If I paid $2.50 in taxes on a $45 item, what percentage rate of taxes did I pay?

Answers

Answer 1

Answer:

47.05

Step-by-step explanation:

12345678910^#3:##;$$;$%#;#<÷&÷#7#;;^#


Related Questions

Your travel guide contains a grid map of London, with each unit on the grid representing 0.5 kilometers. If Buckingham Palace is located at (−2,2) and St. Paul's Cathedral is located at (−2,−3), what is the direct distance (not walking distance, which would have to account for bridges and roadways) between the two landmarks in kilometers? Round your answer to two decimal places, if necessary.

Answers

Answer:

5.00

Step-by-step explanation:

The direct distance between Buckingham Palace and St. Paul's Cathedral is 5 kilometers.

Given the coordinates of Buckingham Palace as (-2, 2) and St. Paul's Cathedral as (-2, -3).

To find the direct distance between two points on a grid, we can use the distance formula, which is derived from the Pythagorean theorem. The distance formula in a 2-dimensional Cartesian plane is:

Distance = √((x₂ - x₁)² + (y₂ - y₁)²)

We can calculate the distance between them as follows:

x₁ = -2, y₁ = 2 (Coordinates of Buckingham Palace)

x₂ = -2, y₂ = -3 (Coordinates of St. Paul's Cathedral)

Distance = √((-2 - (-2))² + (-3 - 2)²)

= √(0² + (-5)²)

= √(0 + 25)

= √25

= 5 kilometers

So, the distance is 5 kilometers.

To learn more about the distance between two points;

https://brainly.com/question/24485622

#SPJ3

convert 35 pints to quarts​

Answers

Answer:

21.0166

Step-by-step explanation:

find the average rate of change of f(x)=5x^2-3 from 3 to 9

Answers

9514 1404 393

Answer:

  60

Step-by-step explanation:

The average rate of change on the interval is ...

  (f(9) -f(3))/(9 -3) = ((5·9² -3) -(5·3² -3))/(9 -3) = (402 -42)/6 = 60

How to convert 2 and 4/5 into an improper fraction

Answers

Answer:

Step-by-step explanation:

2 = 4/2 .  4/5 can not be a improper fraction

The students in Ms. Hill’s class are reading a 325-page book. There are about 90,000 words in the book.
Ms. Hill said the students should try for a reading rate of 200 words per minute for greatest comprehension.

Molly read 65 pages of the book in 80 minutes. What's Molly's reading rate?

Answers

Answer:

225

Step-by-step explanation:

(90000÷325)×65=18000

18000÷80=225

reading rate of 225 words per minutes

Tell whether each fraction, [tex]\frac{1}{n}[/tex], is written as a terminating
decimal or a repeating decimal for the given values
of n. Write T for terminating or R for repeating.

Answers

Answer:

ANSWER EQUALS NUMBER MULTIPLY BY TWO

PLEASE MARK ME BRAINLIST

Answer:

n = 2 ⇒ 1/n = 1/2 = 0.5 Tn = 3 ⇒ 1/n = 1/3 = 0.(3) Rn = 4 ⇒ 1/n = 1/4 = 0.25 Tn = 5 ⇒ 1/n = 1/5 = 0.2 Tn = 6 ⇒ 1/n = 1/6 = 0.1(6) Rn = 7 ⇒ 1/n = 1/7 = 0.(142857) Rn = 8 ⇒ 1/n = 1/8 = 0.125 Tn = 9 ⇒ 1/n = 1/9 = 0.(1) Tn = 10 ⇒ 1/n = 1/10 = 0.1 T

round 45,621 to the nearest 10

Answers

Answer:

45621.0

Step-by-step explanation:

Already rounded to the nearest tenth.

Answer

the answer to this question is 45620.

help me!
Read the excerpt from A Girl Named Zippy.

Not long ago my sister Melinda shocked me by saying she had always assumed that the book on Mooreland had yet to be written because no one sane would be interested in reading it.

Why is the author shocked by what Melinda says?

A.She thought her sister believed Mooreland was exciting.
B.She had heard that her sister wanted to write a memoir.
C.She did not understand what Melinda meant by “no one sane.”
D.She did not agree with her sister that Mooreland was a boring place.

Answers

Answer:

OPTION D

Step-by-step explanation: PLS MARK BRAINLIEST :D

D

is the answer to your question

I NEED HELP WITH THIS MATH PROBLEM!!!!!

WHICH EXPRESSION IS EQUIVALENT TO -8M-8+3M-6?
-11m-2 -5m-2
-5m-14 or -16m-3

Answers

Answer:

-5m-14

Step-by-step explanation:

-8M-8+3M-6

Add -8m and 3m, -8 + 3m = -5m

Next add negative 8 and 6, -6 + -8 = -14

Lastly, put it together,  -5m -14.

Hope that helps!

Using the formula below, find F, when f = 1000 and r = 8

Give your answer as a decimal number.

Answers

Answer: 15.625

Step-by-step explanation:

F = 1000/(8^2) = 1000/64 = 15.625

Answer:

F = 15.625

Step-by-step explanation:

This question may look quite tricky because of the square number, and fraction, but it is actually quite simple when you break it down.

To calculate this question we need to substitute the number 1000 (because we are told this is f) into where f is in our equation. Our new equation is F=1000/r^2.

Next, we need to substitute the number 8 (because we are told this is r) into where r is in our equation. Our new equation is F=1000/8^2.

At this stage, it is just a matter of putting this information directly into a calculator to find F. The answer we get is 125/8, and to get this is into decimal form, we just divide 8 by 125, and the answer is 15.625. This is our final answer.

I have attached a photograph of this calculation written down.

WILL GIVE BRAINLIEST, EXTRA POINTS, THANK YOU, AND STARS!!!

Answers

Answer:

162kph (i think, sorry if im wrong)

Which means 486km in 3 hours....

Step-by-step explanation:

Hope this helps!

Write a three digit number that gives same answer when rounded to the nearest ten and to the nearest hundred .explain

Answers

Answer:

Numbers can be rounded to the nearest ten, the nearest hundred, the nearest thousand, the nearest million, and so on. All the numbers to the right of the place you are rounding to become zeros. Rounded numbers are easier to remember and easier to use.

Find three consecutive multiples of 6 with a sum that is four times the least of the numbers.

Answers

The answer is 18, 24, 30. 18 + 24 + 30 = 72. 4 * 18 = 72.

Answer:

18 , 24, 30

Step-by-step explanation:

6x + (6x+6) + (6x+6+6) = 4*6x

18x + 18 = 24x

6x = 18

x = 3

3 multiples of 6: 18 , 24, 30

check: 18+24+30=72

           4*18 = 72

If 2.5 kg of potatoes cost $8.25 how much will u pay for 7 kg

Answers

Answer:

$23.10

Step-by-step explanation:

To get how much money you will have to pay for  7kg, you need to find out how much you have to pay for 1 kg. You will divided y divided by x = y.

8.25 (y) divided by 2.5 (x) = $3.30

You will pay $3.30 for 1 kg

So $3.30 x 7 = 23.10

You will pay $23.10 for 7 kg of potatoes.

** I hope this helps

complete the table and sketch the graph​

Answers

Answer:

where's the picture?

Step-by-step explanation:

can I have the pic po

can you pls slove the 12 question ​

Answers

So (77 5/7)/17
5/7 = 0.7142
77.7142/17
=4.5714 rupees per metre

W What word problem below can be solved by 7/8 divided by 1/4.? a. Shelly has 1/4 cup of lemonade. She pours 7/8 of lemonade into each glass. how many glasses can Shelly fill? b. Shelly has 7/8 cup of lemondae. She pours 1/4 cup of lemondade into each glass. hom many glasses can Shelly fill? C. Shelly has 7/8 cup of lemondae. She drinks 1/4 cup. How much lemondae does Shelly have left? d. Shelly has 7/8 cup of sugar in her lemondae. She adds another 1/4 cup after tasting it. How much sugar does she have in her lemondae now?hat word problem below can be solved by 7/8 divided by 1/4

Answers

Answer:

b.

Step-by-step explanation:

please help me solve this !
will mark brainliest !
(spammers reported)

Answers

Answer:

x=2

Step-by-step explanation:

A volunteer at the zoo is responsible for feeding the animals in 15 exhibits in the reptile house. This represents 20% of the total exhibits in the reptile house. How many exhibits are in the reptile house.

Answers

The 75 exhibits are in the reptile house.

we have given that,

A volunteer at the zoo is responsible for feeding the animals in 15 exhibits in the reptile house.

We have to determine how many exhibits are in the reptile house.

Therefore we have

if 15 exhibits = 20% of total exhibits,

What is the percentage?

A percentage is a number or ratio expressed as a fraction of 100.

then 15/20% = 75 total exhibits in the reptile house

We can check the answer,

75 x 20% = 15

Therefore the 75 exhibits are in the reptile house.

To learn more about the percentage of visits:

https://brainly.com/question/24304697

#SPJ1

is arccos equal tu sec ?​

Answers

yes it is equal to tu sec.

Find the sale price of the item. Round to two decimal places if necessary.

Original price: $87.00

Markdown: 33%

The sale price is $.

Answers

The sale price is $84.48

The area of the trapezium is 27.5 cm^2 work out the value of y

Answers

Follow up on the attachment, ask for clarification if you don't get it

y=8cm

Write the equation of the line in fully simplified slope Intercept form.

Answers

Answer:

y = -0.83x - 2

Step-by-step explanation:

Slope intercept form is y = mx+b.

M is the slope: In this case the slope (rise/run) is 10/12. However, the slope is decreasing is that would make it negative.

Now we have: y = -0.83x + b

B represents the y-intercept. The y-intercept here is -2. So our final equation is:

y = -0.83x - 2

Graph the number on the number line. Then use your number line to find the
absolute value.

Answers

Answer: 9

Step-by-step explanation:

The opposite of -9 is 9.

2x+2y=16x Solve for X Solve for Y ​

Answers

Answer:

x = [tex]\frac{y}{7}[/tex], y = 7x

Step-by-step explanation:

hope this helps

If sin x=0.96, find tan x

Answers

Step-by-step explanation:

sin x= P/H

sin x = 0.96 = 96/100 = 24/25.

Let the ratio of the sides be x.

B²=H²-P²

B²=(25x)²-(24x)²

B²=625x²-576x²

B²=49x²

B=√49x²

B= 7x.

cos x = 7x/25x = 7/25.

therefore, tan x = sin x / cos x = (24/25)/(7/25) = 24/25×25/7 = 24/7 .

hope this helps you.

Subtract
8/9 - 1/3

5/6
5/9
7/9
7/12

Answers

Answer:

3/9

Step-by-step explanation:

Common denominator: 27

24/27 - 9/27 = 15/27 = 3/9

You roll two fair dice. If they land with a sum of 7, you get a $10. If they land with a sum of 6 or 8, you get $5. Everything else earns $0. Which of the following would be the highest value you could set the price and the player would still win?
$8
$5
$2
$10​

Answers

Using the expected value, it is found that the highest value you could set the price is: $5.

-----------------------------

A game is fair, that is, the player would still win, if the expected value is 0.The expected value is the sum of each outcome multiplied by it's probability.A probability is the number of desired outcomes divided by the number of total outcomes.

For two fair dice, there are 36 total outcomes, as [tex]6^2 = 36[/tex].

The charge is x.

6 outcomes result in a sum of 7, which are (1,6), (2,5), (3,4), (4,3), (5,2) and (6,1), thus, [tex]\frac{6}{36}[/tex] probability of getting 10.

10 outcomes result in a sum of 6 or 8, which are (1,5), (2,4), (2,6), (3,3), (3,5), (4,2), (4,4), (5,1), (5,3) and (6,2), thus, [tex]\frac{8}{36}[/tex] probability of getting x.

36 - 14 = 22, thus [tex]\frac{22}{36}[/tex] probability of losing x.

Since we want the expected value to be 0:

[tex]\frac{6}{36}(10) + \frac{8}{36}(5) - \frac{22}{36}x = 0[/tex]

[tex]\frac{60 + 50 - 22x}{36} = 0[/tex]

[tex]22x = 110[/tex]

[tex]x = \frac{110}{22}[/tex]

[tex]x = 5[/tex]

The highest value you could set the price is: $5.

A similar problem is given at https://brainly.com/question/24905256

Mr. Barker saved his money for 47 years and had $3,700,028 in the bank. He used his money to go on an adventure and spent $967,300. How much did he have left after his adventure?

Answers

Answer:

The answer is $2,732,728

Step-by-step explanation:

You start subtracting by aligning the numbers by place value. You subtract and get 28 then you have to subtract 0 - 3 which you can’t do and next to it are 2 other 0’s the only number you can carry is 7. You cross out the 7 and put a 6 in its place. The zero next to it becomes a 9. The one next to it also becomes a 9. Then the one on top of the three becomes a 10. You then do 10 - 3. Which equals 7. Then you do 9 - 7 = 2. 9 - 6= 3. You can’t do 6 - 9. so you cross out the 3 make it a 2 and turn the 6 into a 16. 16 - 9 =7. 2 - 0 =2 so then you get. $2,732,728.

I’m struggling someone please help me!!

Answers

Answer:

A one real root

Step-by-step explanation:

if not I'm sorry if I get it wrong

Other Questions
How do you write 20% as a decimal? HELPPP!!! Using the following data, which is the correct rate law of the sample reaction?A5B + 6C 3D + 3EExperiment (A) (M) [B] (M) [C](M) Initial Rate (M/s)10.35 0.35 0,35 8.0 x 10420.700.350.353.2 x 10-30.700.700.356,4 x 10-840.700.350.703.2 x 10-3A.) K[A]^2 [B]^1 [C]^1B.) K[A]4 [B]^2 [C]^1C.) K(A)^2 [B]^1 [C]^OD.) k[A]^1 (B)^2 [C]^O if it costs 21.6$ for 12 brownies, how much would it cost for 1 Isaac paid $81 for a new surfboard. The amount paid was 60% of his total savings. How much money did he have in his savings before buying the surfboard? help btw it needs to be rounded to the hundredths BRAINLIEST IF CORRECT which evidence best supports the following topic sentence? Another reason the school should open an after school computer lab is that the lab would offer safeguards for internet use that students do not get out of school. Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) El permetro de una circunferencia es de 40 cm, y tiene un ngulo de 130. Calcula el rea del sector de dicha circunferencia. Read each sentence below and identify the adjectives with the nouns they describe. Nancy was angry when Fred picked her up late A rectangle is 12 cm long and 8 cm broad.The length and breadth of the rectangle areboth increased by the same amount, dcm.If the area of the rectangle is now 221 cm,find the value of d. with a digram HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10