In this graph, what are the independent and dependent variables?

Answer:

Wing beats are independent and the mass of hummingbird are dependent.

Explanation:

Because the y-intersept is independent and the x-intersept is dependent.

Brainliest please!

Why is it we cannot directly observe a genotype, but can sometimes infer it?

What are the goals of binomial nomenclature and systematics?

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

How about decreasing the amount of water in blood affect blood pressure

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.

b. DNA unwinds

c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,

a. each with two new strands

b. one with two new strands and one with 2 original strands

c. each with two original strands
d. each with one new strand and one original strand

6.___DNA replication is said to be semiconservative because:

a. both RNA and DNA synthesis are involved in the process.

b. part of the telomere is lost during each round of replication.

c. a new double helix contains one old and one new strand.

d. each new strand is complementary, not identical, to its template

Help me with this please

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Essay Question: Which two species are more closely related?

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Someone please help me !

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Tell me if you think caecilians are amphibians, reptiles, or fish.

What would happen if there is an obstruction in the vas deferens?​

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Hello! could someone please do a 4 sentence quark poem

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Enumerate ways on how humans produce sound:Ex:clapping your hands
a.__________________________
b.__________________________
c.__________________________
d.__________________________
e.__________________________

​

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

what does not pass through the stomata of leaves ​

Hat percent of electricity in the UK will come from renewable sources by 2010? a. 1% c. 10% b. 5% d. 40%

What does "reliability" mean in these sentences?