Answer:
Rr and rr
Explanation:
The genotypes of the parents would be heterozygous red (Rr) and true-breeding white (rr).
Since the allele for the red flower color (R) is dominant over that of the white flower color (r), for a cross to produce both red and white flower color plants, the red parent must be heterozygous (Rr) and the white parent true-breeding (rr).
Rr x rr
Rr Rr rr rr
Rr = red
rr = white
If the red parents is true-breeding
RR x rr
Rr Rr Rr Rr
All their offspring would be red without any white flower color.
Hence, the genotypes of the parent are Rr and rr.
Bones provide attachments that allow skeletal muscles to cause movements? True or false
Answer:
True ...........................
What is a niche, and how does it relate to evolution?
Answer:
The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes
Explanation:
ye
In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.
B.
Phosphates are absorbed by the roots of plants.
C.
Animals eat the plants that absorbed the phosphates.
D.
Animals that ate the plants die and decompose.
Answer:
D
Explanation:
Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh
Answer:
Behavior adaptation
Explanation:
Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe
I NEED HELP
1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?
Answer:
1. a chromosome is a dna strand that has genes
2. prophase, metaphase, anaphase, telophase
3. anaphase
4. the two nuclei are identical daughter cells and they have the same number of chromosomes
5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.
sorry if this is wrong but this is how i learned it! hope it helps!
Explanation:
Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water
Answer:
I think its water or sugar.
plzzz help i willl give you a Brainliest if you get it correct
Most scientists come up with questions to investigate out of the blue.
1.true
2. false
Answer:
the correct answer is false.
Replication, Transcription, and Translation Chart
Please answer
DNA Replication:
1。Template Strand: Start with this nucleotide chain.
TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC
2。Complementary DNA Strand: Write directly below template strand.
Transcription:
3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).
Translation:
4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).
5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).
6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).
Answer:
jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
Explanation:
when using a solar powered calculator what source of energy is being used to power the calculater
Answer:
UV rays
Explanation:
At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?
Answer:
It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not
Explanation:
When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment
Answer:
All of the above
Explanation:
Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.
What is the function of cholesterol?
to keep the cell membrane from falling apart
to line the arteries of organisms
to store energy
to give us quick energy
Answer:
to store energy
Explanation:
Its main function is to maintain the integrity and fluidity of cell membranes and to serve as a precursor for the synthesis of substances that are vital for the organism including steroid hormones, bile acids, and vitamin D. Cholesterol is essential for making a number of critical hormones, including the stress hormone cortisol. Cholesterol is also used to make the sex hormones testosterone, progesterone, and estrogen. 2 The liver also uses cholesterol to make bile, a fluid that plays a vital role in the processing and digestion of fats.
what are the two main organs involved in the respiratory system?
Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.
Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.
What is the respiratory system?
The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.
Does eukaryotic cells need more lipids than prokaryotic cells
Answer: yes because they need more energy
Explanation:eukaryotes are more complex than prokaryotes
Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction
Answer:
A, B, D
Explanation:
Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.
Explanation:
occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.
The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic
Why are elements called
the building blocks of matter?
A. They stack up nicely.
B. They make-up all matter.
C. They make-up most of the matter around us.
Answer:
B
Explanation:
In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?
A. 0%
B. 25%
C. 50%
D. 100%
Answer:
i think it may be 50 dont be mad if im wrong
Explanation:
recessive takes over from what i read i dont see any o so it can be half a half b so 50...
Why is sickle cell anemia so harmful to its carriers?
Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK
Explanation:
Answer:
Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.
Sickle cell anemia puts your body at more risk for infection.
Explanation:
the process of which cells make proteins is called protein what?
this is a fill in the blank!
Answer:
protein biosynthesis
Explanation:
prove me wrong
Answer:
any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.
Explanation:
I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight
Answer:
D. Sunlight
Explanation:
Answer:
santa claus
Explanation:
What is the value of the expression 3 divided by 3/4
Answer:
4
Explanation:
If we have the expression, 3/3/4.
Then this is the same as 3 × 4/3
Which is the same as 12/3
Which is the same as 4
Hence the value of the expression 3/3/4 is 4
please help me Which example is a trace fossil?
dinosaur footprint
dinosaur bone
dinosaur egg
shark tooth
Answer:
Dinasour footprint
Explanation:
6 grade science
this is a cell not a plant, because the cell do not contain________
Answer:
Chloroplast.
Explanation:
This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.
If this is the answer you're not looking for, let me know! Hope this helped! :)))
WILL GIVE BRAINLIEST!!!!!!!!!
In all living things, the presence of what structure supports the cell theory.
cell membrane
chloroplast
cell wall
vacuole
Answer:
chloroplast
Explanation:
One danger of excessive nitrogen levels in water is BLANK.
Answer:
light
Explanation:
excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters
As you observe an unknown cell under a microscope, you make the following observations..
Answer:
It is a plant cell that is being observed
Explanation:
With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.
Adaptations of plants in different climatic conditions in Telangana
Explanation:
Note, Telangana is known to be an area whose climate is usually semi-arid, that is, it is an area that is dry and receives some small amount of rain.
Thus, plants in the Telangana region would usually possess the following adaptive features;
ability to survive under extreme heatgrowing longer roots than normal in other to find water in the soilefficient water conservation especially in their stems.
1. Even though the atom is made of charged particles, it is still neutral Explain why. (1 point)
Answer:
An atom is electrically neutral (overall charge is zero) since the total number of protons is equal to the total number of electrons.
Hope this answered your question :)
Please help me with this and answer correctly.
Brainliest will give!!
Answer:
Sorry can't help
Explanation:
PLEASE GIVE ME BRAINLIEST