In the figure above, which letter represents the benthic zone?

In The Figure Above, Which Letter Represents The Benthic Zone?

Answers

Answer 1

Answer:

i believe the answer is C i am not 100% sure though. Im doing my best to help people on here im sorry if its wrong

Explanation:

Answer 2

Answer:

D

Explanation:

The benthic zone is the bottom of a body of water. Technically the benthic zone could go up to the shore but D is your best answer choice.


Related Questions

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

The process during which a preexisting cell splits to form two cells is called

Answers

Mitosis is the process of a pre existing cells dividing into two cells.

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

what is carrying capacity? what type of population growth does it affect?

Answers

Carrying capacity is referred to a population size of species in a particular habitat. In an ecosystem, the population of a species will increase till it reaches its carrying capacity. Then the population size remains relatively equal.

What are the types of carrying capacity?

Carrying capacity is the maximum limit till that the ecosystem can support the existence of the population.

There are four categories of carrying capacity, namely:

Physical.Ecological.Economic.Social.

A specific environment's carrying capacity is the maximum population size that it can support.

The carrying capacity modifies the growth rate by slowing it when resources become scarce and stopping growth once it is reached.

Thus, it can be concluded that the carrying capacity is the average population size of species in a particular habitat which slows and stops the growth rate on reaching it.

For more details regarding carrying capacity, visit:

https://brainly.com/question/2375972

#SPJ1

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

What is the use of tail in human sperm?​

Answers

It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.

Explanation:

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

Which of the following events occurs the earliest during the process of photosynthesis?

Answers

Answer:

If you give me the choices to choose from I cna answer.

Explanation:

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants

Answers

Answer:

b it is the climate

Explanation:

B the climate

Answer  C.Size

Explanation:

the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

This is the science of correct reasoning. The basic components are statements that can be true or false, but never both.​

Answers

Answer:

The basic components are statements that can be true or false, but never both. Magnetic Resonance Imaging This is a non-invasive body imaging procedure that uses powerful magnets and radio waves to construct pictures of the internal structures of the body.

Explanation:

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?

Answers

Answer:

The force is by putting the two same objects on both sides and the motion is the scale

The force is by putting the two same objects on both sides and the motion is the scale.

What do you mean by force?

In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.

The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.

Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.

Learn more about force:

https://brainly.com/question/13191643

#SPJ2

2. What is the name of the process of gathering evidence called? *
1 point
the Experimental Process
the Scientific Proof
the Scientific Experiment
the Scientific Method

Answers

Answer:

the answer is d scientific method

Answer:d the scientific method

Explanation:

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients
Other Questions
What is the main idea of "Solar Conjunction: When the Sun Gets in the Way"?a. The Solar Conjunction is a once-in-a-lifetime occurrence.b. Radio signals must pass through the solar corona.c. There is a period of time when the Deep Space Network won't be gathering data.d. A Mars year is about 1.9 Earth years.Here is the story: Solar Conjunction: When The Sun Gets In The WayI am a Navigation Engineer in the Mission Design and Navigation section at the Jet Propulsion Laboratory in Pasadena, California. As a Mars Reconnaissance Orbiter Navigator, my job is to determine where the spacecraft is (orbit determination) and where it is going (orbit prediction). I also keep the spacecraft on course by performing propulsive burns using the spacecraft engines.The Earth and Mars both orbit the sun. Because Mars is farther away from the sun than is the Earth, the length of a Mars year is longer than the length of an Earth year (1 Mars year is about 1.9 Earth years). These different orbit periods cause the Earth and Mars to sometimes be on opposite sides of the solar system from one another. This event is called Solar Conjunction.During Solar Conjunction, radio signals transmitted by the Deep Space Network to the Mars Reconnaissance spacecraft (and vice versa) must pass through the solar corona. Due to signal interference, the measurements that the Navigation team use for orbit determination become very noisy. Noisy measurements mean that the Navigation team can't figure out exactly where the spacecraft is and where it is going. Without accurate measurements (and an accurate orbit determination solution), the Mars Reconnaissance spacecraft cannot perform precise targeted science observations. The best thing for the team to do is to "wait out" Solar Conjunction until the signal noise levels go back to normal levels (when Mars re-emerges from behind the sun). For Mars Reconnaissance Orbiter, this Solar Conjunction period starts around April 4, 2013, and lasts until May 1, 2013. During this time, science observations are suspended and we won't be receiving any new images.But not to worry! We should be back to our normal routine in May, so stay tuned! How would I categorize numbers? For example, what category would 23 fit into? Thankssss An element's atomic mass does not include the mass of its what Which best describes the Hospitality and Tourism career cluster?O A group of careers that focus on going from one place to another for business, pleasure, or other reasons.O A group of careers that focus on the act of traveling, sightseeing, and enjoying activities that are specific to alocationO A group of careers that focus on being welcoming to guests, such as guests who stay for a meal or who stayovernightO A group of careers that focus on providing people with food, a place to stay assistance to travelers, and funactivities What are the primary functions of body paragraphs in a comparative essay that focuses on genres? Select four options.to present the writer's arguments in a logical orderto provide evidence that supports the writer's ideasto analyze the texts, ideas, or objects being comparedto anticipate disagreement and provide counterargumentsto highlight similarities between the texts being discussedto point out differences between the texts being discussed what is the measure of angle A? Ken has inserted an image into his PowerPoint presentation, but the image contains a lot of empty and/or unnecessary space. He needs to eliminate this space. Which option should he use to achieve this goal?cutcopycropadjust What did President Andrew Jackson promise the Cherokee Indians if they moved to a new land? A boy kicked off a cliff and lands 151m away 45s later. What was the initial velocity? How tall is the cliff? How do you solve 2(x-6)=x-14 Which of the following continents was not covered by ice during the Pleistocene ice age?a.Europeb.Asiac.Australiad.North America 50 POINTS PLS ANSWER!!!!1. Honey Bees are becoming extinct. Which biotechnology could we use to help alleviate that problem and produce more honey bees? 2. Bees need flowers that produce a lot of pollen. Which biotechnology could scientists use to make flowers full of pollen? What is the Integers of 3.5 What causes rocks in a stream to be smooth? EarthquakesVolcanoesWeatheringMovement of fishWhat causes rocks in a stream to be smooth? EarthquakesVolcanoesWeatheringMovement of fishWhat causes rocks in a stream to be smooth? EarthquakesVolcanoesWeatheringMovement of fishWhat causes rocks in a stream to be smooth? EarthquakesVolcanoesWeatheringMovement of fish what are square meters How do you think studying the past can help us predict the future? Im pregnant and Ive been throwing up for 6 straight days. I cant keep anything down. Not even water. Ive thrown up so much today black substance comes out. I dont know what to do anymore I feel miserable and unenergetic. Should I got to the hospital?? The tone of this speech could best be described as expressing a feeling offear.hope.anger.pride. HELP ASAP!!Write the place where you would most logically go, according to the information given.Begin with the French of "to the" ( la, l', or au) before the location.Ex. l'htel Tu vas ici pour passer une nuit en vacances,1. Tu vas ici pour acheter les mdicaments,2. Tu vas ici pour regarder les films,3. Tu vas ici pour regarder les animaux4. Tu vas ici pour voyager loin.5. Tu vas ici pour une crmonie de mariage,6. Tu vas ici pour les livres.7. Tu vas ici pour l'agriculture,.8. Tu vas ici pour les statues et les peintures,9. Tu vas ici pour les lettres et les paquets.10. Tu vas ici pour la musique et pour danser11. Tu vas ici pour faire du shopping.12. Tu vas ici pour les docteurs.13. Tu vas ici pour la police.14. Tu vas ici pour faire un pique-nique et jouer. Why would someone be willing to share the economic right to business ownership by forming a general partnership?