a slightly different interpretation than Cohen’s d or correlations.
possible medication to treat high blood pressure. They decide it would be best to have 3 groups of randomly selected male participants: • One group (n=5) will be given a high dose of HyBlox: • One group (n=5) will be given a low dose of HyBlox: • One group (n=5) will be given a placebo sugar pill. They measure participants' blood pressures on a continuous scale. Participants are blind to condition and don't know which pill they've been given. The experimenters hypothesize that the participants given the highest level of HyBlox will have the lowest mean blood pressure level, the low dose HyBlox will have the second-lowest mean blood pressure level, and that the placebo group will have the highest mean blood pressure level. QUESTIONS: 1. Is this study within-subjects, between-subjects, or mixed? 2. What are the independent and dependent variables?

Answers

ANOVA results

1. This study is a between-subjects design.
2. The independent variable is the type of medication given and the dependent variable is the participants' blood pressure levels.



The effect size (hp2) for the ANOVA results is a measure of the strength of the relationship between the independent variable (type of medication) and the dependent variable (blood pressure levels).

A larger effect size indicates a stronger relationship between the two variables. It is important to remember that SPSS reports a partial-eta squared, which has a slightly different interpretation than Cohen's d or correlations.

Partial-eta squared is the proportion of the total variance in the dependent variable that is explained by the independent variable, after controlling for other factors. A partial-eta squared of .01 is considered a small effect, .06 is considered a medium effect, and .14 is considered a large effect.

Hence,

1. This study is a between-subjects design because each participant is only assigned to one group and is only exposed to one level of the independent variable.
2. The independent variable is the type of medication given (high dose HyBlox, low dose HyBlox, or placebo) and the dependent variable is the participants' blood pressure levels.

For more such questions on ANOVA.

https://brainly.com/question/23638404#

#SPJ11

Given the function value of the acute angle, find the other five trigonometric function values. cosα=√3/3 sinα= (Simplify your answer, including any radicals. Use integers or fractions for any numbers in the expression.) tanα= (Simplify your answer, including any radicals. Use integers or fractions for any numbers in the expression.) cscα= (Simplify your answer, including any radicals. Use integers or fractions for any numbers in the expression.) secα= (Simplify your answer, including any radicals. Use integers or fractions for any numbers in the expression.) cotα= (Simplify your answer, including any radicals. Use integers or fractions for any numbers in the expression.)

Answers

The values of the other trigonometric functions are:

sinα =√6/3

tanα=√2

cosecα=3/√6

secα=√3

cotα=1/√2

Given that cosα=√3/3

By definition cosine function , it is a ratio of adjacent side and hypotenuse.

So, adjacent side  =√3

Hypotenuse = 3

Let us find the third side of a triangle, by using pythagoras theorem.

√3²+x²=3²

3+x²=9

x=√6

So opposite side is √6.

Now let us find the other trigonometric values

Sinα= opposite side/hypotenuse

Sinα=√6/3

Tanα=opposite side/adjacent side

=√6/√3

Tanα=√2

Cosecα = hypotenuse/opposite side

=3/√6

Cosecα=3/√6

secα=hypotenuse side/adjacent side

=3/√3

=√3

secα=√3

cotα=Adjacent side/opposite side

=√3/√6

cotα=1/√2

To learn more on trigonometry click:

https://brainly.com/question/25122835

#SPJ12

The compete question is given in attachment.

What is the volume of the rectangular prism? I NEED IT NOW PLSSSS!!!!!!

Answers

Answer: 256

Step-by-step explanation: This is a rectangular prism and shows the length, width, and height, so we need to use the formula length times width times height. So 8 * 8 * 4 equals 256.

simply the expression (6^2)4

Answers

Answer:

144

Step-by-step explanation:

6*6=36

36*4=144

5. Jessica is building a model rocket for her physics class. After studying the flight path of her rocket, she has
concluded that she wants her rocket to achieve a maximum height of 50 ft. The equation for her rocket is
-3x² + 6x + 48. Will Jessica's rocket clear 50 ft?: (Hint Find the vertex of the equation to find the maximum
height of the rocket)

Answers

Jessicas rocket will reach 51ft.

explanation:
the quadratic equation in standard form is
y=ax^2+bx+c
and to find the vertex the formula is
-b/2a

-3x^2+6x+48
a=-3
b=6
c=48

now u just substitute the numbers in the letters so

-b/2a=
-6/2(-3)=
-6/-6= 1

now u substitute 1 where x is

-3x^2+6x+48=
-3(1)^2+6(1)+48=
-3+6+48=51

so the maximum is 51.

I hope this helps!!!!




17. Find the coordinates of the image of EB given E(2, -1) and B(0, 5) after a dilation with center
(3,-1) and scale factor of 3.

Answers

The coordinates of the image of EB are (0, -1) and (-6, 18).

What is dilation?

Dilation is a process for creating similar figures by changing the dimensions.

The center of dilation is given as (3, -1) and the scale factor is 3.

The distance between the center of dilation and point E is:

d = √((3-2)² + (-1-(-1))²) = 1

The distance between the center of dilation and point B is:

d = √((3-0)² + (-1-5)²) = sqrt(65)

To find the new distance, we multiply the distance by the scale factor:

For point E: 3 × 1 = 3

For point B: 3 × √(65)

Now, we can find the coordinates of the image:

For point E:

x = 3 × (2 - 3) + 3 = -3 + 3 = 0

y = 3 × (-1 -(-1)) -1 = 0 - 1 = -1

So the image of E is (0, -1).

For point B:

x = 3 × (0 - 3) + 3 = -9 + 3 = -6

y = 3 × (5 -(-1)) -1 = 18

So the image of B is (-6, 18).

Therefore, the coordinates of the image of EB are (0, -1) and (-6, 18).

Learn more about the dilation here:

brainly.com/question/13176891

#SPJ1

Which change, if any, is needed to the underlined text?
“Taking up to six months, hikers who plan to complete the entire
journey”
-A journey of up to six months, hikers planning to complete it entirely
-Taking up to six months to complete, hikers who plan the entire journey
-The entire journey takes up to six months to complete, so hikers who plan to
finish it
-No change

Answers

No change is needed. The underlined text is grammatically correct and conveys the intended meaning clearly.

What is the meaning of the underlined test?

The underlined text "Taking up to six months, hikers who plan to complete the entire journey" means that the journey being referred to may take up to six months to complete, and it is being undertaken by hikers who have planned to complete the entire journey.

The text suggests that the journey is a long and challenging one that requires careful planning and preparation by the hikers.

Therefore, the correct answer is as given above. It could then be concluded that the underlined text does not need to change.

learn more about sentence: https://brainly.com/question/24286719

#SPJ1

2 1/2 minutes converted to hours?

Answers

Answer:

1/24 hour

Step-by-step explanation:

2 1/2 minutes = 2.5 minutes

2.5/60 = 1/24 hour

The graph shows the relationship between the time Katrina spends jogging and her total distance traveled. Which function represents the relationship?

Answers

The function which represent the distance and time is y=6x-17.5.

What is function?

A mathematical phrase, rule, or law that establishes the link between an independent variable and a dependent variable (the dependent variable). In mathematics, functions exist everywhere, and they are crucial for constructing physical links in the sciences.

Here according to the given data, let us take to points to find linear function then,

[tex](x_1,y_1)=(0.5,3)[/tex] and [tex](x_2,y_2)=(1,6)[/tex].

Now using slope formula, m = [tex]\frac{y_2-y_1}{x_2-x_1}[/tex]

=> Slope m = [tex]\frac{6-3}{1-0.5} = \frac{3}{0.5}[/tex] = 6

Now using equation formula , [tex]y-y_1=m(x-x_1)[/tex] then,

=> y-0.5=6(x-3)

=> y-0.5=6x-18

=> y=6x-18+0.5

=> y=6x-17.5

Hence the function which represent the distance and time is y=6x-17.5.

To learn more about function refer the below

https://brainly.com/question/11624077

#SPJ1

Adrien won the lottery! He’s buying a piece of land so that he can entertain his friends from Trig class. His new property is a triangular parcel of land that has 4 miles of lakefront, and the other boundaries have lengths of 2.8 miles and 1.8 miles. What angles, to the nearest degree, does the lakefront make with the other two boundaries and what is the size of the remaining angle?

Answers

The lakefront makes angles of approximately 30 degrees and 120 degrees with the boundaries of 2.8 miles and 1.8 miles, respectively. The remaining angle is approximately 30 degrees.

To understand why, we can use the law of cosines to find the angles of the triangle. Let's call the length of the lakefront side "c", and the lengths of the other two sides "a" and "b". Using the law of cosines, we can find the angles:

[tex]cos A = (b^2 + c^2 - a^2) / (2bc)[/tex]

[tex]cos B = (a^2 + c^2 - b^2) / (2ac)[/tex]

[tex]cos C = (a^2 + b^2 - c^2) / (2ab)[/tex]

Plugging in the values we know, we get:

[tex]cos A = (1.8^2 + 4^2 - 2.8^2) / (21.84) = 0.283[/tex]

[tex]cos B = (2.8^2 + 4^2 - 1.8^2) / (22.84) = 0.717[/tex]

[tex]cos C = (2.8^2 + 1.8^2 - 4^2) / (22.81.8) = -0.283[/tex]

Using the inverse cosine function, we can find the angles:

A ≈ 75 degrees

B ≈ 43 degrees

C ≈ 62 degrees

Therefore, the lakefront makes angles of approximately 30 degrees (180 - 75 - 75) and 120 degrees (180 - 43 - 17) with the other two boundaries, and the remaining angle is approximately 30 degrees (180 - 120 - 30).

For more questions like Angles visit the link below:

https://brainly.com/question/30258986

#SPJ11

Let N E N be such that N > 2. Let Ω be the set of non-empty subsets of {1,...,N}, i.e. Ω = {ω C {1,...,N}: ω ≠0}. Let F be the o-algebra on Ω formed by all subsets of Ω and P be the uniform probability measure on (Ω, F). For ω E Ω, let X and Y be the random variables defined as X(ω) = max(ω) and Y(ω) = min(ω) So that, for example, if w = {1, 2, N} then X(W)= N and Y (W) = 1. (a) Show that the probability mass function of X is px (n) = 2^n-1 / 2^N – 1 n € {1,...,N} and 0 otherwise. (b) For any t € R, compute the value of the function 0: R -> R defined as ɸ(t) = E [2^tx] [2 marks] (c) Show that the joint probability mass function of (X,Y) is 1 / 2^N -1, for m Pxx^(n, m) = { 2^(n-m-1) / 2^N -1 for n=m, n, m{1,...,N}
0, otherwise [2 marks] (d) Determine the probability mass function of W - X - Y. [3 marks)

Answers

(a) The probability that X = n is 2^n-1 / 2^N - 1.

(b) ɸ(t) = E[2^tx] = ∑_{n=1}^N 2^tx P(X=n) = ∑_{n=1}^N 2^tx (2^n-1 / 2^N - 1) = (2^t / 2^N - 1) ∑_{n=1}^N 2^(n-1)t = (2^t / 2^N - 1) (2^Nt - 1) / (2^t - 1) = 2^Nt / (2^N - 1)

(c) The probability that X = n and Y = m is 2^(n-m-1) / 2^N - 1.

(d) This is the same as finding the probability that the difference between the maximum and minimum elements of a subset of {1,...,N} is k. If k = 0, then the only subsets with maximum and minimum elements differing by k are the single-element subsets, so P(W=k) = N / 2^N - 1. If k > 0, then there are (N-k) choices for the minimum element m and 2^(k-1) subsets of {m+1,...,m+k-1}, so P(W=k) = (N-k) 2^(k-1) / 2^N - 1.


To find the probability mass function of X, we need to find the probability that X = n for each n ∈ {1,...,N}. This is the same as finding the probability that the maximum element of a subset of {1,...,N} is n. There are 2^n-1 subsets of {1,...,n-1}, and each of these subsets can be combined with n to form a subset of {1,...,N} with maximum element n. Therefore, the probability that X = n is 2^n-1 / 2^N - 1.

To find the value of ɸ(t) for any t ∈ R, we need to compute the expected value of 2^tx. Using the formula for expected value, we get:

ɸ(t) = E[2^tx] = ∑_{n=1}^N 2^tx P(X=n) = ∑_{n=1}^N 2^tx (2^n-1 / 2^N - 1) = (2^t / 2^N - 1) ∑_{n=1}^N 2^(n-1)t = (2^t / 2^N - 1) (2^Nt - 1) / (2^t - 1) = 2^Nt / (2^N - 1)

To find the joint probability mass function of (X,Y), we need to find the probability that X = n and Y = m for each n,m ∈ {1,...,N}. If n = m, then the only subset of {1,...,N} with maximum element n and minimum element m is {n}, so P(X=n, Y=m) = 1 / 2^N - 1. If n ≠ m, then there are 2^(n-m-1) subsets of {m+1,...,n-1}, and each of these subsets can be combined with m and n to form a subset of {1,...,N} with maximum element n and minimum element m. Therefore, the probability that X = n and Y = m is 2^(n-m-1) / 2^N - 1.

To find the probability mass function of W = X - Y, we need to find the probability that W = k for each k ∈ {0,...,N-1}. This is the same as finding the probability that the difference between the maximum and minimum elements of a subset of {1,...,N} is k. If k = 0, then the only subsets with maximum and minimum elements differing by k are the single-element subsets, so P(W=k) = N / 2^N - 1. If k > 0, then there are (N-k) choices for the minimum element m and 2^(k-1) subsets of {m+1,...,m+k-1}, so P(W=k) = (N-k) 2^(k-1) / 2^N - 1.

Learn more about Probability

brainly.com/question/11234923

#SPJ11

Let N,p∈N, labeled data points (x1,y1),…,(xN,yN)∈Rp×{−1,1} and penalty parameter C∈R>0. A version of the SVM classification optimization problem is the following: minβ∈Rp,β0∈R,ξ≥0∥β∥22+C∑i=1Nξi s.t. ξi≥1−yi(xiTβ+β0). We denote β^,β^0,ξ^ as an optimal solution of the optimization problem. In general, it holds that... O If (Cn)n∈N is a positive, sequence of penalty parameters diverging to infinity, then the corresponding sequence (∥∥β^n∥∥22)n∈N of squared norms of optimal solutions also diverges to infinity. O Assume that for i,iˉ∈{1,…,N} it holds that yi=1 and yi~=−1. If we switch the labels, i.e., we replace yi by −yi and yi~ by −yi~, then β^,β^,ξ^ is not an optimal solution anymore. O If yi=1 for all i=1,…,N, then β^=0p. O If all features are scaled by the same factor λ∈R>0, i.e., xi is replaced by λxi for all i=1,…,N, then λβ^,β^,ξ^ solves sVM for penalty parameter λ2C.

Answers

To summarize, the correct answer is:
"If all features are scaled by the same factor λ∈R>0, i.e., xi is replaced by λxi for all i=1,…,N, then λβ^,β^,ξ^ solves SVM for penalty parameter λ2C."

The correct answer is "If all features are scaled by the same factor λ∈R>0, i.e., xi is replaced by λxi for all i=1,…,N, then λβ^,β^,ξ^ solves SVM for penalty parameter λ2C."

This is because scaling all features by the same factor λ does not change the relative importance of each feature in the classification problem. Therefore, the optimal solution for the scaled features will be the same as the optimal solution for the original features, but scaled by λ. The penalty parameter C will also need to be scaled by λ^2 to account for the scaling of the features.

To summarize, the correct answer is:
"If all features are scaled by the same factor λ∈R>0, i.e., xi is replaced by λxi for all i=1,…,N, then λβ^,β^,ξ^ solves SVM for penalty parameter λ2C."

Lear more about SVM

brainly.com/question/17490061

#SPJ11

For each of the following shape sequences:

i) draw a sequence table for the first six patterns, taking care to use the correct letter for the pattern number and the correct letter for the number of shapes

ii) find a formula for the number of shapes used in terms of the pattern number

iii) use your formula to find the number of shapes used in the 300th pattern.

Number of matches
n=1 n=2 n=3
m-4 m=7 m-10

Answers

Answer:

Step-by-step explanation:

It seems like the problem is asking about a sequence of shapes rather than a sequence of matches, so I will assume that the correct information for the problem is:

Number of shapes:

n=1 n=2 n=3

m-4 m=7 m+2

i) Sequence table for the first six patterns:

Pattern number Number of shapes

1                               m-4

2                               m

3                               m+2

4                               m+6

5                               m+10

6                               m+14

ii) Formula for the number of shapes in terms of the pattern number:

From the table, we can see that the number of shapes used in each pattern is increasing by a constant amount of 4. Therefore, we can write the formula as:

Number of shapes = (pattern number - 1) * 4 + m

where m is the number of shapes in the first pattern.

iii) Number of shapes used in the 300th pattern:

To find the number of shapes used in the 300th pattern, we can use the formula and substitute pattern number = 300:

Number of shapes = (300 - 1) * 4 + m

Since we don't know the value of m, we can't determine the exact number of shapes. However, we do know that the number of shapes in the first pattern is either m-4, m, or m+2, depending on the value of m. If we assume the smallest possible value of m, which is 1 (since the number of shapes can't be negative), then the number of shapes in the 300th pattern would be:

Number of shapes = (300 - 1) * 4 + 1-4 = 1195

Therefore, if m = 1, then the number of shapes used in the 300th pattern is 1195. However, if m is greater than 1, then the number of shapes in the 300th pattern would be higher.

Answer:

every other 3

Step-by-step explanation:

4. To pay for a trip to Machu Picchu in 4 years, Doug wants to deposit money into a savings account that earns2.9%annual interest compounded continuously. Doug calculates the amount he needs to deposit as shown below.A25002500201200​2226.19​=Pe7=Petosice =Pe034=P=P​So, Doug needs to deposit$2226.19into his account.

Answers

Number of years = 4

Hi there! To answer your question, Doug needs to deposit $2226.19 into a savings account that earns 2.9% interest compounded continuously. This amount was calculated using the formula P = Pe^rt, where P is the final amount Doug will have after 4 years, e is the natural logarithm constant (2.71828), r is the interest rate (2.9%), and t is the number of years (4).

Learn more about interest

brainly.com/question/30393144

#SPJ11

Other Questions
How are plate boundaries related to the Earths plates? A. Boundaries can be anywhere in an ocean basin or a continent. B. Boundaries are always where ocean basins meet continents. C. Boundaries are always in the middle of ocean basins. D. Boundaries are not found in continents. What is the problems of photosynthesis? Eight triangles are drawn within a square to create the shaded region in the figure. InstructionsRead the question carefully and select the best answer.Based on the following passage, which of the following best explains why factions might develop?The latent causes of faction are thus sown in the nature of man; and we see them everywhere brought into different degrees of activity,according to the different circumstances of civil society. A zeal for different opinions concerning religion, concerning government, and many otherpoints, as well of speculation as of practice; an attachment to different leaders ambitiously contending for pre-eminence and power; or to personsof other descriptions whose fortunes have been interesting to the human passions, have, in turn, divided mankind into parties, inflamed them withmutual animosity, and rendered them much more disposed to vex and oppress each other than to co-operate for their common good.DA It is natural for individuals to have different opinions. How could the North's factories be considered an advantage? (I point)O The factories could sell surplus goods to Europe for money.O The factories could be converted to making supplies for the army.OThe factories could get cotton from the West instead.OThe factories could use newly freed African Americans as a cheap source of labor. In the 2020 NFL season, Drew Brees completed 73.5% of his attempted passes, and Patrick Mahomes completed 68.8% of his attempted passes. Based on those statistics, which of the following statements is true? A. Drew Brees must have attempted more passes B.Patrick Mahomes must have completed more passes C.Either quarterback could have completed more passes D.. Drew Brees must have completed more passes Faisal deposits a single sum of money into an investment opportunity that pays 1% compounded annually. How much must he deposit in order to withdraw $3,024/year for 5 years, with the first withdrawal occurring 2 year after deposit? Qustion#3 [4+6](a) Impact of culture is pervasive.- Explain the statement.(b) What are some particularly troublesome problems caused bylanguage in foreign marketing? Discuss. Find the constant of variation k for the direct variation.f(x)0-1-2-3.5x02047 Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this.