If there is 20% T bases in a DNA sequence, what percentage of A would there be in the same sequence? 10% 20% 30% 40%

Answers

Answer 1

Answer:

i believe 20% because T base only connects with A base and vise versa. sorry if i am wrong!

Explanation:


Related Questions

refers to the attitudes, behavior, and activities that are socially defined as appropriate for each sex and are learned through the socialization process. OA) Sexual role B) Gender identity OC) Gender role D) Sexual identity​

Answers

Answer:

Gender Role

Explanation:

How people already see how people should act. Example- Be a man.

Answer:

b. sex

Explanation:

edge 2021

Please Help I will mark bRAINLIEST

Answers

Answer:

d

Explanation:

In particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

correct answer gets brainiest. and i’m telling u. if u guess or leave a link, ur getting reported and that’s not a threat

Answers

The correct answer is D

which type of specialized cells would be found in an animal’s neuvous system?

Answers

Animal nerve cells are specialized cells called neurons. Depending upon function, these cells can be divided into sensory neurons, interneurons, and motor neurons.

The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.

What is the nervous system?

The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.

Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.

Therefore, the correct option is D. Cells that can transmit signals around the body.

To learn more about the nervous system, refer to the link:

https://brainly.com/question/29355295

#SPJ2

The question is incomplete. Your most probably complete question is given below:

Cells that transport oxygen are found in the blood.

Cells that secrete hormones to trigger cellular responses.

Cells secrete enzymes to break down food.

Cells that can transmit signals around the body.

What does the phrase of sunshine and of song mean in the poem?
A.
memories
B.
weather
C.
happiness
D.
singing

Answers

Answer:

a

Explanation:

what are the three age categories labels between childhood and adulthood

Answers

Answer: Early adolescence, middle adolescence, and late adolescence.

brainliest or a thank you please :)) <33

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose

Answers

Answer:

 A

Explanation:

     

Somebody please help? Thanks​

Answers

Answer:

None

Explanation:

because y is recessive and it needs to be yy to be green so Yy wouldn't wrok

The answer is none


...

What is the process of the digestive system?

Answers

Answer:

In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.

In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.

Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.

Answers

Natural selection is the survival of the fittest. Basically the organisms that best suit the environment they’re in will survive, and the less suited will pass. Artificial selection is when humans intervene and breed plants and animals to have desired traits. Like if one turtle has a longer neck than the other, and the plants are really tall in an area, people might selectively breed them so less turtles are dying of hunger.

An eastern screech owl, a carnivore, might compete with which organism most intensely for resources?
A. hawk (secondary consumer)
B. mountain lion (secondary consumer)
C. wren (primary consumer)
D. mouse (primary consumer)

NO LINKS PLEASE

Answers

i think it would be A

Help please :) thank u

Answers

Answer:

!! neither mechanical nor chemical digestion

In fruit flies, the allele for normal-sized wings (W) is dominant to the allele for small wings (w). A fly that has normal wings breeds with a fly that has small wings. Several offspring have small wings, and others have normal wings.

A. What are the genotypes of the 2 parental flies?
Normal wings __________
small wings __________

B. Two flies with small wings produce offspring. What type of wings will the offspring
have? Draw a punnett square to support your answer.

C. A short winged fly can be described -using words as what?

D. What type of inheritance is this called?

Answers

Answer:

A. Normal Wings= Ww, Small Wings=ww

B. All offspring will have short wings because short wings trait is recessive.

w. w

______

w| ww |ww|

————-

w|ww |ww |

______

Explanation:

The different forms of the beef cattle color gene are called_

Answers

The answer is right there click on it 271 the beef is colored red

The different forms of the beef cattle color gene are called "alleles"

What are alleles?

Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.

In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.

The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.

Learn more about alleles, here:

https://brainly.com/question/14104138

#SPJ6

The weight of astronaut on the moon will be
A) Less because the moon has less mass
B) Less because the moon has more mass
C) More because the moon has less mass
D) More because the moon has more mass

Answers

Answer:

A

Explanation:

The gravity of a body increases with its size. The moon is smaller than the Earth, so an astronaut will weigh less on the moon than they will on Earth. Good luck ^^

Explanation:

A because im big brain

please help asap

Summarize how atmospheric pollution affects living organisms and the environment by completing the chart below:

Answers

Answer:

humans- exposes them to the ultra-violet rays of the sun causing cancer

animals- causes the pollution of gases found within the atmosphere

plants- polluted atmosphere contains poisonous gases that pour down as acid rains causing soil pollution and depletion on nutrients for plants

Environment- causes global warming

I need URGENT help with 16 through 18 pls!!!

Answers

Answer:

16. Directional Selection

17. Disruptive Selection

18. Stabilizing Selection

19. Natural Selection

20. Adaptation

Explanation:

In population genetics, directional selection/positive selection is a mode of natural selection in which an extreme phenotype is favored over other phenotypes.

Disruptive Selection would show phenotypes (individuals with groups of traits) of both extremes but have very few individuals in the middle.

Stabilizing Selection. Occurs when individuals at the extremes of the range of characteristic are selected against. This means that the "average" individuals are selected for.

Create a food chain with a producer and 3 consumers.

Answers

Answer: dandelion is consumed by bees, grasshoppers, and butterflies.

Answer:

primary consumers, secondary consumers, tertiary consumers.

Explanation:

Hope this helps

6. Why does the study of cell membranes lead to a better understanding of cell function?
a. All cell functions occur in the cell membrane.
b. All energy transfers occur at the cell membrane.
C. All cell membranes contain the information for making proteins.
d. All materials needed for cell functions must pass through the cell membrane.

Answers

Answer: d. All materials needed for cell functions must pass through the cell membrane. brainliest?

Explanation:

Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?


It increases the probability that moving water will promote gene flow from one population to another.

It increases the chance of the recombination of alleles, leading to genetic drift in the population.

It increases opportunities for offspring to compete for limited resources.

It increases the probability that some offspring will survive long enough to reproduce.

Answers

Answer:

increases opportunities for offspring to compete for limited resources.

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands

Answers

Answer:

false

Explanation:

A moon has less mass than a star and more mass than a planet it orbits.
•True
•False

Answers

It is false bc the mass of moon is less than 1/2 of earth, and earth is tinier than ANY STAR

Why is the success of a mutation dependent on environmental conditions?


PLEASE HELP QUICK!!!

Answers

the mutation can only be passed down in the environment is in the favor of the gene (natural selection)

ex. dark haired mice only surviving on dark lava rock while the white mice on the dark lava rock are getting killed.

Ms. B has 32 students assigned to her class. Her room only holds 28 students. The other 4 need to go to the officer for a schedule change-

Northern pike (a fish) feed on another fish, the yellow perch. An increase in the yellow perch population causes an increase in the pike population-

The BP oil spill in the Gulf of Mexico has harmed many aquatic organisms that live in the Gulf region-

A new strain of influenza breaks out in New York City-

The population of rabbits and a population of deer are both feeding off the same plants in the same area-

Hurricane Katrina forced thousands of people to leave New Orleans-

65 million years ago, a large asteroid collided with the Earth. As a result, large amounts of ash were ejected into Earth's atmosphere.

Answer choices: Density Dependent
Density Independent

Answers

Answer:

Density Dependent

Explanation:

i think hope it helps

Please help!! Any word is greatly appreciated :) thanks <3

Answers

Stem anatomy

WORD DEFINITION

Monocot Plant where Xylem and Phloem are arranged in bundled scatters

Node Location on the stem where leaves and buds are attached

Corm A bulb-shaped specialized stem that is made of solid stem and had no leaves

Stolon Specialized stem that is usually horizontal and above the soil

Specialized Stems Bulbs, Corm, Rhizomes, and Tubers

Apical Meristem Actively growing tip found inside a terminal or lateral bud

Terminal Bud End of stem or branch

Xylem Cells in the stem where they carry UP water and minerals

Lenticel A mark on the outside of the stem that allows gas to be exchanged

Lateral Bud Bud that is found on the side of the branch

Sapwood Part of woody stem that actively conducts water and dissolved minerals

Bulb Specialized stem made of short, flat stems and contains many fleshy leaves

Dicot Plant where it's Xylem and Phloem are arranged in a circle

Inter Node Area on the stem that lies between 2 leaves/buds

Leaf Scar Scar left when a leaf falls off

Bud Scale Scar Area in the stem that shows the location of last years bud

Phloem Tube-shaped cells that carry DOWN water and minerals

Tuber Specialized stem that's tip is swollen with stored food

Rhizome A specialized stem that is thick and runs horizontally under the soil

Bud Scale Small protective structure that can be seen on the outside of a bud

Vascular Cambium Area inside stem where new Xylem and Phloem are made

Explanation:

hope this here helps you

I attached the words in order down below

What are the characteristics of vitamins and minerals? (Select 3)
A.They are gained by the body by eating.
B.They are produced inside the body.
C.They help the body get energy.
D.They help your immune system fight disease.

Answers

Answer:

.

Explanation:

Answer: A, C, D. Hope this helps:

Explanation: Open Photo ;)

Question C. please... :) And NO FILES I WILL REPORT YOU!

Answers

The best way to describe it would be “the pattern of the graph is constantly changing as it goes thru series of increased and decrease through out the years”

what is the term for the process of cell division that results in the formation of gametes ?​

Answers

Answer:

meiosis

Explanation:

Other Questions
Which of the following quotes best summarizes how the details included in the section Some Examples of the Unexpected relate to one another?The things we learn from our national space program will produce benefits in ways entirely unrelated to missiles or interplanetary travel.The implications of this knowledge for satellites near Earth or for reentering spacecraft are obvious.Noble gases are the least active substances known to chemistry; if they can adhere, it is clear that no specific forces are needed for adhesiveness.From this knowledge has come the recent development of a diaphragm-damping fluid surface which has real potential not only for underwater high-speed bodies, but for any vehicle where fast-moving gases or fluids may cause drag.PLS HELP ILL ONLY GIVE BRAINLIEST TO THE CORRECT ANSWER The process to amend the Texas Constitution is slightly different than that of the U.S. Constitution because __________.a.people rarely bother to amend itb.it has been amended less than 30 timesc.amendments are submitted for voter approvald.voters amend it on a monthly basis solve the variable of x. 3^3^x= 1/243 Which detail should the writer add to her letter to explain why she wants tohave an internship with the American Power CompanyClick to view the business letter.A. I have always enjoyed science.B. I am interestedhow power is made.C. I can work two days after school.aD. I live close to the power plant. Procrastinators can develop feelings of __________.a.joy c.accomplishmentb.guiltd.pridePlease select the best answer from the choices providedABCD The health cods cover all issues except? State constitutions have provisions for all the following itemsEXCEPT:signing treaties with foreign countriesmaintaining schoolsraising taxesmaintaining law and order PLZZWhich is NOT a characteristic of a vertebrate?A-have bloodB-have exoskeletonC-have a nervous systemD-have backboneE-have protective skin covering how do I find the value of a in 30=5a The area of the triangle below is 33.62 square feet. What is the length of the base? Reread lines 6379. What evidence in the text suggests how Soto and his mother are feeling? What conclusion can you draw about the work they are doing? Read the excerpt from Catching Sun Rays.Governments and power companies know that solar power is good, so they are also building big solar power plants to keep up with demand. The best place to do that is the Mojave Desert, which covers parts of Arizona, California, Nevada, and Utah. The area gets twice as much sunlight as other parts of the United States. The Mojave is home to the largest solar power installation in the world.Based on the excerpt, which would a business person most likely include in an action plan for building a new solar power plant?A. finding out the best place to build a solar power plant.B. finding out the government's opinion of solar power.C. visiting the solar power installation in the Mojave Desert.D. visiting the Mojave Desert to see how much sunlight it gets. Steve will roll a number cube, numbered 1-6, twice. What is the probability of rolling a number greater than 4, thenrolling an odd number? why would high demand for beef around the world result in growth for the overall economy of Texas In 1941, how did Axis powers gain control of most of Europe? HHHHHHHHHHHHHHHHEEEEEEEEEEEEEEEEEEELLLLLLLLLLLLLLPnumber 2 is what is the area f the triangle 1) Find two positive consecutive integers that have a product of 30? PLEASE HELP!!! Explain how the periodic table tells you about the atomic structure of an element. (this is for my physical science class) Plz answer for goodluck Here it is please make sure its right its a test