I will mark Brainliest for frist answer

I Will Mark Brainliest For Frist Answer

Answers

Answer 1

Answer:C, to contain the information

Explanation:


Related Questions

What is the purpose of RNA?

To hate on DNA

To act as a messenger from DNA to the rest of the cell

No file uploads!!!!!!

Answers

Answer:

to act as a messenger from DNA to the rest of the cell.

Explanation:

I feel like this one was pretty self explanatory lmfa.o

Please help, any unnecessary answers will be reported. Thanks :)

Answers

it's c

Explanation:

because there's different types of cold and illnesses so there can be different symptoms each time

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

Plants produce oxygen which animals use. Animals produce carbon dioxide which plants use. Predict the most likely outcome if airborne pollution blocked the sun’s rays so significantly that the percentage of living plants was decreased by 95%.

A. Plants would quickly evolve to consume a mixture of oxygen and carbon dioxide

B. Animals would quickly evolve to begin using carbon dioxide

C. The atmosphere would fill with carbon dioxide, and animals would begin to die.

D. The atmosphere would fill with oxygen, and animals would begin to die.

Answers

Answer:

C

Explanation:

A can’t happen because there are barely any plants

B can’t happen because Animals need Oxygen to breathe

D won’t happen due to lack of plants

Why does a mountain create a rain shadow on the other side of a mountain?

Answers

Answer:

I hope this will help u

Explanation:

A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.

Answers

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

Cytotoxic T cells protect the body by _____________.

A. secreting toxic substances that destroy pathogens

B. phagocytizing invaders

C. activating the complement system

D. making antibodies that float free in the body fluids

Answers

C.) Hope it helps :)

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

Which list describes the organization within multicellular organisms from least complex to most complex?


A,proteins, organelles, cells, organisms
B,proteins, cells, organelles, organisms
C,cells, organelles, proteins, organisms
D,organelles, cells, proteins, organisms
d

Answers

Answer: A (proteins, organelles, cells, organisms)

Cells, organelles, proteins, organisms describes the organization within multicellular organisms from least complex to most complex. The correct option is C.

What are multicellular organisms?

Multicellular organisms include a mixture of more than one cell, with differentiating groups of cells performing specialized functions.

Early stages of development, cells in humans distinguish towards becoming nerve cells, skin cells, muscle cells, blood cells, as well as other types of cells.

All animals, land plants, and most fungi are multicellular, as are numerous algae, with the exception of slime molds and social amoebae such as the genus Dictyostelium, which are partially unicellular and partially multicellular.

Cells, organelles, proteins, and organisms describe the organization of multicellular organisms in descending order of complexity.

Thus, the correct option is C.

For more details regarding multicellular organisms, visit:

https://brainly.com/question/24381583

#SPJ2

WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)

Answers

Answer:

Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)

Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.

Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.

what did humans evolve from I am creating a a evolution chain I know this can be considered a unintelligent question I am just not positive on what we evolved from

Answers

Answer: Human evolution, the process by which human beings developed on Earth from now-extinct primates. Viewed biologically, we humans are Hono Sapines, a culture-bearing upright-walking species that lives on the ground and very likely first evolved in Africa about 315,000 years ago.

Human evolution is not linear manner it is a web, in the process of evolution primates lead to the emergence of homo-sapiens, which is distinct from the hominid family.

How did humans evolve?

Human evolution is observed in a web manner not linear in evolutionary history primates lead to the homo-sapiens which is distinct from another family of hominids.

The hominid family includes great apes that diverged from the gibbons 15-20 million years ago. Evolution involves some studies, genetic studies, and h behavioral studies.

Anatomically it is observed in Africa 300000 years ago humans appeared, these studies were observed anatomically as the origin of humans.

Therefore human evolution is observed in a web manner not linear.

Learn more about human evolution, here:  

https://brainly.com/question/24276894

#SPJ2

helpppppppppppppppppp

Answers

I’ve tired I’m sorry I don’t know

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!

What do agriculture and urbanization have in common?

Answers

Answer:

Agriculture and urbanization both have the goal of expanding human value of living.

Explanation:

Answer:

Explanation:

Basically both of them benefit each other .

Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands.  It can also bring major challenges for urban and rural food security.

Hope this helped !

Mary pushes her cart across the floor with a force of 150N for a distance of 10m. What is the work done on the cart?

Answers

Answer:

1500Joules

Explanation:

Work done, denoted by W, can be calculated using the formula:

Work done (W) = force (F) × distance covered (d)

According to the information in this question, Mary pushes her cart across the floor with a force (F) of 150N for a distance (d) of 10m.

Hence, work done (W) by the cart is:

W = 150N × 10m

W = 1500 Newton.metre (N.m) or Joules (J).

genes for traits that help an organism be more successful reproductively can be expected to ...

A - cause it to evolve into species

B - eventually be eliminated by natural selection

C - become more common in the future

D- cause the extinction of the species

Answers

C - become more common in the future

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

PLEASE ANSWER THIS DUE BY 3:00 PM PLEASE
THIS IS NOT MULTIPLE CHOICE AND I DID NOT MEAN TO SELECT D.

( I put a better view of the graph)

Answers

Answer:

option C suits the best

Explanation:

The answers and why they are correct or incorrect:

A:

Incorrect because it cannot be answered with the graph and does not apply.

B:

Incorrect since the loudest sound ever recorded is not on the graph.

C:

Correct because the graph shows the difference Between normal conversation vs whispering.

D:

Incorrect, because like the first one it cannot be answered with this graph and makes no sense.

I HOPE I HELPED!!! HAVE AN AMAZING DAY/NIGHT!!! PLEASE MARK ME BRAINLIEST IF I HELPED YOU!!

In the presence of oxygen, _____ molecules of ATP can be formed during cellular respiration.

A. 36 to 38
B. 19 to 24
C. 2 to 4
D. 63 to 68
E. 38 to 42

Answers

the answer is A. 36 to 38. hope i helped!!

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

What were the old women doing?
In Percy jackosn

Answers

Answer:

If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.

Explanation:

in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.

In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.

Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.

Answers

Answer:

The phenotypic ratio is 9:3:3:1

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

Explanation:

We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.

Let us assume that round is the dominant trait, codified by a diallelic gene, so

R is the dominant alleler is the recessive allele

Let us also assume that axial is the dominant trait, so

A is the dominant allelea is the recessive allele    

Cross:

Parentals)   RrAa  x  RrAa

Gametes)  RA, Ra, rA, ra

                 RA, Ra, rA, ra

Punnett Square)     RA           Ra          rA          ra

                   RA      RRAA    RRAa      RrAA     RrAa

                   Ra      RRAa     RRaa       RrAa     Rraa

                   rA       RrAA     RrAa       rrAA      rrAa

                   ra       RrAa      Rraa        rrAa       rraa

F1) Among the progeny, we expect to observe the following phenotypic ratio:

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

Can someone name and explain each lymph organ?

Answers

Answer:

The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.

Answer:

please follow me

Explanation:

yr60zpzyoy9yit*fiif7rrr

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

For predation to occur, there must be a predator species and a prey species. Define predator and prey and give an example of each.

Answers

A predator is a carnivore animal that preys on prey animal. Prey animals are usually small herbivores or just smaller animals. Examples, lion and gazelle, bear and salmon, wolf and deer.

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)
Other Questions
NEED HELP ASAP (will give 10 points) if you actually know plz give an explanation to the answer so i know you aren't just answering for points, please help this is due before 12:00 The Ferris wheel at a state fair has a radius of 60 feet,rotates at a constant speed, and completes 1 rotation in4 minutes. How many degrees does the Ferris wheelrotate in 30 seconds?A. 20B. 24C. 30D. 45E. 48 where was the council of clearmont delivered? An environmental factor that contributes to mental illness is __________.A.intelligenceB.povertyC.high self-esteemD.a supportive family Which quadrilaterals always have two pairs of congruent angles? A 6 ft. Observer cast a 4 ft. Shadow. At the same time the chimney on the Ohio Power Co. Cast an 804 ft. Shadow. How tall is the chimney? 2 PLEASE HELP! WILL GIVE BRAINLIEST! Is 2.36 a rational number? Please solve with steps 10. Why do you believe the couple never discuss why thepeople have changed their treatment of Sile? I love punk/rock music what songs should I listen too....Give me options. 4. In the following reaction: 2NaN3 decomposes to form 2Na + 3N2. If 500 grams of NaN3 decomposes to form 320 grams of Na, how much Na is produced? 180 grams 320 grams 500 grams Hometown Donuts recently sold 19 donuts, of which 6 were cream-filled donuts. What is the experimental probability that the next donut sold will be a cream-filled donut? an electric bulb is marked 40volts ,230w another bulb is marked 40w,110va.calculate the ratio of their resistanceb.the ratio of their energyc.find the charge on each bulbd.which of the two bulbs can hold enough . 4.What would be the purchase price for a $5,000, 91-day T-bill paying 3%interest?a. $4,925.00b. $4,962.50C. $5,000.00d. $5,037.50 I need help fast please answer! An 8.20 kg object is pulled along a horizontal surface by a force of 22.0 N. If its acceleration is 1.1 m/s2, what is the coefficient of friction between the two surfaces? 2). The scale factor of two regular octagons is 52. Find the ratio of theirperimeters and the ratio of their areas, * A 50.0 mL sample of an aqueous H2SO4 solution is titrated with a 0.375 M NaOH solution. The equivalence point is reached with 62.5 mL of the base. The concentration of H2SO4 is ________ M. A 50.0 mL sample of an aqueous H2SO4 solution is titrated with a 0.375 M NaOH solution. The equivalence point is reached with 62.5 mL of the base. The concentration of H2SO4 is ________ M. 0.150 0.234 0.300 0.469 0.938