how you can play your role to overcome the waste issue in your area?

(giving brianliest with extra points)

Answers

Answer 1

Answer:

Recycle and throw away approprite trash

Explanation:

Answer 2

Recycle and throw away appropriate trash.


Related Questions

Describe how the picture below represents the function of the immune system

Answers

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.

Answers

Answer:

To save itself.

Explanation:

The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.

Who ever Answer this right will get brainliest ​

Answers

Answer:

See Explanation

Explanation:

Pathogens are disease causing organisms in the body. They attack diverse cells, organs, tissues and systems in the body thereby causing them to malfunction (to become diseased).

Antibodies are the body's natural protective mechanism against pathogens.  Antibodies engulf these pathogens and digest them. Then they produce certain chemicals called antitoxins which now destroy the toxins produced by these pathogens in the body.

Also they activate the systems involved in fighting pathogens by punching the cell wall of invading pathogens.

In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?




Both of these

Genetic Drift

Founder Effect

None of these

Answers

Answer: Both of these

Explanation: trust me

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

Help me please! Do 1,2,3 by filling in the blank!!!!

and no website

Answers

The answer is Glucose

Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations

Answers

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat

Answers

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

what was explained by darwins theory of biological evolution

Answers

Answer:

When Organism A has a trait that negatively impacts it, or lacks a trait which would positively impact it, then said organism perishes, and its genes are not passed onto the next generation. On the flip side, when Organism B has a trait that positively impacts it, or lacks a trait that would negatively impact it, then the organism thrives, and its genes are passed onto the next generation.

Therefore, the next generation receives genes from Organism B and does not receive genes from Organism A. So, the next generation has traits that positively impact it and lacks traits that would negatively impact it, thus evolving according to Darwin.

Explanation:

What was explained by it? Evolution. But how did it explain evolution? That is in the answer.

how does rock turn into soil​

Answers

Erosion it breaks down the rocks into soil

Answer:

Rocks turn into soil through the process of weathering.

Explanation:

Weathering is when rocks are broken down into smaller pieces

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

c) Explain why wheat is not able to grow well in
nitrate poor soil.

Answers

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

Which of the following factors would make the smallest contribution to determining the climate of an ecosystem?


a.
precipitation patterns


b.
ocean currents


c.
geographic features such as mountain ranges


d.
magma under the earth's crust

Answers

Answer:

Latitude. ...

Elevation. ...

Ocean Currents. ...

Topography. ...

Vegetation. ...

Prevailing winds.

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

During a study session about evolution, one of your fellow students remarks "The giraffe stretched its neck while reaching for higher leaves, its offspring inherited longer necks as a result, which statement is most likely to be helpful in correcting this students misconception?

a) characteristics acquired during an organisms life are generally not passed on through genes
b) spontaneous mutations can result in the appearance of new traits
c) only favorable adaptations of survival value
d) disuse of an organ may lead to its eventual disappearance

Answers

Answer: Characteristics acquired during an organism's life are generally not passed on through genes.

Explanation:

The most common misconception between students which can be corrected is that the characteristics acquired during an organisms life are generally not passed on through the genes. Thus, the correct option is A.

What are acquired traits?

Acquired traits or characteristics are the non-heritable changes in the function or structure of a living organism which is caused after birth and was absent before this. Occurrence of acquired traits could be due to disease, injury, accident, deliberate modification, variation, repeated use, or other environmental influence.

For example, the giraffe stretched its neck while reaching for the higher leaves but her children does not get a long neck by birth however this character has been fixed with time because of the repeated use of the neck for food.

Therefore, the correct option is A.

Learn more about Traits here:

https://brainly.com/question/24886772

#SPJ6

PLEASE HELP I NEED HELP (Plant related / Project stuff)

Answers

Answer:

B, D, A, E, C

Explanation:

1. environmental factors

2. growth

3. adaptation

4. organism

5. genetic factors

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?

Answers

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

When uncontrolled, the cell cycle becomes cancer. It forms lumps called..?

Answers

Answer:

Tumours are groups of abnormal cells that form lumps or growths. They can start in any one of the trillions of cells in our bodies.

Explanation: (:

Answer:

It forms lumps called tumors.

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

Will this process below ensure with certainty that the offspring will retain their needles? Explain your answer.

Chastagner emphasizes that homeowners can minimize needle shedding by keeping their displayed trees well-supplied with water. In fact, when he has set up trees for research in early December and kept them watered, some species, like noble and Nordmann fir, have gone even three months with only minimal shedding.

Answers

Answer:

I'm in school I'll help you when get home around 4:30

Nondisjunction that occurs during meiosis II produces what?

Answers

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

Other Questions
Months after the czar was overthrown in Russia, a group led by Vladimir Lenin took control of the government.Which group did Vladimir Lenin lead?The Democratic partyThe Communist partyThe Soviet CouncilThe Suffragist movement 4x4 Thhhhhhaaannkkkk uuuuu For number one and two what are the Mean Median and Mode and RangePlease help Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection. Evaluate the following: 21 - 8- (-5)(7)| - 54 Summarize in 3 sentences the effects of suburban growth in the 1950s. In what way are the respiratory system and the digestive system similar? B. Compare the words impression and correction. How are they alike?How are they different Find the area of the shaded region. help pls Hellllllp pleas if you want brainliest answer both Is there massless ness in space?Why? Which survey question is unbiased?O A. "Do you think we should allow them to cut down the trees and pave over the grass for the new playground?"B. "Which do you prefer with a meal-water, or a syrupy sweet soft drink?"C. "Should there be a school dress code?"D. "Do you prefer bringing a healthy lunch to school or eating cafeteria food?" A rectangle plot of land is 0.4 kilometres long and 0.07 kilometres wide. What is its area in square kilometres? show your reasoning. Convert the decimals to fractions, then convert your answer back to decimals Identify the line segment that is a radius. Veronica used a copy machine to make an enlargement of a triangle. The original triangle has side lengths of 6 centimeters comma 8 centimeters comma and 10 centimeters. The copy has side lengths of 7.2 centimeters comma 9.6 centimeters comma and 12 centimeters.Which scale factor did Veronica use to make the enlargement? What is the solution to 12x72 Car A travels 18 miles every 20 minutes. Car B travels 13 miles every 12 minutes. Which Statement best compares how far the two cars can travel in an hour? factor 6x^4+42x^2+12 solve for the variable b -1/2 ( b - 6 ) =6 to liftWith a pulley system, you use more rope (distance), but need less (blank) to liftthe load