In Exercises 51-56, find all solutions to the equation in the interval \( [0,2 \pi) \). You do not need a calculator. 51. \( 2 \cos x \sin x-\cos x=0 \) 52. \( \sqrt{2} \tan x \cos x-\tan x=0 \) 53. \

Answers

Answer 1

Solutions to Exercises 51-56:

The equation can be rewritten as: \( \cos x (2 \sin x-1)=0 \). The solutions are: \( \cos x=0 \) or \( \sin x=\frac{1}{2} \). The solutions in the interval \( [0,2 \pi) \) are: \( x=\frac{\pi}{2}, \frac{3 \pi}{2}, \frac{\pi}{6}, \frac{5 \pi}{6} \).

The equation can be rewritten as: \( \tan x (\sqrt{2} \cos x-1)=0 \). The solutions are: \( \tan x=0 \) or \( \cos x=\frac{1}{\sqrt{2}} \). The solutions in the interval \( [0,2 \pi) \) are: \( x=0, \pi, \frac{\pi}{4}, \frac{3 \pi}{4}, \frac{5 \pi}{4}, \frac{7 \pi}{4} \).

The equation can be rewritten as: \( \sin x (1-\cos x)=0 \). The solutions are: \( \sin x=0 \) or \( \cos x=1 \). The solutions in the interval \( [0,2 \pi) \) are: \( x=0, \pi, 2 \pi \).

Overall, the solutions to these exercises can be found by factoring the equations and finding the solutions to each factor in the given interval.

Learn more about interval

brainly.com/question/30486507

#SPJ11

Answer 2

The solutions in the interval \( [0,2 \pi) \) are x = 0, π, and 2π.

In Exercises 51-56, find all solutions to the equation in the interval \( [0,2 \pi) \). You do not need a calculator.

51. \( 2 \cos x \sin x-\cos x=0 \): The solutions in the interval \( [0,2 \pi) \) are x = 0, π, and 2π.

52. \( \sqrt{2} \tan x \cos x-\tan x=0 \): The solutions in the interval \( [0,2 \pi) \) are x = π/4, 3π/4, 5π/4, and 7π/4.

53. \( 2 \cos^2 x-\sin^2 x=1 \): The solutions in the interval \( [0,2 \pi) \) are x = 0, π, and 2π.

Learn more about  interval

brainly.com/question/13708942

#SPJ11


Related Questions

Let k be a field. Show that I = {p(x) ∈ k[x] : p(0) =
0} is an ideal of k[x] and
that it is a principle ideal.

Answers

I is both an ideal of k[x] and a principle ideal.

Let k be a field. The ideal of k, I = {p(x) ∈ k[x] : p(0) = 0}, is an ideal of k[x] because it satisfies the following properties:

1) Closure under addition: If p(x) and q(x) are both in I, then p(x) + q(x) is also in I. This is because p(0) + q(0) = 0 + 0 = 0, so (p + q)(0) = 0.

2) Closure under multiplication by elements of k[x]: If p(x) is in I and r(x) is any polynomial in k[x], then r(x)p(x) is also in I. This is because r(0)p(0) = 0, so (rp)(0) = 0.

Additionally, I is a principle ideal because it can be generated by a single element. In this case, the principle idea is the polynomial x, since any polynomial in I can be written as a multiple of x. For example, if p(x) = x^2 + 2x, then p(x) = x(x + 2), so p(x) is a multiple of x and is therefore in the ideal generated by x.

Therefore, I is both an ideal of k[x] and a principle ideal.

Learn about Ideal

brainly.com/question/12961537

#SPJ11

Is the algebraic expression a polynomial? If it is, write the polynomial in standard form. 3x^(2)+3x^(-3)-2

Answers

Yes, the algebraic expression [tex]3x^(2)+3x^(-3)-2[/tex] is a polynomial.

A polynomial is an algebraic expression consisting of variables and coefficients that involves only the operations of addition, subtraction, and multiplication, as well as non-negative integer exponents. The given algebraic expression satisfies these conditions, so it is a polynomial.

To write the polynomial in standard form, we need to rearrange the terms in descending order of exponents. In this case, the term with the highest exponent is [tex]3x^(2)[/tex], followed by the term with the lowest exponent, [tex]3x^(-3)[/tex], and finally the constant term, -2.

Therefore, the polynomial in standard form is:[tex]3x^(2)+3x^(-3)-2 = 3x^(2)-2+3x^(-3)[/tex] So, the polynomial in standard form is  [tex]3x^(2)-2+3x^(-3)[/tex].

To know more about polynomial refer here:

https://brainly.com/question/11536910

#SPJ11

(u, ɸ) = ∫ 1/√x ɸ(x) dx, ɸ E D (R).
Prove u defines a distribution and calculate u' derivative in terms of distributions.

Answers

The derivative of u in terms of distributions.

Proof:

First, let's prove that u defines a distribution. To do this, we need to show that u is linear and continuous.
Linearity:

Let ɸ₁ and ɸ₂ be two test functions and let a and b be two scalars. Then:

u(aɸ₁ + bɸ₂) = ∫ 1/√x (aɸ₁(x) + bɸ₂(x)) dx

= a∫ 1/√x ɸ₁(x) dx + b∫ 1/√x ɸ₂(x) dx

= au(ɸ₁) + bu(ɸ₂)

Therefore, u is linear.
Continuity:

Let ɸₙ be a sequence of test functions converging to 0 in D(R). Then:

|u(ɸₙ)| = |∫ 1/√x ɸₙ(x) dx|

≤ ∫ |1/√x ɸₙ(x)| dx

≤ ∫ |1/√x| |ɸₙ(x)| dx

≤ ∫ |1/√x| ||ɸₙ||∞ dx

= ||ɸₙ||∞ ∫ |1/√x| dx

Since ɸₙ converges to 0 in D(R), ||ɸₙ||∞ → 0 as n → ∞. Also, ∫ |1/√x| dx is finite. Therefore, |u(ɸₙ)| → 0 as n → ∞, which means u is continuous.

Since u is linear and continuous, u defines a distribution.
Derivative:

Now, let's calculate the derivative of u in terms of distributions. By definition, the derivative of a distribution u is another distribution u' such that:

u'(ɸ) = -u(ɸ')

So, we need to find a distribution u' that satisfies this equation. Let's substitute the definition of u into the equation:

u'(ɸ) = -∫ 1/√x ɸ'(x) dx

Now, let's integrate by parts:

u'(ɸ) = -[1/√x ɸ(x)]∞₀ + ∫ ɸ(x) d(1/√x) dx

= -[1/√x ɸ(x)]∞₀ + ∫ ɸ(x) (-1/2x^(3/2)) dx

= ∫ (1/2x^(3/2)) ɸ(x) dx

Therefore, the derivative of u in terms of distributions is:

u'(ɸ) = ∫ (1/2x^(3/2)) ɸ(x) dx

This is the distribution that satisfies the equation u'(ɸ) = -u(ɸ').

Learn more about distribution

brainly.com/question/30051967

#SPJ11

Can someone please solve this?

3(2x+5)+2x=x+50
x=5
Hint: x+50
-x

Answers

Answer: x=5

Step-by-step explanation:

Jason earns $232.50 per week as the manager at Big Bucks Department Store. He is single and claimed 1 allowance last year. How much more will be deducted from his weekly check if he claims no
allowances?

Answers

The difference in the amount of tax withheld based on his previous W-4 form and the new W-4 form is estimated to be $7 per week for federal income tax withholding, meaning $7 more will be deducted from his weekly check if he claims no allowances.

How to Calculate Claimed Allowances?

The amount of tax withheld from Jason's paycheck depends on his taxable income, which is his gross income minus any deductions and exemptions. The number of allowances claimed on his W-4 form affects the amount of his paycheck that is subject to tax withholding.

If Jason claimed 1 allowance last year, his employer withheld tax as if he had $4,300 less in taxable income than if he had claimed no allowances. For 2023, the value of each allowance is $4,350.

Therefore, if Jason claims no allowances on his W-4 form, his taxable income will be $4,350 more than if he claimed 1 allowance.

Jason's gross income is $232.50 per week, which translates to $12,090 per year. If he claimed 1 allowance last year, his taxable income was $12,090 - $4,300 = $7,790. If he claims no allowances this year, his taxable income will be $7,790 + $4,350 = $12,140.

To determine how much more tax will be withheld from his weekly paycheck, we need to calculate the difference in the amount of tax withheld based on his previous W-4 form and the amount of tax withheld based on the new W-4 form.

Assuming that Jason is paid weekly, we can use the IRS tax withholding tables to estimate the federal income tax withheld for each situation.

Based on the 2023 IRS tax withholding tables, if Jason is single and claims 1 allowance, his employer would withhold $32 per week from his paycheck for federal income tax.

If he claims no allowances, his employer would withhold $39 per week from his paycheck for federal income tax.

Therefore, if Jason claims no allowances, $39 - $32 = $7 more will be deducted from his weekly check for federal income tax withholding.

Learn more about claimed allowances on:

https://brainly.com/question/1212566

#SPJ1

Kingston weighed 9 pounds, 2 ounces at birth. His baby brother, Karmichael, weighed 7 pounds, 11 ounces a birth. How much bigger was Kingston's birth weight compared to Karmichael's?

Answers

Answer: 1lb 7oz

Step-by-step explanation:

All you have to do is subtract 9lbs and 2oz by 7lbs and 11oz, which is 1lb and 7oz

(16 oz in a pound)

Which is the graph
F(x)=4(1/2)x

Answers

Answer:

Step-by-step explanation:

Please help me I don’t want to fail

Answers

The measure of line KR is 8 inches

How to determine the measure of the length

It is important that we know the properties of an isosceles trapezoid.

Only one pair of sides are parallelNon-parallel sides are equal in measureThe diagonals are equal in measureThe opposite angles are supplementary, that is, their sum is equal to 180 degrees

From the information given, we have that;

KR = 1/2x + 5

DH = 2x - 4

Since the non- parallel sides of an isosceles trapezoid are equal, then, we have;

KR = DH

1/2x + 5 = 2x - 4

collect the like terns, we have

1/2x - 2x = -4 - 5

x - 4x  /2 = - 9

cross multiply

-3x = -18

x = 6

KR =  1/2(6) + 5 = 8 inches

Learn about isosceles trapezoid at: https://brainly.com/question/10644521

#SPJ1

Evaluate the following by the Change-of-Base Formula:
log13 (297)

- approximately 2.4728

- approximately 2.2198

- approximately 1.1139

- approximately 0.4505

Answers

The answer is approximately 2.2198, which is option (b).

How did we get the value?

To evaluate log13(297) using the change-of-base formula, we can express it in terms of a logarithm with a base that we can easily calculate, such as the common logarithm (base 10) or the natural logarithm (base e).

Let's use the common logarithm:

log13(297) = log10(297) / log10(13)

We can use a calculator to find the decimal approximations of log10(297) and log10(13), and then divide them to get the final answer:

log13(297) ≈ 2.2198 (rounded to 4 decimal places)

Therefore, the answer is approximately 2.2198, which is option (b).

learn more about logarithms: https://brainly.com/question/25710806

#SPJ1

Need help asap! Step by step please, greatly appreciated!

Answers

The value of x from the given exponential function is -8.159.

What is the exponent?

Exponent is defined as the method of expressing large numbers in terms of powers. That means, exponent refers to how many times a number multiplied by itself.

The given equation is [tex]9^{3x}=4^{5x+2}[/tex].

Take the logarithm of both sides of the equation to remove the variable from the exponent.

Here, [tex]ln(9^{3x})=ln(4^{5x+2})[/tex]

x=2ln(4)/3ln(9)-5ln(4)

x= -8.159

Therefore, the value of x is -8.159.

To learn more about an exponents visit:

https://brainly.com/question/15993626.

#SPJ1

Math part 2 question 3

Answers

The value of (g times f)(x) is 6x² + x - 2. So correct is C.

Describe Function?

The input values of a function are called the domain, and the output values are called the range. The domain can be any set of values, but each input value must have a unique corresponding output value. If there are multiple input values that produce the same output value, the function is not considered to be well-defined. Functions are used to model a wide range of phenomena in many different fields, including science, engineering, and economics. They are also used in calculus to study rates of change and slopes of curves.

Overall, functions are a fundamental concept in mathematics, and have many practical applications in the real world.

To find g(x) times f(x), we need to multiply the two functions together.

(g times f)(x) = g(x) * f(x)

First, we need to find g(f(x)):

g(f(x)) = g(3x+2) = 2(3x+2) - 1 = 6x + 3

Now we can substitute this into the expression for (g times f)(x):

(g times f)(x) = g(x) * f(x) = (2x-1) * (3x+2)

Using the distributive property, we get:

(g times f)(x) = 6x² + 4x - 3x - 2 = 6x² + x - 2

Therefore, (g times f)(x) = 6x² + x - 2.

To know more about expression visit:

https://brainly.com/question/14083225

#SPJ1

a culture of a certain bacteria is known to dpuble in number every 4 hr. if the culture has an initial count of 25, what will be the population of the culture at the end of the 24 hr?

Answers

The population of the culture at the end of 24 hours will be 1600.

To find this answer, we can use the formula for exponential growth:

P = P₀ * 2^(t/h)

Where P is the final population, P₀ is the initial population, t is the total time in hours, and h is the time it takes for the population to double.

Plugging in the given values, we get:

P = 25 * 2^(24/4)

Simplifying the exponent:

P = 25 * 2^6

Solving for P:

P = 25 * 64

P = 1600

So the population of the culture at the end of 24 hours will be 1600.

Know more about equations

https://brainly.com/question/22688504

#SPJ11

If RSTU is a rhombus, find m∠UTS.​

Answers

The measure m∠UTS is approximately 90 degrees.

What is rhombus and some of its properties?

Rhombus is a parallelogram whose all sides are of equal lengths.

Its diagonals are perpendicular to each other and they cut each other in half( thus, they're perpendicular bisector of each other).

Its vertex angles are bisected by its diagonals.

The triangles on either side of the diagonals are isosceles and congruent.

We are given that;

Angle VUR=(10x-23)degree

Angle TUV=(3x+19)degree

Now,

Since RSTU is a rhombus, its diagonals are perpendicular bisectors of each other, which means that angle VUT is a right angle. Therefore, we have:

m∠VUR + m∠TUV + m∠VUT = 180°

Substituting the given values, we get:

(10x - 23) + (3x + 19) + 90 = 180

13x + 86 = 180

13x = 94

x = 7.23 (rounded to two decimal places)

Now, we can find m∠UTS as follows:

m∠UTS = m∠VUR + m∠TUV

Substituting the value of x, we get:

m∠UTS = (10x - 23) + (3x + 19)

m∠UTS = (10 × 7.23 - 23) + (3 × 7.23 + 19)

m∠UTS = 72.3 - 23 + 21.69 + 19

m∠UTS = 89.99

Therefore, the answer of the given rhombus will be 90 degrees.

Learn more about a rhombus here:

brainly.com/question/20627264

#SPJ1

I need to solve and shade

Answers

Answer:

Step-by-step explanation:

2). y > - x - 2

    y < - 5x + 2

3). y ≤ [tex]\frac{1}{2}[/tex] x + 2

    y < - 2x - 3

A sample is taken from the 15th and 50th items from 100
production lines. Which is this sampling method?
Answer options:
Systematic sampling
Cluster sampling
Convenient sampling
Stratified sampling

Answers

A sample is taken from the 15th and 50th items from 100 production lines. The sampling method used in this scenario is Systematic sampling.

Systematic sampling is a method in which a sample is taken at regular intervals from a larger population. In this case, the sample is taken from the 15th and 50th items from 100 production lines, meaning that the sample is taken at regular intervals from the larger population of 100 production lines.

This method is different from cluster sampling, which involves dividing the population into groups and then selecting a sample from each group. It is also different from convenient sampling, which involves selecting a sample based on convenience or accessibility.

Finally, it is different from stratified sampling, which involves dividing the population into strata and then selecting a sample from each stratum. Therefore, the correct answer is Systematic sampling.

Learn more about the Sampling procedure, here:

brainly.com/question/29781946

#SPJ11

Classify the polygon. Be as specific as possible.

Quadrilateral JKLM with JK = 10, KL = 7, ML = 10, and JM = 7

Answers

We can say that JKLM is an isosceles trapezoid, since the non-parallel sides (JK and ML) are congruent.

What is Polygon?

A polygon is a closed plane figure with three or more straight sides that meet at the vertices. It is formed by connecting line segments endpoint-to-endpoint with each segment intersecting exactly two others.

The given quadrilateral JKLM has four sides, and its opposite sides are parallel.

Furthermore, since all four sides have different lengths, it is not a parallelogram.

Also, since no angles or sides are congruent, it is not a kite or a rhombus.

Therefore, the most specific classification for this quadrilateral would be a trapezoid, which is a quadrilateral with one pair of parallel sides.

To be more specific, we can say that JKLM is an isosceles trapezoid, since the non-parallel sides (JK and ML) are congruent.

To learn more about Polygon from the given link

https://brainly.com/question/1592456

#SPJ1

(Answer Quick) Can you show the work as well?
Giving 30 points!

Answers

they are adjacent (they share the same vertex)
& for the angles:
since it is a right angle the total is 90 degrees, therefore
90=4x+2x
90=6x
x=15

If the artist charges $280
for a painting that takes 7
hours to create, which equation represents the total amount, t
, the artist charges for a painting that takes h
hours to create?

Answers

Answer:

Step-by-step explanation:

idrk

Complete the equation of the line whose yyy-intercept is (0,-1)(0,−1)left parenthesis, 0, comma, minus, 1, right parenthesis and slope is 444.what is y=

Answers

Answer:

The equation of a line in slope-intercept form is y = mx + b, where m is the slope and b is the y-intercept.

In this case, the y-intercept is (0, -1) and the slope is 4. So we have:

y = 4x - 1

Therefore, the equation of the line with y-intercept (0, -1) and slope 4 is y = 4x - 1.

Describe the graph of y=1/2x-10 compared to the graph of y=1/x

Answers

The equation y=1/2x-10 is in the slope-intercept form while the other equation y=1/x is a hyperbola.

What is the hyperbola?

A circular cone and a plane that passes through both of the cone's nappes (see cone) connect to form a hyperbola, a two-branched open curve with a conic section.

A hyperbola is made up of two mirror images of one another that resemble two infinite bows.

These two sections are known as connected components or branches.

the hyperbola's equation denoted as (xh)2a2(yk)2b2=1).

So, the equation y=1/2x-10 is in the slope-intercept form and we know the slope which is 1/2, and b which is -10 by just observing the equation.

On the other hand, y=1/x is the hyperbola.

Therefore, the equation y=1/2x-10 is in the slope-intercept form while the other equation y=1/x is a hyperbola.

Know more about the hyperbola here:

https://brainly.com/question/3351710

#SPJ1

Martina spent a total of $15 at the grocery store. Of this amount, she spent $12 on fruit. What percentage of the total did she spend on fruit?

Answers

If Martina spent a total of $15 at the grocery store. Of this amount, she spent $12 on fruit then Martina spent 80% of the total on fruit.

To find the percentage of the total that Martina spent on fruit, we can use the following formula:

percentage = (part / whole) x 100%

where "part" is the amount spent on fruit and "whole" is the total amount spent.

In this case, Martina spent $12 on fruit and a total of $15, so:

percentage = (12 / 15) x 100% = 80%

Therefore, Martina spent 80% of the total on fruit.

The concept used in the solution is percentage, which is a way of expressing a proportion or a fraction as a number out of 100. In this case, we want to find the percentage of the total amount spent that was spent on fruit.

To calculate the percentage, we first need to find the part and the whole. The "part" refers to the amount of money spent on fruit, which is $12 in this case. The "whole" refers to the total amount of money spent, which is $15.

The formula used to find the percentage is:

percentage = (part / whole) x 100%

By plugging in the values we know, we get:

percentage = (12 / 15) x 100% = 0.8 x 100% = 80%

This means that Martina spent 80% of her total grocery bill on fruit.

Learn more about the percentage:

brainly.com/question/29306119

#SPJ4

Students were asked to prove the identity (sec x)(csc x) = cot x + tan x. Two students' work is given.
Part A: Did either student verify the identity properly? Explain why or why not. (10 points)

Part B: Name two identities that were used in Student A's verification and the steps they appear in. (5 points)

Answers

The expression is proved by the following steps.

What is Trigonometric Functions?

Trigonometry uses six fundamental trigonometric operations. Trigonometric ratios describe these operations. The sine function, cosine function, secant function, co-secant function, tangent function, and co-tangent function are the six fundamental trigonometric functions.

The ratio of sides of a right-angled triangle is the basis for trigonometric functions and identities. Using trigonometric formulas, the sine, cosine, tangent, secant, and cotangent values are calculated for the perpendicular side, hypotenuse, and base of a right triangle.

Part A:

student A verified the identity properly Reason student A applied the trigonometric identities

Part B:

The identities used in student A verification are

step 1: sec x = 1/cosx

cosecx= 1 /sin x

(sec x)(csc x) = cot x + tan x

Hence this above equation is proved.

Learn more about  Trigonometric Functions, by the following link.

brainly.com/question/24349828

#SPJ1

Leslie is a biologist. She is going to randomly select one animal from her lab to study. There are
5
55 salamanders,
3
33 crayfish, and
12
1212 minnows in her lab.
What is
P(salamander
)
P(salamander)start text, P, left parenthesis, s, a, l, a, m, a, n, d, e, r, end text, right parenthesis?

Answers

Answer:

The probability that Leslie randomly selects a salamander is

1

4

4

1

Step-by-step explanation:

In general, when we are interested in finding the probability of a event, we just need to divide the number of possibilities the event we are interested in can happens by the number of all possible results.

In this case, we have

20

20 differents animals to be chosen and we are interested in when one of the five salamanders is chosen. That is, P(salamander) =

5

20

=

1

4

20

5

=

4

1

Find the common ratio of a geometric sequence, whose first term is 2 and the third term is 242.​

Answers

The common ratio of the geometric sequence is 11.

What is the common ratio of the sequence?

To determine the common ratio r, we can use the formula for the nth term of a geometric sequence. The formula is expressed as;

aₙ = a₁ × r^(n-1)

where a1 is the first term, r is the common ratio, and n is the term number.

We are given that;

First term a₁ = 2Third term a₃  = 242.

We can use these values to write two equations:

aₙ = a₁ × r^(n-1)

a₃ = a₁ × r^(3-1) = 2r² = 242

Solving for r, we get:

r² = 121

r = ±√121

r = ±11

However, we need to determine the sign of the common ratio.

Since the third term is larger than the first term, the common ratio must be positive. Therefore, r = 11.

Learn more about arithmetic sequence here: brainly.com/question/15412619

#SPJ1

Richard buys, fixes, resells small devices, like the Mir487, which consistently needs a transistor replaced. He can buy the transistor for $10.13 and a broken Mir487 for $29.87. Once fixed, he resells the new Mir487 for $259.93. Approximately how much profit will Richard make if he resells 30 Mir487 devices?

A. $7,200.00
B. $7,440.00
C. $6,600.00
D. $8,160.00

Answers

Richard will make a profit of $6,600.00 by selling 30 pieces of Mir487 i.e. Option C

What is Cost Price and Selling Price?The price at which any good or item is purchased at is called its Cost Price i.e. CPThe price at which any good or item is sold at is called its Selling Price i.e. SP

Given :

Price of broken transistor = $10.13

Price of Broken Mir487 = $29.87

Price of selling fixed Mir487 = $259.93

So, cost of making the product i.e. CP

             = Price of Broken Mir487  + Price of broken transistor

             = $29.87 + $10.13

             = $40

Finally, he sells the product i.e. SP = $259.93

Profit on one product = SP - CP

                                    = $259.93 - $40

                                    = $219.93

Profit on 30 products = 30 * Profit on one product

                                    = 30 * $219.93

                                    = $6,597.9

                                    = approximately $ 6,600.00

Thus, Richard will make a profit of  $ 6,600.00 by selling 30 pieces of Mir487.

To learn more about cost and selling price, visit

https://brainly.com/question/28017453

#SPJ1

Round all answers to 3 decimal places. The vertex of g is (-5,2)
The function g has a local _____ of ___ that occurs at u= ____
What is the domain of g in interval notation? What is the range of g in interval notation? The u-intercept(s) of g are ?
The g(u)-intercept is?
On what interval is g increasing? On what interval is g decreasinq?

Answers

The first derivative of a function equals zero on an interval, the function has a relative extremum on that interval.

Answer: The interval on which the function g(x) increases and decreases.The g function's vertex is at (-5, 2), and we need to figure out where the function increases and decreases. When a function has a vertex, it always opens up or down. As a result, the vertex serves as the function's minimum or maximum point.Given the above, we can assume that g(x) decreases to the left of x = -5 and increases to the right of x = -5. If we want to be more precise about the intervals, we can use the first derivative test. The first derivative of g(x) is as follows:g'(x) = 3x + 15The first derivative test states that if the first derivative of a function is greater than zero on an interval, the function is increasing on that interval. If the first derivative of a function is less than zero on an interval, the function is decreasing on that interval. Finally, if the first derivative of a function equals zero on an interval, the function has a relative extremum on that interval. We now need to find where g'(x) > 0 and where g'(x) < 0.3x + 15 > 0 => x > -5g(x) is increasing on the interval (-5, ∞)3x + 15 < 0 => x < -5g(x) is decreasing on the interval (-∞, -5)

Learn more about Derivative

brainly.com/question/30365299

#SPJ11

Tyee goes out to lunch. The bill, before tax and tip, was $14.20. A sales tax of 6% was added on. Tyee tipped 18% on the amount after the sales tax was added. How much tip did he leave? Round to the nearest cent.

Answers

Answer:  

$4.09

Step-by-step explanation:

14.20+6% of 14.20 = 15.05
118% of 15.05= 18.29
18.29-14.20=4.09

Destiny Rubio Definite Integrals of Rational Functions Feb 23, 11:55:41 AM Find the average value of the function f(x)=(12)/(x-10) from x=1 to x=7. Express your answer as a constant times ln3. Answer: ln3 Submit Answer

Answers

The Average value  of the function f(x)=(12)/(x-10) from x=1 to x=7 -2 ln3.

The average value of a function f(x) over the interval [a,b] is given by the formula:

Average value = (1/(b-a)) ∫[a,b] f(x) dx

In this case, the function is f(x) = (12)/(x-10), the interval is [1,7], and we need to find the average value. Plugging in the values into the formula, we get:

Average value = (1/(7-1)) ∫[1,7] (12)/(x-10) dx

Average value = (1/6) ∫[1,7] (12)/(x-10) dx

Next, we need to find the integral of the function. We can use the formula for the integral of a rational function:

∫ (a)/(x-b) dx = a ln|x-b| + C

In this case, a = 12 and b = 10, so the integral of the function is:

∫ (12)/(x-10) dx = 12 ln|x-10| + C

Plugging this back into the formula for the average value, we get:

Average value = (1/6) (12 ln|7-10| - 12 ln|1-10|)

Average value = (1/6) (12 ln|-3| - 12 ln|-9|)

Average value = (1/6) (12 ln|3| - 12 ln|3^2|)

Average value = (1/6) (12 ln|3| - 12 (2 ln|3|))

Average value = (1/6) (12 ln|3| - 24 ln|3|)

Average value = (1/6) (-12 ln|3|)

Average value = -2 ln|3|

Therefore, the average value of the function f(x) = (12)/(x-10) from x = 1 to x = 7 is -2 ln|3|. We can express this as a constant times ln3 by factoring out the ln3:

Average value = -2 ln|3| = -2 ln3

To know more about rational function click on below link:

https://brainly.com/question/20850120#

#SPJ11

What is the shortest distance from the point (6,5) to the line 2x+3y=1 ? (A) √13 (B) 2√13 (C) 4√13 (D) 6√13 (E) None of these

Answers

The shortest distance from a point to a line can be found by using the formula:
d = |Ax + By + C| / √(A² + B²)

where A, B, and C are the coefficients of the line equation and x and y are the coordinates of the point.

In this case, A = 2, B = 3, C = -1, x = 6, and y = 5.
Plugging these values into the formula, we get:
d = |(2)(6) + (3)(5) - 1| / √(2² + 3²)
d = |17| / √(13)
d = 17 / √(13)
d = √(13) * 17 / 13
d = √(13) * √(13) / √(13)
d = √(13)
Therefore, the shortest distance from the point (6,5) to the line 2x+3y=1 is √(13).

To know more about shortest distance refer here:

https://brainly.com/question/15172156

#SPJ11

What is the answer to the question 3 times 3

Answers

Answer: 9

Step-by-step explanation:

Answer:

Step-by-step explanation:

9

Other Questions
The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of