How might additional information differ from the content of the song If I Had A hammer?

Answers

Answer 1

The song "If I Had a Hammer" is a classic protest song that talks about the power of unity and working together for change. Additional information could differ from the content of the song in a number of ways, depending on the nature of the information.

What is a protest song?

A protest song is a type of music that addresses social or political issues and aims to inspire or motivate change. These songs typically express strong feelings of frustration, anger, or hopelessness toward a particular issue, such as injustice, inequality, war, or oppression. The lyrics of a protest song often contain powerful messages that challenge the status quo or call for action, and they may be accompanied by a simple melody or a more complex arrangement. Protest songs have been an integral part of social movements throughout history, as they can help to raise awareness, mobilize people, and provide a voice for those who are marginalized or oppressed.

The song "If I Had a Hammer" is a classic protest song that expresses the desire for social justice and equality. Additional information about the issues it addresses might include historical context, specific events or movements that inspired the song, or details about the songwriter's personal experiences or motivations.

For example, "If I Had a Hammer" was written by Pete Seeger and Lee Hays in 1949 as an anthem for the progressive movement. The song was first performed by the folk group The Weavers and became an instant hit, inspiring countless people to join the fight for civil rights and social justice. The lyrics of the song touch on various themes, such as the struggle for workers' rights, the fight against racism and segregation, and the desire for peace and equality.

Additional information could also provide insight into how the song was received by different groups or communities. For instance, the song was initially banned by some radio stations due to its perceived leftist message, but it later became an iconic song of the civil rights movement and was embraced by activists and protesters across the country.

Therefore, additional information about "If I Had a Hammer" could deepen our understanding of the historical and social context in which the song was written, as well as its impact on the civil rights and progressive movements of the time.

To learn more about protest songs click here

https://brainly.com/question/8057595

#SPJ1


Related Questions

Ayudaaa

How would narration enhance a documentary about the Apache people? What type of facts might a narrator use?

Answers

Although we do not know the narrator's identity in Apache Service, we may infer that he is male based on the timbre of his voice. In the narrative "The Medicine Bag," in contrast to Apache Service.

We know a lot about the narrator because Martin is the one who is telling the story. The Apaches were nomads who relied nearly entirely on buffalo for food, which is the kind of thing a storyteller would utilize.

When they travelled with the herds, they loaded dogs with their tents, which were made of oiled and tanned hides. They also clothed in buffalo skins. After the Pueblos, they were among the first Indians to learn how to ride a horse.

Learn more about Apache Visit: brainly.com/question/30782194

#SPJ4

A paragraph about Martin Luther King Jr

Answers

Answer:

Martin Luther King Jr. (January 15 1929-April 4, 1968) Brief Summary (of who MLK Jr. is): Martin Luther King Jr. was a Baptist minister and an activist who led the civil rights movement in the 1950. He was a fundamental force behind the civil rights movement that ended legal segregation. He was awarded the Nobel Peace Prize in 1964.

Explanation:

Answer:

As the leader of the nonviolent Civil Rights Movement of the 1950s and 1960s, Martin Luther King Jr. traversed the country in his quest for freedom. His involvement in the movement began during the bus boycotts of 1955 and was ended by an assassin's bullet in 1968.

Explanation:

Formal debates include:
A variety of ________________________
Set _________________________ and guidelines
(types, rules)

Answers

Among Formal debates are:-

Forms and structures that vary

Make rules and regulations.

What rules apply to drafting debates?

In a debate, the opening remarks, the issue, the proposed solution, and the conclusion should all be included. Let's discuss each in more detail. The introduction contains the salutations as well as the issue (including whether the motion is FOR or AGAINST). Best wishes for the day, for instance.

Which four factors constitute a debate?

Claim, reason, support, and warrant are the four main parts of an argument that can be broken down. Claims are declarations about what is real, right, or appropriate, or about what must be done or held to be true.

To know more about formal debate, visit:

https://brainly.com/question/3760048

#SPJ1

The author says that "some have already
given her the title of 'the white slave of the North."
Based on this text, do you feel that this title was
warranted?
Take notes on your discussion below.

Answers

The worker described in "A Week in the Mill" is employed in the North, specifically in Lowell, Massachusetts.Based on the text, it appears that the author does not feel that the title of "the white slave of the North" is warranted.

How to convey the information

The author acknowledges that the work is laborious, but also notes that there are "sunny spots and cheerful intervals" which make the work more pleasant.

Additionally, the author suggests that the worker's situation is not as extreme as some have portrayed it to be. Therefore, it seems that the author is presenting a more nuanced view of the worker's employment than the extreme characterizations presented by others.

Learn more about author on:

https://brainly.com/question/12851463

#SPJ1

Which sentence accurately uses the homophones "they're," "there," or "their"?
Many of the students left there backpacks on the bus.
• They're going to come home as soon as the movie is over. is
think left the bags of groceries on the floor over their.
These dogs bark at everyone, but there not dangerous at all.

Answers

The sentence that accurately uses the homophones  is They’re going to come home as soon as the movie is over.

What are Homophones?

A term that has the same pronunciation as another word is said to be a homophone.

Although they may differ in spelling and have distinct meanings, we can clearly see that the homophone is employed correctly in the second option.

Homophones are groups of words that share the same sound but differ significantly in spelling and meaning. Knowing homophones is crucial for spelling and vocabulary development when learning the English language.

Therefore, The sentence that accurately uses the homophones  is They’re going to come home as soon as the movie is over.

To learn more about Homophones, refer to the link:

https://brainly.com/question/30090104

#SPJ1

From Street Vendor to Celebrity

Artist Jean-Michel Basquiat was a high-school dropdut who became a famous neo-expressionist painter. Basquiat went
from street vendor to a highly acclaimed international artist. He became the youngest artist ever to show his work at
the Kestner-Gesellschaft Gallery in Hanover, Germany.

Which of the following is the best summary of these details?

Answers

The best summary of these details is B Jean-Michel Basquiat became a famous artist who started out as a street vendor. He was the youngest artist to show his work at a gallery in Germany. is the best summary of these details.

What is the summary about?

After dropping out of high school, artist Jean-Michel Basquiat went on to become a well-known neo-expressionist painter. From being a street vendor, Basquiat developed into a widely respected international artist. At the Kestner-Gesellschaft Gallery in Hanover, Germany, he debuted as the gallery's newest artist.

Before becoming a well-known artist, Jean-Michel Basquiat worked as a street vendor. He was the youngest artist to exhibit in a German gallery. is the most accurate summary of these facts.

Learn more about summary on:

https://brainly.com/question/24858866

#SPJ1

What does vere, tanty and his grandfather do on saturdays

Answers

Vere used to spent time at his dilapidated Dead End home with Tanty and his grandfather. However, Vere's mother, big-hearted Tanty, bold, tenacious June, and pudgy Kim, all desert him when he is a little boy in The Boy from Willow Bend.

What is the main idea of The Boy from Willow Bend?

Vere is the protagonist of The Boy from Willow Bend by Joanne C. Hillhouse, who grows up in a dark alley on the Caribbean island of Antigua. It is the tale of Vere, a little Antiguan boy with an unbreakable spirit who grows up in a world of hardship, grief, and poverty.

The women in his life—his absent mother, patient Tanty, rebellious June, early crushes on Kim and Makeba, and first friend Elizabeth—as well as his harsh grandfather and others, mold him. Yet ultimately, he develops into his own person: intelligent, talented, and a survivor. Hence the central idea of the narrative is Vere's change to young adulthood unharmed despite the hardships that have shaped him.

To learn more about central idea, visit:

https://brainly.com/question/8282081

#SPJ1

Over time, Lizabeth realizes that Miss Lottie planted the marigolds in order to...

add beauty to her life.

gift them to her neighbors.

sell them and make money.

teach the children how to garden

Answers

This question is from  story Marigolds, By Eugenia W. Collier, the correct option is A, Over time, Lizabeth realizes that Miss Lottie planted the marigolds in order to add beauty to her life.

In Eugenia Collier's short story "Marigolds," Lizabeth comes to understand as an adult that the terrible event in which she damaged Miss Lottie's marigolds caused her to lose her innocence and teach her compassion. In spite of her circumstances, Miss Lottie was able to find hope in the marigolds, and as an adult, Lizabeth has come to appreciate the value of such uplifting areas of beauty.

In "Marigolds," Lizabeth learns as an adult that her childhood and innocence ended the minute she destroyed those marigolds.

She didn't have to admit she had done wrong or explain why her acts had been so harsh because she was an adult.

To learn more about Marigolds, By Eugenia W. Collier from given link

https://brainly.com/question/24715194

#SPJ1

Complete question -

This question is from story Marigolds, By Eugenia W. Collier.

Over time, Lizabeth realizes that Miss Lottie planted the marigolds in order to...

add beauty to her life.

gift them to her neighbors.

sell them and make money.

teach the children how to garden

In The tragedy of Romeo and Juliet act I scene v p396 line 138-141. What is the effect of Julieta use of juxtaposition in this speech? How does it tie into Shakespearean use of prose vs verse and his use of oxymoron?

Answers

Shakespeare occasionally employed prose rather than poetry to give his characters more depth and to change the piece's general rhythmic framework.

Provide some examples of how Shakespeare used verse and prose in his plays?

Shakespeare frequently varies between prose and verse in his plays, with lower class characters typically speaking in prose and upper class characters generally speaking in verse. However, characters frequently speak in both forms, occasionally changing in the middle of a sentence.

Shakespeare uses both prose and verse for what purpose?

Shakespeare alternated between writing in prose and verse to change the meter of his plays and give his characters more dimension. But don't be fooled—he treats prose just as skillfully as he does verse.

To know more about Shakespearean visit:-

https://brainly.com/question/10258826

#SPJ1

(Of mice and men, chapter 5)
why does lennie panic, and what happens as a result of his panic? how is this similar to an event earlier in the story

Answers

Explanation:

In Chapter 5 of "Of Mice and Men," Lennie is in the barn alone, petting his puppy, when he accidentally kills it by petting it too hard. When he realizes what he has done, he becomes panicked and afraid of what George will say and do when he finds out. Lennie's fear and panic lead him to try to hide the dead puppy in the hay.

As a result of his panic, Lennie's mental state becomes increasingly unstable, and he begins to hallucinate. He sees a vision of his Aunt Clara scolding him for his behavior and telling him that he will never get to tend the rabbits on their dream farm. Lennie becomes agitated and upset, and he begins to cry out for George.

This event is similar to an earlier one in the story where Lennie becomes scared and panics after accidentally killing Curley's wife. In both instances, Lennie's lack of understanding of his own strength and the consequences of his actions lead to tragic results. His fear and panic also cause him to act irrationally, leading to further problems.

how to re-write the sentence" finally well rested the chores didn't seem so overwhelming." ?

Answers

As you receive sentence completion questions, you must substitute the missing word(s) from the reading text with an appropriate word(s).

Do you understand by "overwhelmed" happy or sad?

Events that are overwhelming cause people to get anxious and stressed out because they are so intense and difficult to handle. Overwhelming obstacles are challenging to overcome. You're likely to chuckle if you have an intense need to do so. You'll undoubtedly cry if you're experiencing severe sadness.

When is overwhelming appropriate?

To stress that one amount or quantity is significantly larger than in other amounts or quantities, you can use the word overpowering. Small enterprises fail in their first twenty-four months in a resounding majority. The party won the general election with a resounding victory.

To know more about overwhelming visit:

https://brainly.com/question/11532077

#SPJ1

Write 4 or more sentences describing specific learning from these notes. This section is important for your grade. Make sure to write out a thoughtful reflection in which you are considering the impact of all the information together. In other words, when you think of everything you learned from this video, what conclusion can you draw? You must write in complete sentences here

Answers

Reflection allows you to consider how your personal experiences and observations influence your thinking and acceptance of new ideas. Students are frequently asked to write reading reflections by their professors.

They do this to encourage you to think about your own ideas about a text and express your own thoughts rather than summarising the views of others. Because it requires you to express what you think, as well as how and why you think it, reflective writing can help you improve your analytical skills.

Furthermore, reflective analysis requires you to acknowledge that your assumptions and preconceived ideas shape your thoughts; by doing so, you can appreciate the ideas of others and notice how their assumptions and preconceived ideas may have shaped their thoughts.

To know more about reflective writing:

https://brainly.com/question/5012638

#SPJ4

THIS IS FOR ECONOMICS
A price change will only change _____________________________, it won’t shift the demand curve.

Answers

A price change will only change movement along the demand curve, it won’t shift the demand curve.

Only factors other than price adjustments can create changes in the supply and demand curves. Just a movement along the supply or demand curve results from price changes. This is due to the fact that consumers will simply desire fewer products at higher price points, which causes us to move down the demand curve to a lower level of quantity.

Changes in tastes, population, income, the cost of substitute or complementary goods, and expectations regarding future conditions and prices are just a few of the variables that can cause the demand curve for goods and services to shift, resulting in a different quantity being demanded at any given price.

If the determinant lowers demand, the demand curve moves to the left. Less demand for the good or service results from this. When there is a recession, it occurs when buyer incomes decline. Even though everything is priced the same, they will purchase less of everything.

To learn more about demand curve from given link

https://brainly.com/question/1139186

#SPJ1

what are the stages of growth in a butterfly? (5 points)

Answers

The stages of growth in a butterfly, also known as metamorphosis, include four distinct stages:

Egg: The butterfly begins its life as an egg, which is typically laid on the leaves of a host plant.

Larva (Caterpillar): Once the egg hatches, the butterfly enters the larval stage, also known as the caterpillar stage. During this stage, the caterpillar eats and grows, shedding its skin several times as it becomes larger.

Pupa (Chrysalis): After the caterpillar reaches its full size, it forms a pupa or chrysalis, in which it undergoes a remarkable transformation into an adult butterfly. Inside the pupa, the caterpillar's body breaks down and reorganizes into the butterfly's adult form.

Adult: Finally, the fully-formed butterfly emerges from the chrysalis and takes its first flight. The adult stage is the reproductive stage of the butterfly's life, during which it seeks out a mate and lays eggs to begin the next generation.

Answer:

Explanation: there a picture of how a growth of butterfly

What lizard can I put in with my corn snake. So that they can live together.

The cage is 75 gallons.

Pls help giving the rest of my points away.

Answers

Answer:

It is not recommended to house lizards and snakes together, as they have different temperature and humidity requirements, and may even pose a danger to each other. Even if the cage is large enough, it is not advisable to house them together. It is best to provide separate habitats for each species.

Explanation:

Explanation:

It is not recommended to keep lizards and snakes together in the same enclosure, even if the cage is large enough to accommodate both. There are several reasons for this.

Firstly, snakes are natural predators and may see the lizard as prey. Even if the snake is not hungry, it may still attack the lizard out of instinct.

Secondly, lizards and snakes have different environmental and dietary requirements. Snakes are carnivorous and require a diet of rodents, while lizards are omnivorous or herbivorous and require a different diet. Additionally, snakes require specific temperature and humidity levels to thrive, which may not be suitable for the lizard.

Finally, keeping two different species together in the same cage increases the risk of disease transmission, stress, and aggression.

Therefore, it is best to keep your corn snake in its own enclosure without any other species. This will ensure the safety and well-being of your snake and prevent any potential harm to other animals.

Use adventurously(Adverb) in a sentence

Answers

Answer:

Michael adventurously climbed the rugged mountainside.

Explanation:

Question
How does the section “Tigers in the Grass” add to the reader's understanding of the text?
Responses

by showing that humans are often afraid of things that are not real


by describing different myths about unexplained happenings


by telling how scientists think through difficult problems


by giving an example that shows why humans look for patterns

Answers

Responses by showing that humans are often afraid of things that are not real by describing different myths about unexplained happenings  by telling how scientists think through difficult problems.

How does the section “Tigers in the Grass” add to the reader's understanding of the text?

By providing a case study that demonstrates why people look for patterns, the section "Tigers in the Grass" enhances the reader's comprehension of the text. The author discusses how the tendency of the human brain to detect patterns even when none may exist can occasionally result in erroneous assumptions and misunderstandings. The author illustrates how this pattern-finding propensity can result in a survival advantage in some circumstances but can also lead to unwarranted fear and anxiety in others by using the metaphor of tigers in the grass. Overall, the section contributes to the text's main theme—the significance of critical thinking and evidence-based reasoning—by providing an example of how to understand the world around us.

To Know more about Tigers Visit:

brainly.com/question/30328028

#SPJ1

Where might one look to find more information about the song If I had A Hammer and its content?

Answers

"If I Had a Hammer" is a popular folk song written by Pete Seeger and Lee Hays. The song was first recorded by The Weavers, a folk music quartet composed of Seeger, Hays, Ronnie Gilbert, and Fred Hellerman, in 1950.

What is a folk song?

A folk song is a traditional song that has been passed down from generation to generation through oral tradition. These songs typically reflect the cultural and historical values, customs, and traditions of a particular group of people, such as a specific region, ethnic group, or community.

Folk songs are often characterized by simple melodies, straightforward lyrics, and repetitive patterns, which make them easy to remember and sing. They are typically performed with acoustic instruments, such as guitar, banjo, or fiddle, and often involve group singing or audience participation.

If you are looking for more information about the song and its content, you can start by searching for resources online. Some good places to start include:

1. Song lyrics websites such as AZLyrics or Genius, provide the lyrics to the song and often include annotations and interpretations.

2. Music streaming platforms which may have multiple versions of the song and related videos, including live performances and covers.

3. Biographical books about Pete Seeger, Lee Hays, or The Weavers, may include information about the song's creation and the context in which it was written.

4. Folk music archives and libraries, such as the Woody Guthrie Center or the Library of Congress's American Folklife Center, may have recordings, sheet music, and other resources related to the song.

5. Online forums and discussion groups devoted to folk music or music history, where you can ask questions and get insights from other enthusiasts.

Therefore,  there are many resources available to learn more about "If I Had a Hammer" and its significance in the history of American folk music.

To learn more about folk songs click here

https://brainly.com/question/24539969

#SPJ1

PLEASE PLEASE PLEASE PLEASE HELP ME
Choose one chapter and pick 5 vocabulary words to illustrate, 3 important sentences, 1 personal reaction a reflection. From
El capibara con botas

Answers

Explanation:

Chapter: Chapter 5 - El Cumpleaños

5 Vocabulary Words:

Postergar: To postpone

Fingir: To pretend

Desagradable: Unpleasant

Ansioso: Anxious

Enfadado: Angry

3 Important Sentences:

El cumpleaños del Capibara con Botas era un acontecimiento importante que habían estado planeando por semanas. (The Capybara with Boots' birthday was an important event that they had been planning for weeks.)

La Cebra, que fingía estar enferma, finalmente admitió que simplemente no quería asistir a la fiesta. (The Zebra, who pretended to be sick, finally admitted that she simply didn't want to attend the party.)

El Capibara con Botas estaba enfadado y desagradable con todos los que habían llegado tarde. (The Capybara with Boots was angry and unpleasant with everyone who arrived late.)

1 Personal Reaction and Reflection: I found this chapter to be a fun and entertaining read. The author did a great job of creating a lively and vivid world that was full of interesting and memorable characters. The use of vocabulary words such as "postergar" and "desagradable" added depth and complexity to the story, making it both enjoyable and educational. I also appreciated the author's use of humor and irony throughout the chapter, which made the story more engaging and memorable. Overall, I would highly recommend this book to anyone looking for an enjoyable and entertaining read.

2 / 2

Which example has the correct part of the verb?
Betty picking blueberries.
Betty picked blueberries.
Betty pick blueberries.

Answers

Answer:picking

Explanation:because a verb is something you do

Picking or picked I believe

Sample Writing Prompt from: Georgia Milestones American Literature and Composition EOC Assessment Guide

Before you begin writing your essay, you will read two passages. As you read these passages, think about details you may use in an argumentative essay about cultural treasures being held in museums

Answers

Explanation:

Passage 1: "Cultural treasures, whether they be ancient artifacts or contemporary art pieces, are an important part of our human history and heritage. Museums provide a space for these treasures to be preserved, studied, and appreciated by people from all over the world. However, there is a growing movement to repatriate cultural treasures to their countries of origin, arguing that these treasures belong to the people who created them and that they have been wrongfully taken and held in museums."

Passage 2: "While it is true that some cultural treasures may have been obtained through theft or colonialism, many were acquired through legitimate means such as donations, purchases, or excavations. Repatriating all cultural treasures to their countries of origin would be a complex and difficult process, and it could potentially lead to the loss or destruction of these treasures. Museums are often better equipped to protect and preserve these artifacts than their countries of origin."

Argumentative Essay: The debate over whether cultural treasures should be repatriated to their countries of origin or held in museums is a complex and multifaceted issue. While it is true that some treasures may have been obtained through theft or colonialism, many have been acquired through legitimate means and are better protected in museums.

One of the main arguments for repatriation is that cultural treasures belong to the people who created them and that they have been wrongfully taken and held in museums. While this argument has some merit, it overlooks the fact that many treasures were obtained through legitimate means such as donations, purchases, or excavations. Repatriating these treasures could lead to the loss or destruction of the artifacts, as their countries of origin may not have the resources or expertise to properly preserve them.

Furthermore, museums provide a space for cultural treasures to be studied and appreciated by people from all over the world. Museums are often better equipped to protect and preserve these artifacts than their countries of origin, as they have specialized facilities and trained professionals to ensure their longevity. Additionally, museums provide a platform for cultural exchange, allowing people to learn about different cultures and histories.

In conclusion, while repatriation of cultural treasures may seem like a noble cause, it is important to consider the complexities and potential consequences of such actions. Museums provide a valuable service in preserving and protecting cultural treasures for future generations to appreciate and learn from. Rather than focusing on repatriation, efforts should be made to ensure that these treasures are obtained through legitimate means and protected in museums where they can be properly preserved and shared with the world.

What issues, problems, or events are presented in the song if I had A hammer? Does this song suggest any solutions to the issues or problems addressed?

Answers

The song's purpose was to promote social and political change, specifically in regards to civil rights and equality. The lyrics focus on the power of love, unity, and collective action to create a better world. The hammer in the song represents the power of the people to create change through their actions.

Solutions suggestion in the song are; It suggests that if people work together they can overcome oppression, inequality, and injustice.

Please help me

Which sentences are written in passive voice?

Answers

Answer:

the 2nd one and the 4th one

**ANSWER FAST 100 POINTS**

Which of the following statements is not true about the difference between paraphrasing and summarizing a text?

A paraphrase contains new ideas from the author; a summary is a breaking down of a text to its essential ideas.

A paraphrase is a shorter than the original text; a summary is the same length as the original text.

A paraphrase is the same length as the original text; a summary is shorter than the original text.

A paraphrase restates the author's words; a summary expresses the central idea of a text.

Answers

Answer:

The second one is not true

Explanation:

Coca vocals……………………and alll the Rea

The volume of a cylinder is 72pie cubic feet and the radius is 6 feet. What is the height of the cylinder

Answers

Answer:0.64 ft

Explanation: hopes this helps

Read through the following sentence locate the errors and correct them so as to have the verb agree with the subject



she get very nervous every time she sees a needle​

Answers

Answer: Can you elaborate this answer?

Explanation:

A customer has a history of non-payment of monthly utility bills. The customer applies for credit. Which response should the customer expect from the lender?
O Denial of a line of credit
O Extension of a higher credit limit
Award of an increased credit score
O Offer of a large loan

Answers

The customer with a history of non-payment of monthly utility bills should expect the denial of a line of credit from the lender.

Non-payment of monthly utility bills is an indication of a low credit score, which indicates a higher risk of defaulting on loan payments. Lenders typically avoid extending credit to individuals with a history of non-payment or late payments, as they are considered high-risk borrowers. Hence, it is unlikely that the lender will approve the customer's application for credit, and if approved, the credit limit may be lower than what the customer expects.

Answer:

A. Denial of a line of credit

Explanation:

A customer who has a history of non-payment of monthly utility bills should expect a denial of a line of credit from the lender. Non-payment of bills indicates a poor credit history, which is a significant factor that lenders consider when determining a borrower's creditworthiness. If the lender perceives the customer as high risk, they are less likely to extend a line of credit or offer a large loan. Therefore, option A is the correct response the customer should expect.

Write the sentence in indirect speech

Tanaka replied " I have been to the UK before"

Answers

Tanaka replied that she have been to the UK before is the correct answer for Indirect speech.

What is Indirect Speech?

Instead of delivering the exact words that were said or written, indirect speech reports what was said or written.

It is used in numerous UN papers, such as executive summaries and reports on international body proceedings. Quotes are not used around indirect speech.

There are various adjustments that must be made when switching from direct, or quoted, speech to indirect, or reported, speech. Initially, a major clause or reporting clause must be included. This clause must have a verb of talking, thinking, or reporting in the past tense.

Therefore, Tanaka replied that she have been to the UK before is the correct answer for Indirect speech.

To learn more about Indirect speech, refer to the link:

https://brainly.com/question/14319113

#SPJ1

What word would best characterize how Gary Soto felt about his sixth grade year?

Answers

Answer:

Who is Gary soto???????????



Which sentence contains a misspelled word?

A. The principal of the school is holding an assembly this week.

B. In principle, the government is supposed to answer to the people.

C. We try to live by the principal of thinking before we act.

D. To me, the most important principle is to be kind to others.

Please help quickly !!!!!

Answers

Answer: I think it’s option B.

Explanation: I think he used the word “principle” for schools instead of using “principal” for things like a rule or given thing to do.

Other Questions
A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen A 17-year-old Senior High School student visited the clinic for consultation with history of 4-day diarrhea, inappetence, mild abdominal pain, and fatigue, after spending the weekend in their province. Stool samples were collected and placed in 10% formalin and Zn-PVA fecal preservatives and were sent to the laboratory for analysis. Photomicrographs below show organisms seen by the Medical Technologist in a trichrome-stained slide of the Zn-PVA sample. He also mentioned that the organisms' size ranges from 12-26m. What is your diagnosis? Based on what criteria? What further testing, if any, would you recommend? What statement describes the cause for sibling rivalry between both brothers? The windpipe is properly called the At its lower end it divides into right and left into progressively smaller The aveolar ducts of the lungs terminate in structures called whose walls are composed of A true breeding pink flowered petunia plant is crossed with a true breeding white petunia plant, and the F1s have purple flowers. The F1 is selfed, and F2 plants are obtained. Of the 80 F2s, 53 have pink flowers, and 27 have white flowers. If the phenotypic difference is due to two alleles of one gene, what ratio of purple to white flowered plants do you expect in the F2?Using the chi-squared test, determine if the results in the F2 generation support the hypothesis that the phenotypic difference is due to two alleles in one gene. Explain your answer with math.