(Anthropology)Demonstrate and understanding of how natural selection works. (200-250 words)
Natural selection is the process by which organisms that are better adapted to their environment tend to survive and reproduce more than those that are less well adapted. This leads to the gradual evolution of populations and species over time.
There are several key components to natural selection. The first is variation, which refers to the fact that individuals within a population have different traits, such as size, color, or behavior. These traits are determined by an individual's genes, which are passed down from their parents.
The second component is competition, which arises because resources, such as food, water, and shelter, are often limited. This means that individuals must compete with one another for these resources in order to survive.
The third component is differential survival and reproduction, which refers to the fact that some individuals are more successful at surviving and reproducing than others. This is often due to the fact that they have traits that are better adapted to their environment.
Over time, natural selection can lead to the evolution of populations and species. If a particular trait is beneficial in a given environment, individuals with that trait will be more likely to survive and reproduce, passing the trait on to their offspring.
In conclusion, natural selection is a key mechanism of evolution that is driven by variation, competition, and differential survival and reproduction. It leads to the gradual evolution of populations and species over time, as beneficial traits become more common and less beneficial traits become less common.
See more about natural selection at https://brainly.com/question/23929271.
#SPJ11
1. All organisms make ATP.
A) Yes
B) No, only animals.
C) No, only multicelled organisms.
2. In a cell, what is necessary to make ATP? (choose all
that apply)
A) glucose
B) oxygen
C) vitamin D
D) wate
1. All organisms make ATP. A) Yes,
2. The necessary components to make ATP in a cell are A) glucose and B) oxygen
All organisms make ATP. ATP is the universal energy currency for all living organisms, and it is produced through cellular respiration or photosynthesis. The ATP will be used by organisms to carry out various activities.
Glucose is the primary source of energy for cellular respiration, and oxygen is required for the process of oxidative phosphorylation, which generates the majority of ATP in the cell. Vitamin D and water are not directly involved in the production of ATP.
Learn more about oxidative phosphorylation at:
https://brainly.com/question/29104155
#SPJ11
Using your knowledge of the Goldman Equation Please Calculate the Resting Membrane Potential of a Neuron in a Mammal. In this case the cell is 10 times more permeable to Na+ than K+ As a reminder the Goldman Equation is:
????m=61∗????o????10(PK[K+]o+P????????[????????+]oPK[K+]????+P????????[????????+]????)
V m = 61 ∗ l o g 10 ( P K [ K + ] o + P N a [ N a + ] o P K [ K + ] i + P N a [ N a + ] i )
????????+ concentration (mM) out 150
K+ concentration (mM) out 3
????????+ concentration (mM) in 10
K+ concentration (mM) in 145
Please provide an answer to the hundrenths decimal place (example. -21.32), and use of the appropriate sign (+ or -) is paramount. Units will not be counted, however you should know that the units are mV (millivolts).
The resting membrane potential of a neuron in a mammal can be calculated using the Goldman Equation. In this case, the cell is 10 times more permeable to Na+ than K+, meaning that the Na+ concentration is higher inside the cell than outside.
Using the given concentrations, the Goldman Equation can be used to calculate the resting membrane potential: Vm = 61 ∗ log10(PK[K+]o+PNa[Na+]oPK[K+]i+PNa[Na+]i) = 61 ∗ log10(3+150/145+10) = -21.29 mV.
This answer indicates that the resting membrane potential of the neuron is negative and is more negative than the equilibrium potential for K+ (approximately -90 mV). This is due to the high concentration of Na+ inside the cell, which creates an inward electrochemical gradient across the membrane, leading to a negative membrane potential.
Know more about Goldman Equation here
https://brainly.com/question/7984680#
#SPJ11
In shorthorn cattle, genes for red (R) and white (r) coat colour occur. Cross between red (RR) and white (rr) produces roan (Rr). This is an example of
A incomplete dominance
B codominance
C complementary genes
D epistasis
The cross between red (RR) and white (rr) shorthorn cattle that produces roan (Rr) is an example of codominance. Therefore the correct option is option B.
Codominance is a form of inheritance in which both alleles of a gene are expressed equally in the phenotype of the offspring. In this case, both the red and white coat colour genes are expressed, resulting in the roan coat colour.
This is different from incomplete dominance, where the phenotype is a blend of the two alleles (e.g. pink flowers from a cross between red and white flowers).
Complementary genes and epistasis involve the interaction of multiple genes to produce a phenotype, which is not the case in this example.
Therefore the correct option is option B.
For such more question on codominance:
https://brainly.com/question/3578928
#SPJ11
Are nervous systems a homology shared by all animals? Why or why not? What If instead I asked about intercellular communications being a homology of all animals. Would you your answer change? Why or why not? Finally what is the linkage between cell signalinglintercellular communication and nervous systems?
Nervous systems are not a homology shared by all animals. While many animals do have nervous systems, there are some that do not, such as sponges.
However, intercellular communication is a homology shared by all animals. This is because all animals are made up of cells, and these cells must be able to communicate with each other in order for the organism to function properly.
The linkage between cell signaling/intercellular communication and nervous systems is that both are involved in the transmission of information within an organism. Nervous systems use electrical and chemical signals to transmit information from one part of the body to another, while intercellular communication uses chemical signals, such as hormones, to transmit information between cells. Both of these processes are essential for the proper functioning of an organism.
Learn more about nervous systems : https://brainly.com/question/869589
#SPJ11
Compared to the brand of detergent that was given to you, can other detergents or even soaps be used? If yes, why? If not, why not? Yes, be cause all detergents can do the same function that they help in capturing and separating the lipids and proteins from the cells. 5. Your group was given 30 g of green peas and the procedure indicated certain quantities of all the reagents. Can you use more of the green peas to start the experiment? If so, how would you modify your procedure? 6. Can the same method of isolation of the DNA be used for other raw vegetables, fruits, or other parts of a plant such as leaves? Explain your answer.
Yes, other detergents and soaps can be used in the experiment because all detergents have the same function of capturing and separating the lipids and proteins from the cells. However, it is important to note that different detergents may have different levels of effectiveness and may produce different results.
If you use more than 30 g of green peas in the experiment, you would need to modify your procedure by increasing the quantities of all the reagents proportionally to ensure that the experiment is conducted correctly and the results are accurate.
The same method of isolation of DNA can be used for other raw vegetables, fruits, or other parts of a plant such as leaves. This is because the basic structure of DNA is the same in all living organisms, and the same method of capturing and separating the lipids and proteins from the cells can be applied to any type of plant material. However, it is important to note that different types of plant material may have different levels of DNA content and may require different quantities of reagents to isolate the DNA effectively.
Read more about detergents here:https://brainly.com/question/24852631
#SPJ11
Why are nematodes in a different clade than annelids and playthelminthes? (Ecydsozoa vs. Lophotrochozoa)? Nematodes are more abundant than platyhelminthes & annelids Nematodes have more advanced body systems than annelids or playthelminthes Nematodes molt their cutibje several times during development All parasitic organisms are placed in Clade Ecdysozoa
Nematodes are in a different clade than annelids and platyhelminthes because they are part of the Ecdysozoa clade, while annelids and platyhelminthes are part of the Lophotrochozoa clade.
The main difference between these two clades is that Ecdysozoa, including nematodes, have a cuticle that they molt several times during development, while Lophotrochozoa, including annelids and platyhelminthes, do not have a cuticle and do not molt.
This is the primary reason why nematodes are placed in a different clade than annelids and platyhelminthes.
It is not accurate to say that nematodes are more abundant or have more advanced body systems than annelids or platyhelminthes, as these are not the defining characteristics of the Ecdysozoa clade. Additionally, not all parasitic organisms are placed in the Ecdysozoa clade, as there are parasitic organisms in other clades as well.
In conclusion, the main reason why nematodes are in a different clade than annelids and platyhelminthes is because of their ability to molt their cuticle during development, which is a characteristic of the Ecdysozoa clade.
To know more about Nematodes click on below link:
https://brainly.com/question/19711007#
#SPJ11
Scientists use a technique to abort the formation of seeds in the plant during its early stages. This type of procedure could be: a. Stimulative Parthenocarpy b. Vegetative Parthenocarpy c. Stenosperm
This type of procedure could be "Stimulative Parthenocarpy". Thus the correct answer is a. Stimulative Parthenocarpy.
Stimulative Parthenocarpy is a technique used by scientists to abort the formation of seeds in a plant during its early stages. This is done by applying plant hormones or chemicals to the flower, which prevents fertilization from occurring and results in the formation of a seedless fruit. This technique is commonly used in the production of seedless fruits such as grapes, watermelons, and bananas.
Vegetative Parthenocarpy, on the other hand, is the natural production of seedless fruits without the use of any external chemicals or hormones. This occurs when a plant is able to produce fruits without fertilization.
Stenosperm is not a term related to the formation of seedless fruits and is therefore not the correct answer.
You can learn more about Parthenocarpy at
https://brainly.com/question/10894312
#SPJ11
What are the current guidelines for radiation protection?
The current guidelines for radiation protection are justification, optimization, dose limits, risk assessment, training, and education.
The current guidelines for radiation protection are set by the International Commission on Radiological Protection (ICRP) and the National Council on Radiation Protection and Measurements (NCRP). These guidelines include:
1. Justification: The use of radiation must be justified by the potential benefits outweighing the potential risks.
2. Optimization: The amount of radiation exposure should be as low as reasonably achievable (ALARA) to minimize the risk of harm.
3. Dose limits: There are specific dose limits for occupational exposure, public exposure, and medical exposure to prevent excessive exposure to radiation.
4. Risk assessment: A risk assessment should be conducted to determine the potential risks and benefits of using radiation.
5. Training and education: Individuals working with radiation should be properly trained and educated on radiation safety and protection.
These guidelines are designed to protect individuals from the harmful effects of radiation and to ensure that the use of radiation is safe and effective.
Learn more about Radiation protection at https://brainly.com/question/2177171
#SPJ11
In carrying out Drosophila crosses in the laboratory, a student hypothesized that the allele for the wild-type red eyes (se" is dominant to the allele for sepia eye color (se), that the allele for wild-type long wings (sh) is dominant to that for short wings (sh), and that the alleles governing these two traits assort independently of each other. The mating of a sepia-eyed, long-wins fly with a red-eyed, short-winged fly produced and Fi with red eyes and long wings. The mating of Fy flies produced and F generation of 640 progeny. 344 red, long: 134 red, short: 128 sepia, long, and 34 sepia, short. a) What is the expected ratio and number of flies for each of the four F2 phenotypic classes? b. Determine the X value for the F2 outcome c) What is the probability value for this X? value? d) Can the difference between observed and expected numbers reasonably be attributed to chance?
a) The expected ratio for the F2 phenotypic classes is 9:3:3:1, which corresponds to 360 red, long: 120 red, short: 120 sepia, long: 40 sepia, short.
b) The X value for the F2 outcome can be calculated using the formula X is 3.77,
c) The probability value for this X value can be determined using a chi-square distribution table with 3 degrees of freedom. The probability value for an X value of 3.77 is between 0.1 and 0.05.
d) The difference between observed and expected numbers can reasonably be attributed to chance, as the probability value is greater than 0.05.
a) In the F2 generation, a 9:3:3:1 ratio of phenotypic classes was expected based on the Mendelian inheritance pattern of two traits. This ratio corresponds to 360 red, long; 120 red, short; 120 sepia, long; and 40 sepia, short.
b) The value of X for the F2 outcome was calculated to be 3.77 using a chi-square test to compare the observed and expected numbers of each phenotypic class.
c) The probability value for the X value of 3.77 was determined using a chi-square distribution table with 3 degrees of freedom, which indicates that the probability of obtaining this value by chance alone is between 0.1 and 0.05.
d) The observed difference between the expected and observed numbers can be attributed to chance, as the probability value is greater than 0.05. This suggests that the observed and expected numbers are not significantly different, and therefore, the hypothesis of Mendelian inheritance is supported.
X = [(observed - expected)^2 / expected].
The X value for each phenotypic class is as follows:
- Red, long: [(344 - 360)^2 / 360] = 0.71
- Red, short: [(134 - 120)^2 / 120] = 1.63
- Sepia, long: [(128 - 120)^2 / 120] = 0.53
- Sepia, short: [(34 - 40)^2 / 40] = 0.9
The total X value for the F2 outcome is the sum of these individual X values, which is 0.71 + 1.63 + 0.53 + 0.9 = 3.77.
To know more about chi-square distribution click on below link:
https://brainly.com/question/30259945#
#SPJ11
A team of researchers has just discovered a new disease that infects the root of corn plants and threatens the corn crop in the country. They’ve been given a huge grant from the U.S. Department of Agriculture to study this plant disease. You've been hired by these researchers to design a sound experimental strategy. Answer the following questions and provide brief reasoning for your strategies:
a) List all the potential pathogen-types that might cause diseases in plants.
b) What is a simple method to eliminate cellular pathogens as the cause without using microscopy or antibiotics or any enzymes?
c) What would be a simple way to rule out viroids as the potential pathogen, based only on the biochemistry/structural organization of the pathogen (without using microscopy)?
d) You discern that the pathogen is not a viroid. Is this data sufficient to conclude that the pathogen is a virus? How can you confirm that the virus is the pathogen only based on the biochemistry/structure of viruses? (Note: You do not have access to electron microscopes. However, you can use chemical agents such as enzymes to help design this confirmatory experiment.)
This data is not sufficient to conclude that the pathogen is a virus. To confirm that the virus is the pathogen, you can conduct various biochemical/structural tests.
For example, you can examine the size of the pathogen to see if it is within the size range of known viruses, as viruses are generally larger than viroids.
Additionally, you can perform protein analyses to look for viral proteins, such as viral capsid proteins and other viral enzymes. Finally, you can use electron microscopy to study the structure of the pathogen and compare it to known viruses.
Conduct various biochemical/structural tests to compare the characteristics of the pathogen to that of known viruses.
Learn more about pathogen: brainly.com/question/1273396
#SPJ11
What can we conclude about the climate on the Serengeti between 1960-75?
Answer the following question in CER format. Question: Was climate or food the cause of the increase in the buffalo population?
Answer:
Claim: The increase in the buffalo population was primarily caused by food availability rather than climate.Evidence supporting the claim includes historical records of the buffalo population fluctuating in response to changes in available vegetation, as well as observations of buffalo populations in regions with similar climates but varying food resources. Furthermore, studies have shown that during periods of drought, when vegetation is scarce, buffalo populations decrease, whereas during times of ample food resources, buffalo populations increase.However, it is important to note that climate can still indirectly impact the buffalo population through its effects on vegetation and food availability. For example, prolonged droughts or extreme weather events can lead to reductions in vegetation growth, which can in turn impact the availability of food for the buffalo.Therefore, while climate can have an impact on the buffalo population, it is the availability of food that is the primary driver of changes in population size.
One genus of dinoflagellates, the Symbiodinium, are specifically important in the survival of coral reefs
around the world. Answer the following questions concerning these organisms:
Why are these dinoflagellates necessary for the survival of coral recfs?
Why are the dinoflagellates at risk?
Symbiodinium dinoflagellates are necessary for the survival of coral reefs because they form a symbiotic relationship with the coral, providing them with essential nutrients and energy. Unfortunately, the dinoflagellates are at risk due to climate change and other human activities that harm the ocean.
These dinoflagellates use photosynthesis to produce sugars, which the coral then uses as a source of energy. In return, the coral provides the dinoflagellates with a safe and stable environment to live in. Without the Symbiodinium dinoflagellates, the coral would not be able to survive.
Rising ocean temperatures can cause the dinoflagellates to become stressed and leave the coral, leading to coral bleaching. Additionally, pollution and other human activities can harm the dinoflagellates and their coral hosts, leading to their decline. It is important to address these issues in order to protect the Symbiodinium dinoflagellates and the coral reefs they support.
Learn more about Dinoflagellates https://brainly.com/question/28902387
#SPJ11
Which viral reproductive cycle does the viral genetic info become integrated/incorporated in the host cells genetic info and remain dormant until activated by a stressor?
Lysogenic Cycle
Lytic Cycle
Answer:
The lysogenic cycle is the viral reproductive cycle wherein the viral genetic information becomes integrated, or incorporated, into the host cell's genetic information and remains dormant until activated by a stressor. In this cycle, the virus does not immediately replicate and instead enters a dormant state, known as lysogeny. When the host cell experiences a stressor or trigger, the virus may be activated and begin to replicate itself
Explanation:
The following data correspond to one marker taken from a genome-wide association study (GWAS) of genetic variants related to heart disease. The number of individuals are categorized by case-control status, as well as their genotype at this marker (AA, AG, or GG).
AA AG GG
Cases
(heart disease)
315 702 1410
Controls
(no heart disease)
85 723 1717
What would you conclude based on these data?
Group of answer choices
a. This marker is likely to be closely linked to a gene that affects heart disease risk, and the A allele is associated with higher disease risk.
b. This marker is likely to be closely linked to a gene that affects heart disease risk, and the G allele is associated with higher disease risk.
c. This marker is not likely to be closely linked to a gene that affects breast cancer risk.
Based on these data you could conclude is b. This marker is likely to be closely linked to a gene that affects heart disease risk, and the G allele is associated with higher disease risk.
The genome-wide association study (GWAS) is used to recognize the association between genetic variants and diseases. It is a type of observational study that compares the genomes of groups of people with and without disease. This study determines which genetic variations are related to the disease.
In this study, the G allele is associated with higher disease risk. So, this marker is likely to be closely linked to a gene that affects heart disease risk. Therefore, option B This marker is likely to be closely linked to a gene that affects heart disease risk, and the G allele is associated with higher disease risk is correct.
Learn more about genome-wide association study at:
https://brainly.com/question/29894104
#SPJ11
I CLICKED 50 I DONT KNOW WHAT IT MEANS BUT SOMEONE HELP FAST
Compare and contrast a frameshift mutation and a single nucleotide substitution mutation in a DNA sequence encoding a protein. How many nucleotides would be inserted or deleted in each? How many amino acids in the protein sequence would be altered in each?
Depending on how far downstream the mutation occurs, a frameshift mutation can change numerous amino acids, whereas a single nucleotide substitution may only affect one amino acid in the protein sequence.
One nucleotide of the DNA sequence is changed by a single nucleotide substitution mutation, which may or may not alter the amino acid sequence of the resultant protein.
A frameshift mutation alters the reading frame of the genetic code by deleting or introducing nucleotides. This change may produce a completely new or shortened protein.
How are mutations described?Any factor that results in a mutation (a change in the DNA of a cell). Mutagens can injure cells and cause some diseases, like cancer, by altering DNA.
Radioactive elements, x-rays, ultraviolet rays, and certain compounds are examples of mutagens.
What are the four mutation types?There are many different kinds of mutations, including translocation, insertion, deletion, and replacement.
What examples of mutations exist?Cystic fibrosis, hemophilia, and sickle cell disease are examples of hereditary mutations.
Throughout a person's life, further mutations may occur on their own. Spontaneous, sporadic, or novel mutations are the terms used to describe them. They only impact certain cells.
learn more about mutation here
https://brainly.com/question/14438201
#SPJ1
Explain the significance of the refractory period following an
action potential. Include definitions of absolute and relative
refractory periods in your answer.
The refractory period following an action potential is significant because it ensures that the action potential moves in one direction down the axon and prevents the action potential from repeating in the same area.
The absolute refractory period is the time period during which a second action potential cannot be initiated, no matter how strong the stimulus is. This is because the voltage-gated sodium channels are inactive during this time and cannot be opened to allow the influx of sodium ions needed for an action potential.
The relative refractory period is the time period during which a second action potential can be initiated, but it requires a stronger stimulus than normal. This is because the voltage-gated potassium channels are still open, causing the membrane to be more negative than normal, and a stronger stimulus is needed to overcome this and reach the threshold for an action potential.
Overall, the refractory period plays an important role in ensuring the proper functioning of the nervous system and the transmission of information.
For such more question on refractory:
https://brainly.com/question/9517674
#SPJ11
A patient is given an extended treatment with a broad spectrum
antibiotic. Towards the end of the treatment, the patient develops
a C. diff infection. What is this an example of?
This is an example of an opportunistic infection is when a patient is given an extended treatment with a broad spectrum antibiotic, towards the end of the treatment, the patient develops a C. diff infection.
What is an opportunistic infection?An opportunistic infection is an infection that occurs when an organism takes advantage of a host with an already weakened immune system. Opportunistic infections are caused by bacteria, viruses, fungi, and parasites that are typically harmless in healthy individuals but can cause disease in those with compromised immune systems. Extended treatment with a broad-spectrum antibiotic can eliminate not only the pathogenic bacteria but also the commensal microorganisms, allowing Clostridium difficile, a resident of the colon, to proliferate and cause infection. This is an example of an opportunistic infection that can occur as a result of antibiotic use.
Learn more about infection here: https://brainly.com/question/26229132
#SPJ11
two reasons why extreme cold mathylated spirit is used
Methylated spirit is used in extreme cold because it has a low freezing point and evaporates quickly.
Why is methylated spirit used in extreme cold?Methylated spirits, also known as denatured alcohol, is a type of alcohol that has been treated with chemicals to make it unsuitable for consumption. It is often used for cleaning or as a fuel for camping stoves.
Extreme cold methylated spirit, also known as freezing mixture, is a mixture of methylated spirits and other chemicals that produce a very low temperature. It is commonly used in science labs and medical facilities for a couple of reasons:
To create a low-temperature environment: Extreme cold methylated spirit can create temperatures as low as -70°C, which is useful for storing samples, such as blood, tissue, or DNA, for research purposes.In both cases, extreme cold methylated spirit is preferred over other cooling methods because it is easy to handle, has a low cost, and does not leave any residue.
Learn more about methylated spirit, here:
https://brainly.com/question/470038
#SPJ1
How would you determine whether your two mutants have defects in the same gene or different genes?
There are several ways to determine whether two mutants have defects in the same gene or different genes:
Complementation analysisEpistasis analysisDNA sequencingRescue experimentsWe proceed to analyze the methods for analyzing the defects of two mutants:
Complementation analysis: This involves crossing the two mutants together to see if they can complement each other's defects. If the resulting offspring have a wild-type phenotype, it suggests that the mutations are in different genes. If the offspring still have the mutant phenotype, it suggests that the mutations are in the same gene.Epistasis analysis: This involves examining the genetic interactions between the two mutants. If one mutant masks the phenotype of the other, it suggests that the two mutants are in different genes. If the double mutant has a phenotype that is the same as one of the single mutants, it suggests that the two mutants are in the same gene.DNA sequencing: This involves sequencing the DNA of the two mutants to identify the specific mutations. If the mutations are in the same gene, they are likely to be in the same exon or intron, whereas mutations in different genes would be in different regions of the genome.Rescue experiments: This involves introducing a wild-type copy of the gene into one or both mutants to see if it can rescue the mutant phenotype. If the phenotype is rescued in both mutants, it suggests that they have defects in the same gene.See more about mutants at https://brainly.com/question/17031191.
#SPJ11
_______ It starts in the esophagus where strong wave-like motions of the smooth muscle move balls of swallowed food to the stomach
The process you are describing is called peristalsis. It is a series of wave-like muscle contractions that move food through the digestive tract. Peristalsis begins in the esophagus, where it helps move the food down to the stomach.
It then continues in the small intestine, where it helps mix and move the food along so that it can be further digested and nutrients can be absorbed. Peristalsis also occurs in the large intestine, where it helps move waste products along to be eliminated from the body. Without peristalsis, food would not be able to move through the digestive tract and be properly digested.
For more such questions on peristalsis
https://brainly.com/question/3223318
#SPJ11
T/F dehydration synthesis: process by which larger molecules are formed by the removal of water from two smaller molecules. hydrogen comes off one compound, hydroxide off another, forming water which is removed, and compounds join to create larger one
The given statement "Dehydration synthesis is a process by which larger molecules are formed by the removal of water from two smaller molecules. hydrogen comes off one compound, hydroxide off another, forming water which is removed, and compounds join to create larger one." is true, because (This process is commonly used in the formation of polymers)
Dehydration synthesis process involves the removal of a hydrogen atom from one compound and a hydroxide group from another compound, forming water, which is then removed. The two compounds then join together to create a larger molecule. This process is commonly used in the formation of polymers, such as carbohydrates, proteins, and lipids.
Dehydration synthesis is a crucial step in the production of polymers and other complex biological compounds. A water molecule is eliminated during this process when two smaller molecules are combined to create a bigger one. Due to the condensation of two molecules into one, this process is also sometimes referred to as condensation synthesis. By adding water, big molecules are converted into smaller ones during the process of hydrolysis. In the metabolism of living things, hydrolysis and dehydration synthesis are both crucial processes.
For more such questions on Dehydration synthesis, click on:
https://brainly.com/question/14679565
#SPJ11
Describe the sequence of events involved in each of the phases of eukaryotic translation: Initiation, Elongation, Termination.
During initiation, the ribosome assembles on the mRNA and begins reading it. In elongation, the ribosome adds amino acids to the growing polypeptide chain. In termination, the ribosome reaches a stop codon, and the polypeptide chain is released.
The process of eukaryotic translation can be divided into three main phases: Initiation, Elongation, and Termination. Each phase involves a series of events that lead to the synthesis of a protein from an mRNA template. Here is a description of the sequence of events involved in each phase:
Initiation:The small ribosomal subunit binds to the 5' end of the mRNA molecule.The initiator tRNA, carrying the amino acid methionine, binds to the start codon (AUG) on the mRNA.The large ribosomal subunit then binds to the small subunit, forming a complete ribosome and enclosing the initiator tRNA in the P site.Elongation:A tRNA carrying the next amino acid binds to the A site of the ribosome.The amino acid in the P site is transferred to the amino acid in the A site, forming a peptide bond.The ribosome moves one codon along the mRNA, moving the tRNA in the A site to the P site and the tRNA in the P site to the E site, where it is released.The process repeats until the ribosome reaches a stop codon.Termination:The ribosome reaches a stop codon (UAA, UAG, or UGA) on the mRNA.A release factor binds to the stop codon, causing the ribosome to release the newly synthesized protein and dissociate into its separate subunits.
Learn more about eukaryotic translation here:
https://brainly.com/question/26265481
#SPJ11
Which of the following are examples of biodegradable wastes?
a. Plastic and cow-dung cakes c. Cow-dung cakes and vegetable peels
b. Plastic and rubber d. Glass and the cow-dung cakes
Answer:
C. cow-dung cakes and vegetable peels.
Explanation:
biodegradable means that something will be able to be broken down by microorganisms (returned to the earth, basically) in a relatively short amount of time. both vegetable peels and cow dung are both biodegradable.
Describe Darwin’s and Went’s experiments on plant responses to
light and the hormone responsible.
Darwin and Went's experiments on plant responses to light and the hormone responsible.
Darwin's Experiment on Plant Response to Light: Darwin's experiment was to investigate how the light affected plant shoots' growth. He observed that the plant shoots grow towards the source of light. He placed plants near a window with a horizontal glass plate in the middle, which blocked light to one side. He noticed that the plant shoots grew towards the window, which was the source of light. He also observed that the tips of the shoots showed greater growth. The area responsible for this is known as the tip of the stem.The light sensitivity of the plant is due to the hormone Auxin. Auxin is synthesized in the plant's tip and migrates down the stem, causing the stem to elongate.
The amount of Auxin produced is affected by the amount of light received by the plant. Went's Experiment on Plant Responses to Light: Went used oat and coleoptile to test the light sensitivity of plants. He discovered that the tip of the oat coleoptile is the light-sensitive portion. When the tip was covered, the coleoptile did not curve towards the light. Went demonstrated that a chemical known as auxin or indoleacetic acid (IAA) is responsible for coleoptile bending. When the tip was removed and placed on agar, it produced auxin, which caused the coleoptile to curve towards the light. Went's experiment showed that auxin is a chemical messenger that travels from the tip to the lower part of the plant and causes the plant to bend towards light or away from gravity.
To know more about plant responses refer here:
https://brainly.com/question/30228388
#SPJ11
You are given a primary amino acid sequence of a protein.
Explain how you would predict the secondary and tertiary structures
that the mature version of the given protein would adopt.
To predict the secondary and tertiary structures that the mature version of the given protein would adopt, you would need to analyze the primary amino acid sequence using bioinformatics tools.
The prediction of the secondary and tertiary structures of a given primary amino acid sequence of a protein can be done through the following steps:
1. Analyze the primary sequence to identify the presence of secondary structure elements such as alpha-helices, beta-sheets, and turns. This can be done using bioinformatics tools such as PSIPRED or Jpred.
2. Use the information about the secondary structure elements to predict the tertiary structure of the protein. This can be done using computational methods such as comparative modeling or ab initio modeling. Comparative modeling uses the known structures of related proteins as templates to predict the structure of the target protein. Ab initio modeling predicts the structure of a protein from its sequence alone, without the use of templates.
3. Validate the predicted structures using experimental methods such as X-ray crystallography, nuclear magnetic resonance (NMR) spectroscopy, or cryo-electron microscopy (cryo-EM). These methods can provide structural information at the atomic level, allowing for the verification of the predicted structures.
By following these steps, it is possible to predict the secondary and tertiary structures of a given primary amino acid sequence of a protein.
To learn more about protein, click here:
https://brainly.com/question/29776206
#SPJ11
how breathing rate is regulated by the brain in response to extreme
shifts in acid-base balance in the blood.
Breathing rate is regulated by the brain in response to extreme shifts in acid-base balance in the blood. The brain regulates breathing rate in response to changes in the pH balance of the blood, which is the measure of acid-base balance.
When the blood becomes too acidic, the brain increases the rate of breathing to expel carbon dioxide, thus lowering the pH level of the blood. Conversely, when the blood becomes too alkaline, the brain decreases the rate of breathing in order to increase the level of carbon dioxide, thus increasing the pH level of the blood.
The brain maintains homeostasis, or balance, of the acid-base balance of the blood through two processes: central and peripheral chemoreceptors. Central chemoreceptors are located in the medulla of the brain, and detect the pH level of the cerebrospinal fluid, which is closely related to the pH level of the blood.
Peripheral chemoreceptors are located in the carotid bodies, and detect the pH levels of the blood directly. When either of these chemoreceptors detect a change in the pH level of the blood, they send signals to the brain which causes a corresponding change in the rate of breathing.
For more about breathing rate:
https://brainly.com/question/22600763
#SPJ11
Which enzyme in the hexokinase assay makes this assay
specific for glucose, and not some other hexose
sugar
The enzyme that makes the hexokinase assay specific for glucose and not any other sugar is hexokinase itself.
Hexokinase is an enzyme that catalyzes the phosphorylation of glucose and other hexoses, as well as some pentoses, in the presence of adenosine triphosphate (ATP). Because hexokinase can only bind and phosphorylate glucose, the hexokinase assay is specific for glucose and not any other sugar.
Hexokinase is a vital enzyme in glucose metabolism, and it is found in most living organisms. Hexokinase is a regulatory enzyme in the glycolytic pathway, and it plays a critical role in glucose homeostasis. The phosphorylation of glucose by hexokinase is an irreversible reaction, and it serves to trap glucose within the cell.
The hexokinase assay is a common method used to quantify glucose levels in biological samples such as blood, serum, plasma, and urine. In the hexokinase assay, glucose is first phosphorylated by hexokinase in the presence of ATP. Glucose-6-phosphate (G6P), the product of this reaction, is then oxidized by NADP to produce NADPH in the presence of glucose-6-phosphate dehydrogenase (G6PDH).
To learn more about glucose, click here:
https://brainly.com/question/30548064
#SPJ11
How are plate boundaries related to the Earth’s plates? A. Boundaries can be anywhere in an ocean basin or a continent. B. Boundaries are always where ocean basins meet continents. C. Boundaries are always in the middle of ocean basins. D. Boundaries are not found in continents.
Boundaries can be anywhere in an ocean basin or a continent. –That is how plate boundaries are related to the Earth’s plates.
What is continent?
A continent is any of multiple extremely large geographic regions. The definition of a continent is usually based on convention rather than precise criteria; a continent could be a single landmass or a section of a very large landmass, as in the case of Asia or Europe. As a result, there are often seven or as few as four geographic areas that are regarded as continents. Most English-speaking countries classify seven regions as continents.
A number of plate boundaries converge. According to one theory, plate boundaries arise where the mantle's convection currents are more variable. Another idea, is that there are parts of each plate, which is comprised of rock, that are thinner and hence more prone to react to the heat from the mantle below.
Hence the correct answer is A, Boundaries can be anywhere in an ocean basin or a continent
To learn more about continent from the given link
https://brainly.com/question/22687489
#SPJ1
Answer: A.) Boundaries can be anywhere in an ocean basin or a continent.
Explanation:#edmentumgang
Brainliest???
If a strand of DNA has a sequence TAGGATC, what would be thecomplementary sequence?CGAAGATTACCGGACGAAGTCATCCTAG
The complementary sequence would be:
Original sequence: TAGGATC
Complementary sequence: ATCCTAG
The Complementary sequence to the given DNA strand would be ATCCTAG. This is because in DNA, the base adenine (A) always pairs with thymine (T), and the base cytosine (C) always pairs with guanine (G). Therefore, the complementary sequence would have the bases that correspond to the original sequence. Here is a step-by-step explanation:
1. Look at the first base in the original sequence, which is T.
2. Find the base that pairs with T, which is A.
3. Write down A as the first base in the complementary sequence.
4. Repeat this process for each base in the original sequence.
Here you can learn more about Complementary sequence
https://brainly.com/question/15262636#
#SPJ11