I do not understand this. It is about "Membrane Transport".

I Do Not Understand This. It Is About "Membrane Transport".

Answers

Answer 1
Osmosis is taking place?

Related Questions

why do multicellular organisms have emergent properties

Answers

Answer:

They have more genes than unicellular organisms.

Explanation:

They show properties that can only result from the interaction of many cells.

I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology

Answers

Answer:

guess we were in the same boat I have

Explanation:

Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today

which high grade, foliated metamorphic rock has visible crystals?

Answers

Answer:

Gneiss

Explanation:

Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.

Hope this helps! : )

Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.

What is Gneiss?

The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.

Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.

Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.

Learn more abut Gneisses, here:

https://brainly.com/question/22489042

#SPJ5

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

what are the two major anatomical subdivisions of the nervous system?

Answers

Answer: The nervous system has two main parts:

The central nervous system is made up of the brain and spinal cord.

The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Explanation:

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

How does thermal energy impact the lower layers of atmosphere?

Answers

Answer:

Explanation:

Land and water absorb most of the solar radiation from the sun. Some of this solar energy from land and water is then transferred to the lower atmosphere which is in contact with the continents and oceans. From Land, this occurs mostly as heat energy or infrared radiation. Water usually transfers this energy through the evaporation of water into the atmosphere

list three ways that organisms use energy

Answers

Answer + Explanation:

Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.

what is the name of the tiny air sacs in your lungs?

Answers

Answer:

alveoli

Explanation:

where does pyruvate oxidation occur in eukaryotic cells

Answers

Answer:

mitochondrial matrix

Explanation:

Answer:

Pyruvate is produced during glycolysis in the cytoplasm, but pyruvate oxidation occurs in the mitochondrial matrix (in eukaryotes).

please give me crown thank you

Explanation:

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

tumors can coerce the formation of blood vessels to serve the cancer cells within the tissue. what is this process called?

Answers

Answer:

Such tumors, unless they secrete hormones, cause few problems. However, most tumors induce the formation of new blood vessels that invade the tumor and nourish it, a process called angiogenesis.

Explanation:

Give me an example of seedless vascular plants...​

Answers

Mosses,Hornworts,Liverworts

Explanation:

Seedless vascular plants embrace ferns,Horsetails and club mosses.

Answer:

mosses,liverworts

Explanation:

whats the answer ugh

Answers

Answer:

Phalanges: long bones

Sternum: flat bone

Vertebrae: Irregular bone

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.

Answers

Answer:

ATP is your answer

Explanation:

Which of the following elements is not a metalloid?

Answers

Answer:

gallium

Explanation:

plz answer correctly. thank you.

Answers

Answer:

Mitosis and cytokinesis

Explanation:

Answer:

see below

Explanation:

1) A- Interphase and mitosis

2) Interphase

which muscle group relates best with the term midline?

Answers

The oblique is the muscle group that best relates with the term midline.

The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:

The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.

It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.

The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.

Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.

Learn more here: https://brainly.com/question/19486604


Name given to the two new cells formed at the end of cell division.

Answers

Answer:

Diploid cells

Explanation:

The daughter cells from mitosis are called diploid cells. Diploid cells have two complete sets of chromosomes.

Diploid cells is the name given

1. When “cleaning” a cadaver, what is removed to better see defined muscles?

Answers

When cleaning a cadaver, a professional will remove the fascia in order to better see defined muscles.

The fascia is a thin layer of connective tissue that wraps muscles. It is membraneous and extends throughout the entire body. Among the many functions of the fascia are:

Protectionisolation Compartmentalization

Of its functions, the last it's perhaps the most relevant to this question. It divided the muscles into groups. This is one of the main reasons that in order to see and properly study the muscles of a cadaver, the professional must remove the fascia.

To learn more visit:

https://brainly.com/question/262544?referrer=searchResults

Answer:

deep fascia

Explanation:

in an otherwise normal cell, what happens if one mistake is made during dna replication?

Answers

Answer:

Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.

Explanation:

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2

Organize these rock layer from youngest to oldest
Breccia

Conglomerate

Dolostone

Shale

Answers

Conglomerate,Shale,Dolostone

From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale, and as per geology, the principle of superposition states that in a sequence of layered rocks, the youngest layer is on top and the oldest layer is at the bottom.

What are rock layers?

Breccia is the youngest layer in the sequence. Breccia is a coarse-grained sedimentary rock made up of angular fragments of other rocks that have been cemented together. It is formed through a process called brecciation. Conglomerate is also a coarse-grained sedimentary rock, but unlike breccia, its fragments are rounded and well-worn, indicating that they have been transported over a distance by water or wind before being deposited and cemented, and dolostone is older than both breccia and conglomerate. Shale is the oldest layer in the sequence.

Hence,    From youngest to oldest are Breccia, Conglomerate, Dolostone, and Shale.

Learn more about the rock layers here.

https://brainly.com/question/19598172

#SPJ2

A change in pH has the greatest impact on which life proces

Answers

Answer:

Aquatic Organisms

If the pH of water is too high or too low, the aquatic organisms living within it will die. pH can also affect the solubility and toxicity of chemicals and heavy metals in the water ¹². The majority of aquatic creatures prefer a pH range of 6.5-9.0, though some can live in water with pH levels outside of this range.

Explanation:

Adding more OH- ions increases the pH, making the substance more basic. Increasing the pH will increase the number of OH- ions, so the equilibrium will shift to the left. Decreasing the pH will increase the number of H3 O+ ions; they'll ''use up'' the OH- ions, thus shifting the equilibrium to the right.

which muscle is used when giving your grandmother a kiss on the cheek?

Answers

Sternocleidomastoid

Explanation:

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

Glycogen is a complex carbon hydrates found in animals true or false?

Answers

Answer:

true

Explanation:

Explanation:

i think true i think please mark me brainlist thank you

Other Questions
Find the missing side of the length, s. I need help! which 2 Empires competed for control over Latin America? I got ace in a week i felt so happy i wanna give someone branliest 2+2 I have sent a photo its a 1 question In one to two sentences, explain how the First Continental Congress unified the colonists.NO FILES NO VIDS NO PICS AND NO OTHER WEBSITES YOU WILL GET 30 POINTS PLEASE HELP ITS DUE REALLY SOON AND IM REALLY DESPERATE JUST ANSWER ANY QUESTION THAT YOU CAN AND PLS TELL ME WHICH ONE IT WAS. I WILL GIVE BRAINLIEST 5 STARS AND A THANKS PLS OMG :C SORRY THERE IS NOT A LOT OF POINTS :cCC Read the scenario.Joe, a reporter for Main Street News, covered a campaign rally for Jiya Patel, who is running for county commissioner. While at the rally, he interviewed the candidate and some audience members as his research for the article. He then wrote an article describing the rally, the candidates platform, and the reasons her supporters believe that she is the best person for this job. When he finished, he turned his article in to his editor. As the editor reviews this story, he sees a public report on campaign donations and learns that Joe has made a sizeable contribution to Patels campaign.What is the most ethical action for the editor to take? maritime industries is a federal contractor that makes navigation equipment for naval ships. maritime industries rarely focuses on the external environment and is very rigid due to the structured contracts that drive most of its business. because the products maritime industries sells need little improvement and there is virtually no competition, maritime industries takes few risks. maritime industries is an example of an adhocracy culture. This is a specialized defensive position responsible for defending the attack from the opposing team. This player wears a contrasting colored jersey . The temperature at 10:00 a.m was -3 and increased 2.25 each hour for the next 5 hours.What was the temperature at 3:00pm? Tyler buys packs of Pokemon cards. His spending can be represented by the equation C = 0.5p, where C is the cost of his purchase and p is the number of packs he buys. Create a graph that represents Tyler's spending. What is the distance between point C (3.5,6) and Point A (4.8, 6) Find the Perimeter of the figure below, composed of a rectangle and two semicircles. Round to the nearest tenths place. Allen has a[n] _______________memory when it comes to remembering faces, so it was quite a[n] __________ when a stranger asked, Dont you know me? and Allen was forced to say No. The stranger issued a simple, Youll remember, before leaving Allens store. The visit was __________ to Allen; he hated having such a[n] __________ gap in the memory he often boasted about. That evening at home, Allen perused every __________ of customer names and addresses he could find, hoping to spark his memory. Which of the following does not influence the pacing of a story? To hit a fish that he sees beneath the water, where should he aim? what triggered typhoid and cholera epidemics in american cities in the late 1800s why does josh gain confidence with his reading and writing skills? What is \frac{1.88x10^6}{2000} in scientific notation? compare the circulatory system of a plant and animal plz help do not copy off anything because this is a unit test