In Scene 5, as the kids sit at the lunch counter for the first time, “the room falls silent.” Why?

Answers

Answer 1

Because they were the only non-white group entering the Katz Drug Store.

What was life like in 1958 for blacks living in the United States?

Historically speaking, life for a black girl in Oklahoma City in 1958 was marked by pervasive racial segregation, discrimination, and violence. Jim Crow laws were still in effect, and Black people were subjected to systemic oppression and prejudice.

Schools, housing, and public spaces were strictly segregated, and Black people had limited access to education, healthcare, and employment opportunities.

Thus, the scenes depicted below rightly described how blacks were generally treated at the time. Their presence in certain places, unfortunately, resulted in an unusual silence at times from others.

You can learn more about racial segregation in America here https://brainly.com/question/24576052

#SPJ1

An image of scene 5 is attached.

In Scene 5, As The Kids Sit At The Lunch Counter For The First Time, The Room Falls Silent. Why?

Related Questions

You accidentally spilled spaghetti sauce on your brand new shirt, a shirt you are wearing for the very first time! You say to your friend, "See, this is why I can't have nice things. " What fallacy are you guilty of?

Answers

Answer:

c

Explanation:

I need a twelve-minute informational speech written about the Economic Impacts of Farming, How Technology Affects Farming, and How The Environment Affects Agriculture and Agriculture in Iowa. I need this by Friday night and would be very grateful

Answers

Explanation:

Good evening, ladies and gentlemen.

Today, I would like to talk about the economic impacts of farming, how technology affects farming, and how the environment affects agriculture, with a special focus on agriculture in Iowa.

First, let's talk about the economic impacts of farming. Agriculture is a significant contributor to the economy of not just Iowa, but the entire United States. The agricultural sector supports millions of jobs, and the products produced by farms are sold domestically and internationally, generating billions of dollars in revenue each year. In Iowa alone, agriculture contributes over $112 billion annually to the state's economy, with the majority of that coming from crop production.

Now let's discuss how technology affects farming. Technology has revolutionized the way farming is done. Advances in machinery, genetics, and precision agriculture have increased the efficiency and productivity of farms while reducing labor requirements. Technology also allows farmers to better monitor crops, manage pests and diseases, and optimize resource use. Iowa, being one of the leading agricultural states, has been at the forefront of agricultural technology adoption. Precision agriculture techniques, such as GPS-guided tractors and drones, have helped farmers in Iowa increase yields while reducing inputs, making farming more sustainable.

Finally, let's talk about how the environment affects agriculture. Farming is a sector that is particularly vulnerable to the impacts of climate change, such as droughts, floods, and extreme weather events. These impacts can have a significant impact on crop yields, food prices, and the livelihoods of farmers. In Iowa, agriculture is facing significant environmental challenges, such as soil erosion, nutrient runoff, and water pollution. These issues have led to increased regulation and adoption of conservation practices, such as cover crops and no-till farming, to protect the environment and maintain soil health.

In conclusion, agriculture is a vital sector to the economy of Iowa and the United States. Technology has revolutionized farming, increasing productivity and efficiency, and helping farmers to better manage resources. However, the sector faces significant environmental challenges that require the adoption of sustainable practices. I hope this speech has provided you with a better understanding of the economic impacts of farming, how technology affects farming, and how the environment affects agriculture, with a specific focus on agriculture in Iowa. Thank you for listening.

What is the best way to combine sentences 13 and 14? A. Using parks in this way takes coordination and effort because many people want to use the same field. B. Using parks in this way takes coordination and effort even though people want to use the same field. C. Using parks in this way takes coordination and effort, and people want to use the same field. D. Using parks in this way takes coordination and effort, but people want to use the same field.

Answers

Answer:

A

Explanation:

Im not an expert, but it sounds right, more fluid sounding

identify the error in the following sentence and the best way to fix it.

My youngers brothers best friend.

A. It is a fragment and needs a subject
B. It has a comma splice and needs a conjunction
C. It is a fragment and needs a verb
D. It is a run on sentence and needs a period or semicolon

Answers

An incomplete sentence that has been substituted for a full sentence is referred to as a sentence fragment. The subject and predicate needed to convert a sentence fragment.

What is a sentence fragment that can be fixed?

Fill in missing sections of sentences by using an adverb or a conjunction to connect the two components. True: Because of how challenging his classes may be, students loathe Mr. Jones.

A sentence error is caused by a fragment, why?

A sentence fragment, in its simplest form, is a clause that lacks one of the three essential elements of a proper sentence: a subject, a verb, and a complete thought. As a result of how easily our partial thoughts might pass for entire sentences, we frequently fail to detect our sentence fragments.

To know more about sentence visit :-

https://brainly.com/question/18728726

#SPJ1

Atonement is defined as ""making amends for a wrong or injury. "" Find one passage from these chapters that reflects the need for one to find atonement. Write the passage word-for-word

Answers

"But I didn’t want to go and beg to be forgiven, because I felt I had wronged him more deeply than I could ever atone for."

What is forgiven ?

Forgiveness is the act of pardoning someone for their wrongs or mistakes. It is a way to show mercy and understanding, and to let go of the pain, anger, and resentment that may be caused by the wrongdoings of another person. It is a powerful act that can bring healing and peace to a situation. Forgiveness does not mean forgetting, condoning, or excusing the wrongs that were done, but it does mean letting go of the hurt and anger that was caused. When one forgives, they are choosing to move forward with a positive attitude and to focus on the future. It is a way to show mercy and compassion, and to create understanding and peace.

To learn more about forgiven

https://brainly.com/question/26371910

#SPJ1

On the last day of school, a food-fight broke out in the cafeteria even the principal was involved but it was over as soon as it began.

Which punctuation mark should be added to emphasize the part of the sentence in bold?
A.
hyphens
B.
apostrophes
C.
commas
D.
dashes

Answers

Explanation:

D. dashes

........................

What is the correct verb?

Research at the University of Adelaide suggests that just thirty seconds of exposure to drinks with high acidity are enough time to permanently damage tooth enamel

Answers

Answer:

damage

Explanation:

damage is the doing action

5 Correct the mistakes in these sentences. 1 I shouldn't have ate that last piece of cake. 2 I wish I wouldn't be at work right now. 3 If I would speak English better, I could work in the UK. Supposing you can have any job you wanted. What would you choose? 4 5 If only we would afford to buy a big house. 6 It's time you buy a new jacket. That one's falling apart. 7 If I'd have known you were coming I would have tidied the house. 8 I'd rather you not ask me that question.​

Answers

Answer:

It's all correctly wrong

Write a formal letter of complaint to the school principal complaining about the condition of the school​

Answers

To: The Principal, <School Name>

From: <Your Name>

Date: <Date>

Subject: Complaint About School Conditions

Dear Principal <Name>,

I am writing to voice my concerns and dissatisfaction with the current state of our school. Over the past few weeks, it has become evident that the school is in a state of disrepair, and the condition of the classrooms and facilities is not up to acceptable standards.

The classrooms are in a terrible state - chairs and desks are broken, there is graffiti on the walls, and the floor is cracked and littered with dirt and debris. In addition, the bathrooms throughout the school are in a very poor state, with broken fixtures and flooding in some cases. Furthermore, the school cafeteria is unhygienic, and the food is of very low quality.

This deteriorating condition of our school is having a severe impact on the learning environment of the students and i hope you can address this issue and see to this matter

thanking you,

Answer:

Explanation:

Dear

I am the parent of (child’s name and class) who attends (name of school).

I am writing to make a formal complaint about (the person and/or incident you are

complaining about).

I am complaining because (give as much detail about the incident(s) as you can.

Include the date/time, people involved, what happened, any witnesses).

So far the following actions have been taken: (explain what has happened so far

in response to your concerns e.g. meetings, actions by the school. You can

include copies of any letters or emails).

I am not happy with the actions taken because (e.g. not enough done, the problem

is still going on, no action has been taken).

I would like you to put things right by (e.g. offering an apology, changing school

policy, giving my child extra help).

I would like you to investigate this matter further and let me know of the outcome.

(You can put a time deadline here).

I look forward to hearing from you.

Yours sincerely

(Your Name)

how is the celebration of special dad connected to peoples rights and responsibilities?​

Answers

The celebration of a special day, such as on Father's Day, is connected to people's rights and responsibilities in a few ways:

The right to recognition and appreciation: Every person has the right to be recognized and appreciated for their contributions, including fathers and father figures. Celebrating Father's Day is one way to honor and recognize the important role that fathers play in families and society.The responsibility to show gratitude and respect: Along with the right to recognition, there is a responsibility to show gratitude and respect towards fathers and father figures. Celebrating Father's Day is an opportunity to express appreciation for the love, support, and guidance that fathers provide.

What other way is the celebration of special day connected to peoples rights and responsibilities?

The celebration of a special day, such as on Father's Day, is also connected to people's rights and responsibilities like;

The responsibility to be a good father: For those who are fathers themselves, celebrating Father's Day can be a reminder of their responsibility to be a good parent and role model for their children. It is a time to reflect on their actions and behavior, and to strive to be the best possible father they can be.

In summary, the celebration of special dads is connected to people's rights and responsibilities through the recognition, appreciation, gratitude, respect, and responsibility

Find more useful information on Father's day;

https://brainly.com/question/19491047

#SPJ1


What is Massimo Bottura doing
about the problem of wasted food?

Answers

In order to bring awareness to the issue of food waste, he started a brand-new program in 2016 called Food for Soul.

Who was Massimo Bottura?

He has established a network of communal kitchens in Paris, Milan, Rio de Janeiro, and London where he and his employees prepare meals every day of the week using leftovers that would otherwise go to waste.

He then extends an invitation to residents of the area to come and enjoy it. Bottura makes it very clear that this is not a soup kitchen, despite the fact that some of these guests are those in need.

It's a cultural endeavor, not a charitable one, he claims. "A decent supper in a lovely environment can restore people's dignity.

Therefore, In order to bring awareness to the issue of food waste, he started a brand-new program in 2016 called Food for Soul.

To learn more about Massimo Bottura, refer to the link:

https://brainly.com/question/946336

#SPJ9

How does the characterization of Talon throughout chapter 1 enhance the author's purpose about Downsiders? Cite evidence to support your analysis.


Consider these questions when constructing your response: -What kind of person is Talon? -Is he a leader or a follower?-How does he treat others?-Why do you think the author made Talon this kind of character? What might the author be trying to show us?

Answers

In Chapter 1 of the novel "Downsiders" by Neal Shusterman, Talon is introduced as a rebellious teenager who enjoys taking risks and breaking rules.

what is the author's purpose in characterizing Talon ?

The author's purpose in characterizing Talon in this way is to show the unique culture and way of life of the Downsiders, who live beneath the streets of New York City.

Talon's rebellious nature and disregard for authority highlight the differences between the Downsiders and those who live above ground. His leadership qualities also demonstrate the strength and resilience of the Downsider community.

Overall, the characterization of Talon in Chapter 1 enhances the author's purpose of highlighting the distinct culture and way of life of the Downsiders, while also challenging stereotypes and encouraging empathy towards those who may be perceived as different.

To learn more about characterization follow the given link:  https://brainly.com/question/1393329

#SPJ1

Why do people succeed cite evidence from this text your own experience and other literature

Answers

Answer: Well, I don't have the text that we're supposed to be using. But I would say some of the qualities that help people succeed are confidence, showing pride in what you do is always important. Teamwork is also another quality that helps people succeed, learning how to work and solve problems with others is important. Finally, a good work ethic is one of the most useful and helpful qualities. It's useful because you learn how to use your brain and tools in tough situations.

what is a thesis statement for the moon and how will you connect this paragraph back to your thesis? Write a sentence which explains how the evidence above proves your thesis statement.

Answers

Your thesis statement must be related to and supported by the topic sentences, explanation, and supporting details. Topic sentences are brief statements that notify the reader of the main idea of the paragraph (T). It should be related to one of your thesis's concepts.

How does a paragraph relate to a thesis?

The greatest way to ensure that a body paragraph supports your thesis is to keep it focused. Make sure that one of the claims from your thesis is the focus of each body paragraph. Then, make sure the evidence in each paragraph is concentrated on that particular assertion.

A paragraph's thesis statement is what, exactly?

How do I write a thesis statement? The sentence that states the thesis identifies a writing assignment's primary idea and aids in controlling the ideas that are included in the document. That goes beyond being a topic. It frequently expresses a writer's opinion or assessment of a piece of writing or a personal encounter.

To know more about Thesis statement visit:

https://brainly.com/question/30854934

#SPJ1

anyone read the story of ona judge if you have please give the most braniliest expert verified answer possible please the question is How does Ona judge not allow herself to be defined by her circumstances? according to the book
it is never caught the story of ona judge

Answers

Ona did not allow herself to be defined by her circumstances because she never accepted her position as a slave and sought freedom knowing that it was her right.

Who was Ona Judge?She was a personal slave of Martha Washington.She was an activist for abolition.

Ona Judge was born a slave and over time she learned about the states where slavery was prohibited and that there were free black people who fled. She began to see freedom as a right and realized that slavery did not define her, like any of the limitations that surrounded her.

Therefore, even in the midst of difficulties, she knew that she was an intelligent woman and capable of overcoming the oppression she was experiencing.

Learn more about slavery:

https://brainly.com/question/9331183

#SPJ1

Which category of copyright law does computer programming falls under?
(1 point)
O pictures, graphics, and sculptures
O written works
O dramatic works
O sound and voice recordings

Answers

Computer programming generally falls under the category of "written works" in copyright law. Option B.

What does written works comprise?

Written works" generally comprise any original creative works that are fixed in a tangible form of expression, including:

Books, articles, and other literary worksPoetry and other verseSoftware code and computer programsWebsites, blogs, and other online contentScripts for movies, TV shows, and playsLectures, speeches, and other non-fiction works

This category also includes related materials like illustrations, charts, graphs, and other visual aids that are integrated into the written work. Overall, the "written works" category is quite broad and encompasses a wide range of creative and intellectual endeavors.

Find more useful information on computer programs here;

https://brainly.com/question/14618533

#SPJ1

what kind of phrase is "catching the right apprehension" of things

Answers

"Catching the right apprehension" is a phrase that describes the act of perceiving or understanding something correctly.

What are different types of phrases ?

Noun phrase (NP): A phrase that functions as a noun in a sentence, e.g. "the blue car" or "a book on astronomy."

Verb phrase (VP): A phrase that functions as a verb in a sentence, e.g. "is running" or "should have been sleeping."

Adjective phrase (AdjP): A phrase that functions as an adjective in a sentence, e.g. "very happy" or "incredibly smart."

Adverb phrase (AdvP): A phrase that functions as an adverb in a sentence, e.g. "quite slowly" or "very carefully."

Prepositional phrase (PP): A phrase that includes a preposition and a noun or pronoun, e.g. "in the park" or "with my friends."

Infinitive phrase (InfP): A phrase that includes an infinitive verb and any complements or modifiers, e.g. "to run" or "to eat a sandwich."

Gerund phrase (GerP): A phrase that includes a gerund verb (-ing form) and any complements or modifiers, e.g. "running in the park" or "eating a sandwich."

Participial phrase (PartP): A phrase that includes a participial verb (-ed or -ing form) and any complements or modifiers, e.g. "painted blue" or "crying in the corner."

"Catching the right apprehension" is a phrase that describes the act of perceiving or understanding something correctly. The word "apprehension" here refers to the act of comprehending or grasping something, and "catching" suggests the idea of capturing or getting hold of it. So, the phrase "catching the right apprehension of things" means to accurately perceive or understand things in the correct way.

To learn more about phrase follow the given link:

https://brainly.com/question/25073409

#SPJ1

Write an essay that synthesizes material from at least three of the sources and develops your position on the extent to which privatizing space exploration is beneficial. Source a (mccarthy) source b (schwartz) source c (pappalardo) source d (table) source e (cartoon) source f (al-rodhan)

Answers

Answer: Here is my essay

Explanation: Space exploration has always been a realm of human endeavor that has inspired the imagination and pushed the boundaries of science and technology. With the dawn of the private sector space industry, the potential of space exploration has been vastly increased. However, the extent to which privatizing space exploration is beneficial is a hotly contested issue. This essay will synthesize material from six sources in order to assess the benefits of privatizing space exploration.

To begin with, Source A (McCarthy) argues that the private sector has the potential to revolutionize space exploration by providing the necessary funds and resources to pursue ambitious projects. Private companies can invest in projects that governments may be unwilling to fund, such as space tourism and commercial space flights, which could increase the public's interest in space exploration. Furthermore, the private sector can provide the technical expertise and resources to tackle complex projects, such as the exploration of the moon and Mars, which are essential to the furthering of space exploration.

In contrast, Source B (Schwartz) states that the privatization of space exploration could lead to a two-tier system, in which the wealthy can access space exploration opportunities while poorer countries are excluded. The author points out that governments are better placed to ensure that space exploration is conducted in a

Space exploration is the study of the universe beyond the Earth's atmosphere using a variety of methods. It involves sending probes, satellites, and people to explore.

What is an essay?

An essay is a written piece of work that presents an argument or discusses a particular topic. It is typically structured into an introduction, body paragraphs, and a conclusion.

The introduction provides background information on the topic and a thesis statement that outlines the main argument of the essay. The body paragraphs provide evidence, examples, and analysis to support the thesis, while the conclusion summarizes the main points and reiterates the thesis in a new way.

Essays can vary in length, style, and purpose, and can be written for academic, professional, or personal reasons.

Learn more about essays, here:

https://brainly.com/question/20426054

#SPJ2

Which sentence correctly uses colons?
A.
Norah's mom told her to stop at the library to pick up a copy of C.S. Lewis': The Chronicles of Narnia, The Lion, the Witch, and the Wardrobe.
B.
His favorite: movies were: Casablanca, The Princess Bride, The Notebook, Gladiator, and Sisterhood of the Traveling Pants.
C.
Her recipe for red velvet cupcakes included: flour, vegetable oil, buttermilk, sugar, cocoa powder, eggs, vinegar, and cream cheese for icing.
D.
Paul told us about his resignation: "This is difficult, but I believe it would be best for the students if I step down from my position."

Answers

Explanation:

D. Paul told us about his resignation: "This is difficult, but I believe it would be best for the students if I step down from my position."

Explanation: A colon is used to introduce a quote or explanation, and in this sentence, the colon is used correctly to introduce Paul's quote about his resignation. Option A is incorrect because colons should not be used after author names. Option B is incorrect because it uses colons excessively and incorrectly. Option C is incorrect because the colon should not be used before a list that is not an independent clause.

Answer:

D.

Explanation:

All the others insert them in awkward places.

Write a sentence for the word morbid, but as a metaphor.

Answers

Explanation:

The morbid curiosity of the audience was like a moth drawn to the flame of the macabre performance.

write a letter to the minister of education in your country discussing at least three ways by which the quality of education could be improved. 450 words ​

Answers

The letter to the minister of education in your country discussing at least three ways by which the quality of education could be improved can be considered as a formal letter.

What is a formal letter?

A formal letter can be described as one that can be written to official people. check below for this letter.

Dear Honorable Minister of Education,

I am writing this letter to you to discuss three ways by which the quality of education in our country could be improved. As you know, education is the backbone of a nation, and it is essential that we strive to provide our students with the best possible education. Here are three suggestions that I believe can help improve the quality of education in our country.

Teacher Training: One of the most crucial aspects of improving the quality of education is to ensure that our teachers are well-trained and equipped with the necessary skills and knowledge. There should be regular teacher training programs that help teachers stay up-to-date with the latest teaching methodologies, technologies, and practices. We should also encourage teachers to attend workshops and conferences, which can expose them to new ideas and best practices.

Technology Integration: Technology is rapidly changing the way we live and work, and it can also transform the way we learn. Integrating technology in classrooms can help make learning more engaging and interactive, and it can also provide access to a wealth of online resources that can enrich the learning experience. We should consider providing more access to technology, such as tablets, laptops, and smartboards, and also invest in creating digital resources, such as online courses and educational videos.

Curriculum Review: Our curriculum should be regularly reviewed to ensure that it is relevant and up-to-date. The curriculum should focus on providing students with the necessary knowledge and skills to succeed.

                                                                                 Yours faithfully,

                                                                                            John

Learn more about letter at:

https://brainly.com/question/24140747

#SPJ1

THIS IS FOR ECONOMICS
money someone makes, the ___________________ taxes they pay.

Answers

The more someone makes, the more taxes they pay.

Describe the tuck's return to Treegap. What do they do? What do they discover?​ (in 10 sentences)

Answers

The Tucks have returned to Tree gap, but obviously many years after the events of Winnie's August days. There are many changes in the village, including crossing streets and lines down the middle of them. The forest is completely gone, no tree left, and so is Winnie's cottage.

What do you mean by Discover?

To discover is to find information, a place, or an object, especially for the first time.

Tree gap is a small rural town and most of the story of treegap takes place near Foster's land in the countryside. A map of Tree gap in Tuck Everlasting would show the tree with the spring hidden in the center of Foster's woods.

Therefore, The Tucks have returned to Tree gap.

Learn more about Discover, here;

https://brainly.com/question/12500753

#SPJ1

Read the paragraph.

Attending career day this spring will be helpful to all seniors, regardless of their future plans. By talking to potential future employers, students can learn about careers they have never heard of before. They can also learn which college degrees may be the most useful to them later in life.

What does the phrase "later in life” contribute to the text?

The phrase helps to conclude the text and does not add to the writing.
The phrase adds details to the text by summarizing the main idea.
The phrase adds a specific detail about time that is relevant to the text’s topic.
The phrase helps to introduce the text’s topic by providing a direct object.

Answers

Answer: The phrase adds details to the text by summarizing the main idea I believe.

I hope this helps!

Answer:

b

Explanation:

Question 1. (a) of the/are venomous/only/300 out/species/2700 known (b) which is/yellow liquid/water/snake venom/90% of/is a (c) expelled/poison gland/that is/it is/from the/substance (d) of thick/are/connective/these glands/made/tissues (e) used it/in the/to treat/doctors/12th century/leprosy

please he me put it in order and make a paragraph ​

Answers

We can put the words in order and form a paragraph providing information about venomous snakes, as the one seen below, with attention to nouns.

Only 300 out of the 2700 known species of snakes are venomous. Of the venomous snakes, 90% of the yellow liquid expelled from the poison gland is snake venom. This thick substance is made of connective tissues from these glands. It is used by doctors, who have been using it since the 12th century, to treat leprosy.

How to put words in order

To be able to put the words in the correct order, we read them paying attention to the nouns first, then the verbs. They are the words that have the most important meaning, that reveal the topic of the paragraph.

For instance, we noticed that the adjective and noun "venomous snakes" were important. Thus, it was easy to organize the words and form a paragraph providing information about venomous snakes.

Learn more about words in order here:

https://brainly.com/question/30448152

#SPJ1

After you know the outcome of the story, might there be a reason Dr. Heidegger chose these people for the experiment, other than reasons he told them?

Answers

It is possible that Dr. Heidegger had reasons for choosing the particular people for his experiment other than those he told them. The story "Dr. Heidegger's Experiment" by Nathaniel Hawthorne is a tale of moral allegory, and Dr. Heidegger is portrayed as a character who is fascinated by the effects of human behavior and aging.

What is  Dr. Heidegger doing?

He conducts the experiment as a means of exploring the human condition and exposing the flaws and weaknesses of his subjects.

Given Dr. Heidegger's manipulative nature and his interest in the darker aspects of human behavior, it is possible that he selected the particular subjects for his experiment based on their character flaws and weaknesses.

Therefore, In this way, Dr. Heidegger's experiment can be seen as a means of exposing the weaknesses and flaws of human nature, and his selection of particular subjects may have been motivated by his desire to explore these flaws in a controlled environment.

Learn more about  Dr. Heidegger on:

https://brainly.com/question/23394184

#SPJ1

Pls help thank you will mark the brainliest

Answers

The part the apothecary plays in the tragedy is selling Romeo the lethal poison, hence a pharmacist according to Romeo, in Romeo and Juliet's Act V, scene I. Shakespeare personifies and represents Death itself by having the Mantuan apothecary appear as a skeleton.

What does an apothecary sell to Romeo?

Early in his career, William Shakespeare wrote the tragedy Romeo and Juliet, which tells the story of two young lovers who were star-crossed, and how their deaths eventually brought their warring families together. The Apothecary claims to have something similar to poison, but selling poison in Mantua is punishable by death.  

Romeo makes a generous offer to the apothecary, a beggar, who initially declines to sell him because doing so would be against the law. Eventually, the sale is consummated.  As a result, when he sells Romeo the lethal poison, the apothecary significantly contributes to the tragedy.

To learn more about Romeo and Juliet, visit:

https://brainly.com/question/20091298

#SPJ1

Answer: Pharmacist

Explanation: they give out drugs

Based on the passage, what inference should readers make about Danica Patrick’s IndyCar win?

Danica Patrick is a careless driver.
Danica Patrick will do anything to win.
Danica Patrick’s win helps all female racers.
Danica Patrick does not take chances.

Answers

With Danica Patrick's IndyCar victory, readers should note that it benefits all female racers.

Does Danica Patrick have a romantic partner?

Danica Patrick, a former NASCAR racer who is now a businesswoman, has had a number of prominent partnerships throughout the years. Patrick, who is most known for her years-long relationship with Aaron Rodgers, is currently dating Carter Comstock. The former NASCAR driver, though, is OK with being single.

Danica Patrick is now where?

She continues to run Somnium, a winery in California, and she also runs a young candle business (her Voyant candles come in the shape of a wine glass). Afterwards, she hosts her third annual "Pretty Intense" podcast.

To know more about Danica Patrick visit:

https://brainly.com/question/19517996

#SPJ1

Part A
What is the sentral idea in the newsela article washed up plastic becomes art with a vital message

Answers

Answer:

do not pollute but recycle

Explanation:

What inferences, generalizations, and conclusions based on evidence can be drawn from the song "Blowin' in the Wind" by Bob Dylan?

Answers

The inferences, generalizations, and conclusions based on evidence can be drawn from the song "Blowin' in the Wind" by Bob Dylan refers to fighting for the rights and equality.

Who is Bob Dylan?

Bob Dylan was an American singer and the songwriter. There were many songs were written by the Bob Dylan, like  "Blowin' in the Wind." He was regarded as the one of  the greatest songwriter of all time.

Inferences   -    Anti-war song. Generalizations  -  Folk Evidence  -   It was released as a single and considered on his album The Freewheelin' Bob Dylan in 1963.

As a result, the inferences, generalizations, and conclusions based on evidence can be drawn from the song "Blowin' in the Wind" by Bob Dylan are aforementioned.

Learn more about the Bob Dylan here:

https://brainly.com/question/22740126

#SPJ1

Other Questions
Record yourself giving a performance of as much of "Chatter at a Royal Ball" as you cminutes if you need, and when you are ready, just click on the record button. You canREPLAY.*Note: This is a practice activity. Completing this activity will not only prepare you forimportantly, it will enhance your language ability. This activity will not count towards yo The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers?