i need help with arabic homework​

I Need Help With Arabic Homework

Answers

Answer 1
اول إثنين جوابه. ( أمر)
Answer 2
١) "قم للصلاه" الجواب (اسلوب الأمر) لانه يأمره بالصلاه.

٢) "لا تكتب على الجدران" الجواب (اسلوب نهي) لأنه يطلب منه ان يكف عن الكتابه على الجدران بقول 'لا'.

٣) "كيف حالك يا عمي" الجواب (اسلوب استفهام) لانه يسأل عمه عن حاله.

٤) "ما تأخرت عن المدرسه" الجواب (اسلوب نفي) لأنه ينفي بأنه لم يتأخر عن المدرسه.

٥) "إن الله يحب عباده المخلصين" الجواب (اسلوب خبري) لانه يخبرنا بأن الله يحب عباده المخلصين.

٦) "هل تحترم اخوتك؟" الجواب (اسلوب استفهام) لانه يقوم بطرح سؤال ما.

٧) "لا اصاحب الاشرار" الجواب (اسلوب نهي) لانه يقوم بنهي عن انه يصاحب الاشرار بقول 'لا'.

٨) "ما اجمل السماء!" الجواب (اسلوب تعجب) لانه متعجب بجمال السماء.

٩) "يا اخي حافظ على وطنك" الجواب (اسلوب نداء) مستخدماً 'يا' بمناداة اخيه.

١٠) "هل جزاء الاحسان الا الاحسان؟" الجواب (اسلوب استفهام) يقوم بسأل سؤال.

١١) "أإله مع الله؟" الجواب (اسلوب استفهام)

١٢) "أنت يجيب المضطر اذا دعاه و يكشف السوء؟" الجواب (اسلوب استفهام) لانه يسأل '؟'

١٣) "و اكتب لنا في هذه الدنيا حسنة و في الآخره إنا هدانا اليك" الجواب (اسلوب الدعاء في صيغه امر)

Related Questions

Which of the following best describes Douglass' life after escaping slavery?

Answers

Answer: He worked different labor jobs at first, but then became an influential voice on the evils of slavery.

Explanation:

Case study: Natalie du Toit Natalie du Toit believes that setting goals helped her recover and put her on path to severance has won her gold medals in competitions for disabled and able-bodies swimmers. Natalie swam in the freestyle final at the commonwealth Games in 2002 and won the award for the Most Outstanding Athlete, in 2006 she broke two records in the Paralympic World Cup. She came 16 in the 10km open water swim at the 2008 summer Olympics in Beijing. At 17 years of age, Natalie lost her leg in a road accident. At the time she was training to qualify for the 2004 Athens Olympics. Due to her persistence, she was swimming again within four months of the accident. She changed her race to the longer distance of 800m and 1 500m, to make up for the loss of speed due to having only one leg. Natalie believes you should "swim your own race and not someone else's" She applies this advice to all aspects of life and says that the key to success is to stay true to yourself and your dreams. She is convinced that individual challenges come your way to "dare you to stick to your goals and your values". Natalie gives motivational talks to business people, learners and prisoners. She is also enthusiastic about getting involved in educating children on water safety to prevent drowning, particularly in underprivileged communities.

1.3.show how she persevered and persisted in reaction to the obstacle​

Answers

Natalie du Toit persevered and persisted despite the obstacles as she decided to stick to her goals and adapt to achieve these.

What is persistence?

Persistence can be described as a quality that involves continuing despite obstacles or changes. This quality applies to Natalie du Toit, who did not let obstacles and changes such as losing her leg in an accident stop her from becoming an athlete. Instead, she was aware of these obstacles and looked for alternatives to overcome them. This shows she did not give up and continued working toward her goals.

Learn more about persistence in https://brainly.com/question/30762813

#SPJ1

Написать письмо от имени Кости, в котором он рассказывает о машинисте Мальцеве.
Задание. Написать письмо от имени Кости, в котором он рассказывает о машинисте Мальцеве. В письме необходимо выразить отношения Кости к Мальцеву, к его работе, объяснить, почему же он решает ему помочь. Употребление цитат (1-2) обязательно. Используйте риторические вопросы, обращения. Объём работы 1-1,5 стр.


Начало. (можно изменить)

Здравствуй, дорогой друг. Ты, конечно, знаешь, что я уже больше года работаю в Толубеевском депо. И вот сбылась моя мечта: я стал паровозным машинистом. Но сегодня не об этом.

Я хочу рассказать тебе …

Answers

Answer: Your welcome!

Explanation:

о моем друге и коллеге по работе Мальцеве. Я знаю его уже много лет и по праву могу сказать, что он – самый надежный и ответственный машинист. Он относится к своей работе очень серьезно и внимательно. Он всегда готов помочь и рассказать о новых технологиях в области железнодорожного транспорта.

А как же по-настоящему выразить мои чувства к Мальцеву? Как не забыть о том, что он умеет поставить на колени любую проблему и правильно ее решить? «А откуда берется у людей такая сила?» – спрашиваю я себя. Но я знаю ответ: эта сила берется из любви и желания помочь другому человеку. И Мальцев – идеальный пример такого человека.

Поэтому я решил помочь Мальцеву, поскольку для меня он – ценное знание, которое нужно сохранить. Как говорится в пословице: «Друзья нужны для того, чтобы делиться с ними своими сильными и слабыми сторонами». Именно поэтому я решил помочь Мальцеву.

С уважением,

Костя

Which quotation from the excerpt best supports Gandhi’s claim that many countries are going through economic difficulties?

“Today, we are passing through specially dark days.”
“But these are not dark days for India alone.”
“Only a few countries, which have very small populations, have no unemployment.”
“They have shortages even of food.”

Answers

Answer:

Second line

Explanation:

But these are not dark days for India alone shoes that other nations are included

PO PRZECZYTANIU
1. Jakich argumentów używa Głupota, by dowieść, że ludzie, im są głupsi, tym czują się
szczęśliwsi?
2. Przedstaw charakterystykę szczęścia według Głupoty i sformułuj własną definicję.
przeciwną do wyrażonej w tekście Erazma z Rotterdamu.
3. Wskaż w tekście sformułowania, które - Twoim zdaniem - najdobitniej kompromi-
tują przemawiającą Głupotę.
* 4. Przygotuj mowę zatytułowaną Pochwała mądrości.

Answers

Answer:Nie wierzył w prawdziwe szczęście. Jego zdaniem najlepsze, co człowiek może osiągnąć, to zmniejszyć nieszczęście. Pod koniec swojej kariery napisał książkę o tym, jak żyć najbardziej znośnie. Jest to praktyczny przewodnik oparty na jego osobistych doświadczeniach i zilustrowany cytatami innych myślicieli podpisujących się pod jego poglądami. W niniejszym artykule podsumowujemy jego zalecenia i porównujemy je z warunkami szczęścia obserwowanymi we współczesnych badaniach empirycznych. Mam nadzieję, że pomogłem

What was the first usage of the Roman Forum?


Burial ground

Museum

Shrine to Jupiter

Altar to the Titans

Answers

Answer:

The Roman Forum was initially a burial ground for the early inhabitants of Rome.

Why does douglass go to his master
who had rented him to mr corvey?

Answers

Answer:

Covey came by, kicked him, and gave him a beating. Although Douglass was bleeding profusely, he managed to escape and walked seven miles to St. Michael's.

Explanation:

Douglass arrives at Covey's farm on January 1, 1833 , and he is forced to work in the fields for the first time. His first task is to guide a team of unbroken oxen.

Why is the Basque language not increasing anymore and is still a dying/endangered language?

Answers

Answer:

B cease hardly anyone speak the language

Explanation:

Is there a way for a language to die even if its widely spoken? If yes, explain how.

Answers

no but some languages die when their new generation begin to lose proficiency in their traditional languages and don’t use it.

Oque significa formigação e tesourar/entesourar

Answers

Answer: caracterizada por dificuldade persistente em descartar ou se desfazer de pertences devido à necessidade percebida de salvá-los -condição progressiva e crônica -começa cedo na vida, mas a maioria dos sintomas compulsivos é relatada na meia-idade -se não for tratada, sua gravidade aumenta com a idade

Explanation: espero ter ajudado :D

i need help quick with arabic homework​

Answers

شكرًا على الطلب! هنا هي الإجابات:

نشاط 1:

   حفظ أحمد النشيد، ثم قرأ قصة.

   قل خيرًا أو اصمت.

   توضأ المسلم، فصلى بخشوع.

   ذهب محمد مع أبيه وأخيه إلى سوق السمك.

What is the Arabic language about?

نشاط 2:

   أكل الولد تفاخا، ثم موزا. (حرف عطف يفيد الترتيب والتراخي)

   أكل الولد تفاخا، وبعد ذلك موزا. (حرف عطف يفيد الترتيب والتعقيب)

   أكل الولد تفاخا، وشارك موزا. (حرف عطف يفيد الجمع والمشاركة)

   كلوا تفاحًا، أو موزًا. (حرف عطف يفيد التخيير)

نشاط 3:

   الواو تفيد الترتيب والتعقيب.

   أو تفيد التخيير.

   ثم تفيد التتابع.

   الفاء تفيد الزمرام.

نشاط 4:

   أحضرت سلامة لأم خلفان الشيخ، وكانت سعيدة به.

   سكن سعيد في الشارقة، وعمل في دبي.

   أذهب إلى الحديقة ماشيًا، أو راكبًا بالسيارة، حسبما تفضل.

   أدخل المسجد برجلي اليمنى، ثم اتبعها اليسرى.

   توقيع ولي الأمر: المعلمة.

Learn more about Arabic from

https://brainly.com/question/28183940

#SPJ1

See transcribed text below

نشاط داعم( مهارات نحوية ) - تركيب العطف

(نشاط رقم 1 ) ضع خطا تحت حرف العطف في الجمل الآتية ثم اكتبه في الفراغ :

- حفظ أحمد النشيد ثم قرأ قصة

ـ قل خيرا أو اصمت

توضا المسلم فصلی بخشوع .

- ذهب محمد مع أبيه وأخيه إلى سوق السمك

(نشاط رقم 2 ) اكمل الفراغ في الجمل الآتية بما هو مطلوب بين القوسين :

ـ أكل الولد تفاخا - ---- موزا ( حرف عطف يفيد الترتيب والتراخي

ـ أكل الولد تفاخا ------------- موزا . ( حرف عطف يفيد الترتيب والتعقيب )

ـ أكل الولد تفاخا . موزا . ( حرف عطف يفيد الجمع والمشاركة )

- كلوا تفاحا ------- - موزا .

( حرف عطف يفيد التخيير)

********

نشاط 3 صل بين أحرف العطف في القائمة " أ " وما يناسبها في القائمة " ب " :

(أ)

الواو تفيد

أو تفيد

ثم تفيد

الفاء تفيد

نشاط 4 املأ الفراغ في الجمل الآتية بحرف عطف مناسب :

• أحضرت سلامة لأم خلفان الشيخ .

• سكن سعيد في الشارقة

• أذهب إلى الحديقة ماشياً ....... راكبا بالسيارة .

• أدخل المسجد برجلي اليمني .

أتبعها اليسرى

: توقيع ولي الأمر

******

(ب)

التخيير ( الاختيار بين شيئين )

مطلق الجمع والمشاركة .

الترتيب والتعقيب . ( مباشرة )

الترتيب والتراخي .

الزمرام .

انتقل إلى أبو ظبي بعد عدة سنوات .

******

: المعلمة

20

تلميذي العزيز

ارني نشاطك في

حل هذه التمارين

Is Filipino language slowly dying out? If yes explain why

Answers

Answer:

It don't think it is dying but it will probably decrease in usage.

Firstly, Philippines is a very Americanized country. English fluency is almost a prerequisite for all Filipinos. Which is good, being bilingual is important in a very interconnected world. Especially with English, the worlds most widely spoken language.

But what is also happening is Filipinos are also rejecting their culture to fit in.This is more prevalent in OFW who tend to teach their children English but not their home language of Bisaya or Tagalog. This is because in some countries, being identified as a Filipino is not the best. For example in Hong Kong where I come, everyone thinks Filipinos MUST be maids, sex workers, not realizing a country cannot sustain itself like that. There is a bad stigma attached to being Filipino and thus, most parents do not teach their children the language.

Also, Philippines is very tribal in the sense that it had many tribes in the past. And those tribes had their own languages. Although Tagalog will have a longer life span as it is recognised as the national language, other languages may die out. For example, Zamboungan or Ilocanos. Smaller languages that are used by less people will die out if people aren't teaching

Getting rid of out-of-touch bureaucrats

Answers

Explanation:

I may act cool on social media

But In real life , I literally have zero friends who can proudly say that I'm their only friend and they can chill with only me . I always feel uninvited, unwanted, avoided, not liked or a very ugly friend. Nobody literally can proudly say I'm their bestfriend, they act like we are friends but for some days only.To whom I know since beginning always ignores me , I never get same energy back .I always got surrounded by only toxic people who will choose anyone over me.Not complaining though just sharing my personal feeling.

Explain how each of the following skills might resolve conflict and contribute to harmonious relationships during your grade 12 academic year. Collaborating

Answers

Collaboration can resolve conflicts & build relationships in Grade 12. Working together towards common goals & compromising leads to harmony.

What is the justification for the above response?

Collaborating is a skill that can greatly contribute to resolving conflicts and building harmonious relationships during the academic year. Collaborating involves working together to find a solution that satisfies everyone's needs and interests.

When conflicts arise, collaborating can help all parties to identify the root cause of the issue, generate multiple solutions, and evaluate the pros and cons of each option.

By collaborating, individuals can build trust, respect, and understanding of one another. Collaborating can also create a sense of ownership and shared responsibility, which can lead to a more positive and productive learning environment.

Thus, by using the skill of collaborating, individuals can work towards resolving conflicts and building strong, positive relationships with their peers.

Learn more about Collaborating at:

https://brainly.com/question/30235523

#SPJ1

.................................

Answers

Excuse me what is the question

What is one of Gandhi’s claims in the excerpt?

Most people do not choose the right job.
Most people are happier doing basic jobs.
The smallest jobs are the most important jobs.
The smallest jobs are essential to the country.

Answers

Answer:

The smallest jobs are essential to the country

Explanation:

Read the excerpt from "What Educated Women Can Do” by Indira Gandhi. Some people think that only by taking up very high jobs, you are doing something important or you are doing national service. But we all know that the most complex machinery will be ineffective if one small screw is not working as it should and that screw is just as important as any big part. It is the same in national life. There is no job that is too small; there is no person who is too small. Everybody has something to do. And if he or she does it well, then the country will run well. What is one of Gandhi’s claims in the excerpt? Most people do not choose the right job. Most people are happier doing basic jobs. The smallest jobs are the most important jobs. The smallest jobs are essential to the country.

Answers

Answer: An ancient Sanskrit saying says, woman is the home and the home is the basis of society. It is as we build our homes that we can build our country. If the home is inadequate -- either inadequate in material goods and necessities or inadequate in the sort of friendly, loving atmosphere that every child needs to grow and develop -- then that country cannot have harm ony and no country which does not have harmony can grow in any direction at all.

That is why women's education is almost more important than the education of boys and men. We -- and by "we" I do not mean only we in India but all the world -- have neglected women education. It is fairly recent. Of course, not to you but when I was a child, the story of early days of women's education in England, for instance, was very current. Everybody remembered what had happened in the early days.Explanation:

Answer:

What is one of Gandhi’s claims in the excerpt?

I think it's this one; The smallest jobs are essential to the country.

Explanation:

You're welcome.

Hey anyone please help me I forgot almost everything on this. I will give 20 points

Answers

The answers to the above Latin prompt is given as follows:

CanesIanuaeMercatoresFratribusBestiaeAgricolamPuellaeDiscosThermisGladiatores

What is the rationale for the above response?

The above response lists the correct Latin forms of the given words, according to their grammatical cases and numbers.

For example, "Canes" is the nominative plural form of "canis," meaning "dogs," while "Ianuae" is the dative singular form of "ianua," meaning "door." The correct forms of Latin words are important for accurate communication and understanding in the study of Latin language and literature.

Learn more about Latin  at:

https://brainly.com/question/13118792

#SPJ1

Other Questions
Eight triangles are drawn within a square to create the shaded region in the figure. InstructionsRead the question carefully and select the best answer.Based on the following passage, which of the following best explains why factions might develop?The latent causes of faction are thus sown in the nature of man; and we see them everywhere brought into different degrees of activity,according to the different circumstances of civil society. A zeal for different opinions concerning religion, concerning government, and many otherpoints, as well of speculation as of practice; an attachment to different leaders ambitiously contending for pre-eminence and power; or to personsof other descriptions whose fortunes have been interesting to the human passions, have, in turn, divided mankind into parties, inflamed them withmutual animosity, and rendered them much more disposed to vex and oppress each other than to co-operate for their common good.DA It is natural for individuals to have different opinions. How could the North's factories be considered an advantage? (I point)O The factories could sell surplus goods to Europe for money.O The factories could be converted to making supplies for the army.OThe factories could get cotton from the West instead.OThe factories could use newly freed African Americans as a cheap source of labor. In the 2020 NFL season, Drew Brees completed 73.5% of his attempted passes, and Patrick Mahomes completed 68.8% of his attempted passes. Based on those statistics, which of the following statements is true? A. Drew Brees must have attempted more passes B.Patrick Mahomes must have completed more passes C.Either quarterback could have completed more passes D.. Drew Brees must have completed more passes Faisal deposits a single sum of money into an investment opportunity that pays 1% compounded annually. How much must he deposit in order to withdraw $3,024/year for 5 years, with the first withdrawal occurring 2 year after deposit? Qustion#3 [4+6](a) Impact of culture is pervasive.- Explain the statement.(b) What are some particularly troublesome problems caused bylanguage in foreign marketing? Discuss. Find the constant of variation k for the direct variation.f(x)0-1-2-3.5x02047 Joni says that a rectangular prism has two bases. How many possible pairs of bases does a rectangular prism really have? Explain In 2017, a company was planning to launch a new project in Canada The cost of the production equipment is $1420,000 The equipment falls in CCA class 8 with a 20% rate for income tax purposes. A working capital investment of $125,000 will be required at the beginning of the project, which will be recoverable at the end the project's life in six years. The sales forecast is based on the sale of 85,000 widgets per year. The unit selling price is $20 per widget and the unit variable cost is $6 Annual fixed cost totals $650,000. At the end of the lifetime of the project the salvage value of the equipment is expected to be $180,000. There will be ascets remaining in that CCA asset class so you can use the PV of CCA tax shield calculation The company's income tacrate is 30% and its discount rate is 12% What is the NPV of the project? Would you recommend approval? Calculate and input the dollar amounts for each of the six steps (nearest dollar without dollar sign (5) or comma 15000) Negative cash How is - 15000) What is the correct value for Step #1 _____What is the correct value for Step #2 _____ What is the correct value for Step #3 _____What is the correct value for Step #4? _____What is the correct value for Step NS? ____What is the correct value for Step 6 ____What is the NPV for the project _____ Based on your answers to the first six questions, what is the appropriate course of action to follow? ___ Isn't it supposed to be one black triangle and one black square? Why is the Basque language not increasing anymore and is still a dying/endangered language? Help needed with the question please! Information sent to a function is a?Group of answer choicessumloop control variablecount variableparameter If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG ______ is the usual starting point for budgeting.Select one:a. The production budgetb. The estimated net incomec. The revenues budgetd. The cash budget Which of the following are examples of biodegradable wastes? a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peelsb. Plastic and rubber d. Glass and the cow-dung cakes In Exercises \( 1-8, W \) is a subset of \( R^{2} \) consisting of vectors of the form \[ \mathbf{x}=\left[\begin{array}{l} x_{1} \\ x_{2} \end{array}\right] \] In each case determine whether \( W \) Please I need help. I dont understand this. Two resistors of resistances 3 and 6 are connected in parallel across a battery having voltage of 12V. Determine (a) the total circuit resistance and (b) the current flowing in the 3 resistor determine which of the following features they have in common.