How does Wade's interaction with Art3mis show him to be suffering from the effects of social isolation? Provide an example and explain it.

Answers

Answer 1

Wade Watts, the protagonist of Ernest Cline's novel "Ready Player One," spends most of his time alone in the virtual world of the OASIS, where he can escape from the harsh reality of his impoverished and isolated life. Despite his extensive knowledge of pop culture and video games, Wade lacks social skills and struggles to form meaningful relationships.

Wade's interaction with Art3mis, a fellow "gunter" and virtual friend, reveals his social isolation and its effects on his behavior. When Wade first meets Art3mis, he is immediately drawn to her intelligence, wit, and shared interests. However, as their relationship progresses, Wade begins to display possessive and jealous behavior that ultimately pushes Art3mis away.

For example, when Art3mis reveals that she is searching for the Easter Egg in order to prevent IOI, a powerful corporation, from gaining control of the OASIS, Wade becomes overly protective of her and insists on helping her. He also becomes jealous of her relationship with another gunter named Shoto and tries to sabotage their partnership.

This behavior can be attributed to Wade's social isolation and lack of experience with forming healthy relationships. He has spent so much time alone in the OASIS that he has developed a sense of ownership over his virtual friends and sees them as a replacement for real-life relationships. He struggles to understand and respect Art3mis' autonomy and sees her as a possession rather than a person with her own goals and desires.

In conclusion, Wade's interaction with Art3mis in "Ready Player One" highlights the negative effects of social isolation on his ability to form healthy relationships. His possessive and jealous behavior is a result of his lack of experience and understanding of social dynamics, and it ultimately pushes Art3mis away. This example serves as a cautionary tale about the dangers of relying too heavily on virtual relationships to the detriment of real-life connections.

-chatGTP

hope this helps :)


Related Questions

In A Change of Plan this paragraph, “huffed” means A inhaled B fumed C exhaled D giggled

Answers

Answer:

exhaled

Explanation:

In the story of the three little pigs, the wolf will "huff and huff and blow their house down" so, to huff means to blow air

which of the following are appropriate strategies for titling a speech? multiple select question. be figurative and provocative be deceptive and puzzling be question-based be straightforward and descriptive

Answers

The appropriate strategies for titling a speech are as follows: be figurative and provocative ,be question-based be straightforward and descriptive. Titling a speech is an essential aspect of creating a compelling and engaging speech that grabs the attention of the audience.

The title of a speech plays a crucial role in captivating the attention of the audience. The following are appropriate strategies for titling a speech:1. Be figurative and provocative, The title should be figurative and provocative to grab the audience's attention. A provocative and eye-catching title will draw the attention of the audience and make them more attentive to the speech.

2. Be question-based, The title should be based on a question. A question-based title is compelling and encourages the audience to think critically about the topic.3. Be straightforward and descriptiveThe title should be straightforward and descriptive. A descriptive title clearly indicates the topic and the purpose of the speech, making it easier for the audience to understand the speech's focus.

In conclusion, the appropriate strategies for titling a speech are to be figurative and provocative, question-based, and straightforward and descriptive.

know more about descriptive title here

https://brainly.com/question/14758125#

#SPJ11

Answer: -Be question-based -Be figurative and provocative -Be straightforward and descriptive

In Act I, Scene 5, Lines 113-120, Romeo says

I fear too early, for my mind misgives

Some consequence yet hanging in the stars

Shall bitterly begin his fearful date

With this night’s revels, and expire the term

Of a despisèd life closed in my breast

By some vile forfeit of untimely death.

But he that hath the steerage of my course

Direct my sail.



What does this statement reveal about Romeo?

Group of answer choices

He believes his fate is out of his control.

He believes he is in charge of his own destiny.

He does not believe in fate or destiny.

He does not believe in omens or premonitions.

Answers

Answer:

This statement reveals that Romeo believes in fate and that he believes his fate is out of his control. He expresses fear that something negative, predetermined by the stars, will occur as a result of the night's events. He also hopes for guidance and direction in his life, suggesting that he believes someone or something else is in control of his course.

6
The life expectancy in Hong Kong is 85.29 and in the United States is 79.11. What does this data suggest about Hong Kong?

A.
Hong Kong has a lower birth rate than the United States.

B.
The lifestyle in Hong Kong is healthier than that of the United States.

C.
The United States has a similar culture to Hong Kong.

D.
There are fewer people living in Hong Kong than the United States.

Answers

Option A is correct. A baby born in Hong Kong in 2020 can anticipate living to be 85.4 years old, according to the most recent World Bank data.

Men and women can anticipate living till 83 and 88, respectively. Since 1997, the average life expectancy for both sexes has increased by over five years. Hong Kong's life expectancy has steadily increased over the past 50 years, reaching 81.9 years for men and 87.6 years for women. This is due to fewer diseases of poverty and the suppression of diseases of affluence. Hong Kong's life expectancy is the highest in the world. This is due to its extremely quick post-World War II economic development and the epidemiological transition from communicable to noncommunicable diseases as the leading causes of death.

Learn more about recent here-

https://brainly.com/question/1257186

#SPJ1

in case the potion doesn’t work, what item does juliet keep with her in the bed?

Answers

Juliet keeps a knife with her in the bed in case the potion does not work. She worries that the  might be poison, but she chooses to put her trust in Friar Lawrence.

List three things that Juliet believes could go wrong if she drinks the potion. She fears that the poison could kill her and that Friar Lawrence may have compounded it specifically to do so. She worries that it won't work and that when she wakes up the following morning, she will have to marry Paris. Scene 3 of Act 4. Knowing how awful it will be to awaken in her family's tomb, Juliet sends the nurse away and swallows the pill, deciding that it's now or never. She has a backup plan in the form of her blade in case the concoction fails.

To know more about Juliet refer :

brainly.com/question/30459348

#SPJ4

in the grey evening
i see a long green serpent
with it's tail in the dahlias.

it lies in loops across the grass
and drinks softly at the faucet.

i can hear it swallow.

-Beatrice Jonosco
1. What object is the poem describing?______________

Answers

This poem is describing a garden hose
I believe the poem is describing a garden hose.

PLEASE HELP!!!!
Explain what stage of rebellion Finbar Flynn from "Gren's Ghost" is in based on
the information in the article "Rebel with a Cause."

Answers

Two normal kinds of resistance are against socially fitting in and against grown-up power (disobedience of rebelliousness). In both cases, rebellion offends adults to get their attention.

Finbar Flynn from "Gren's Ghost" Theme :

It's critical not to judge others based on how you first perceive them. Without realizing it, children can be cruel to their classmates. You can increase your acceptance by changing who you are.

How does Finn's perspective on green shift throughout the narrative?

At the end of the story, Finn decides to change who he is to be tough like Green because he is intimidated by Green at the beginning. Finn sees Green as a companion in the start of the story, yet ultimately acknowledges Gren will not be companions with him freely.

Learn more about Rebel with a cause :

brainly.com/question/26925709

#SPJ1

what is the equation to calculate distance ​

Answers

The equation to calculate distance is:

distance = speed × time

This equation is also known as the distance formula, and it is used to calculate the distance traveled by an object in a given amount of time. In this equation, speed is the rate at which the object is traveling, measured in units such as miles per hour (mph) or kilometers per hour (km/h), and time is the duration of the travel, measured in units such as hours or seconds. When speed and time are multiplied together, the result is the distance traveled by the object.

It's important to note that this equation only applies to situations where the speed of the object is constant over the entire duration of the travel. If the speed of the object changes during the travel, the distance traveled would need to be calculated using more complex equations.

answer

distance = speed x time

d = s * t

steps

Distance Formula Equation.

1. The equation to calculate distance is

a way to figure out how far apart two

things are from each other.

2. The equation is: distance = speed x

time.

3. This formula is called the distance

formula.

4. To use the formula, you need to know

the speed and the time it takes to

travel.

5. For example, if you are traveling at a

speed of 60 miles per hour for 2

hours, the distance you would have

covered is 120 miles.

6. A real-world example of this formula

is calculating the distance you need to

travel to get to your friend's house,

based on the speed you're driving and

how long it will take you to get there

ChatGPT

The last sentence of "The Moral Logic of Survivor Guilt" states:

“And so, what duties to others need to make room for, even in a soldier’s life of service and sacrifice, are duties to self, of self-forgiveness and self-empathy. These are a part of full moral repair.”

Use the Timed Writing Tips for an argumentative essay (see Conventions section above) to guide you in the following writing task:

Write a 3-paragraph essay of at least 300 words that states your opinion on the quote.
Do you agree? Why or why not?
Make sure and cite from the text to support your ideas.
Be sure to briefly address a possible counterclaim, choosing where to work this in carefully.

Answers

The quote, "And so, what duties to others need to make room for, even in a soldier’s life of service and sacrifice, are duties to self, of self-forgiveness and self-empathy. These are a part of full moral repair," from "The Moral Logic of Survivor Guilt" raises an important issue about the responsibilities of soldiers towards themselves. In my opinion, I agree with the author's statement that soldiers have a duty to themselves to practice self-forgiveness and self-empathy.

The life of a soldier is not easy, and they are often subjected to trauma and stress that can cause them to feel guilty or ashamed about things they did or did not do. The author argues that it is essential for soldiers to practice self-forgiveness and self-empathy as a part of full moral repair. This is because a soldier who is unable to forgive themselves or empathize with their own struggles is likely to suffer from mental health issues, such as depression and PTSD, which can ultimately affect their ability to serve.

One possible counterargument is that soldiers are supposed to be selfless and put others first, so prioritizing their own needs is selfish. However, I believe that this counterargument ignores the fact that soldiers are human beings with emotions and needs, just like everyone else. Soldiers cannot effectively serve others if they are not taking care of themselves first. Self-forgiveness and self-empathy are important parts of the healing process for soldiers, and by taking care of themselves, they can become better equipped to serve others.

In conclusion, I agree with the author's statement that soldiers have a duty to themselves to practice self-forgiveness and self-empathy. Soldiers are human beings who deserve to take care of their own needs, and prioritizing their own well-being is not a selfish act. By taking care of themselves, soldiers can become better equipped to serve others and fulfill their duties as soldiers.

Find the error with subject-verb agreement. Select the incorrect verb and type it correctly.
The
jar
of
marbles
are
on
the
top
shelf
between
the
crafts
box
and
the
dominoes
You'll
need
a
stepladder
to
reach
it

Answers

Answer:the jar of marbles IS on the shelf

Explanation: are is incorrect the correct linking verb is, is

how does the writer support his idea that when the human brain the body is finished the soul the spiritual emotional part is not

Answers

The writer supports his idea that when the human brain and body are finished, the soul, the spiritual emotional part is not by using metaphors and imagery in the text. When the human brain and body are finished, the soul, the spiritual emotional part is not.

The writer uses metaphors and imagery in the text to support this idea. In the text, the writer suggests that the human brain is like a machine that functions as long as it is supplied with energy. In contrast, the soul is viewed as something that is independent of the brain and can continue to exist even after the body has expired.

Furthermore, the writer suggests that the soul is like a bright flame that will continue to burn after the fuel that feeds it is consumed. The writer's use of metaphors and imagery in the text serves to reinforce the idea that the human brain and body are not the same as the soul. The metaphors of a machine and a flame serve to create a distinction between the physical and the spiritual aspects of human existence.

know more about metaphors here

https://brainly.com/question/13020675#

#SPJ11

PLSS! HELP! I WILL MARK BRAINIEST! :D (WORTH 180 PTS)

adapted from Todd
by Mia Hopkins


There was once a child named Todd,
who had many posters in his room.
All of them had planets and galaxies,
along with constellations from outer space.
5 And in his room was a small telescope.
He used it to watch the stars at night.

He was watching the news one day,
sitting with his dad, right in front of the TV.
And the newsreader made an announcement.
10 There would be men landing on the moon.
Todd's eyes widened, and he shouted with joy.
He wanted to see this live, oh boy!

He asked his dad and mom,
"Could he invite his friends over?"
15 "Can we have a viewing party?" he asked.
"Yes. Why not?" they replied.
And he spent the day thinking how it must be
to step on the moon's face.

The day had finally arrived.
20 Apollo 11 standing straight as an arrow, pointed to the sky.
Little Todd and his best friends,
sat awe in front of the TV.
They watched the astronauts board the ship.
All of this they saw on the black-and-white screen.

25 The moment had finally come.
Then the countdown began.
"Liftoff! We have a liftoff!"
The newsreader shouted with joy.
Up the rocket went,
30 And so did Todd's dreams, oh boy!

Many years later, Todd ponders upon this scene.
He remembers why he became an astronomer.
Inspired by the men who bravely stepped on the moon,
Todd worked with passion,
35 And so made his dream a reality.

By describing Todd's room, the reader can infer that —

A.
Todd was interested in astronomy as a child

B.
Todd wanted to travel in a rocket

C.
Todd liked decorating his room

D.
Todd liked to spend a lot of time in his room

Answers

Answer:

A. Todd was interested in astronomy as a child.

Explanation:

Clues shown in the passage that Todd was interested in astronomy as a child is that he had many posters in his room with planets and galaxies. He used to watch the stars at night.

Answer:

the answer is A.

Explanation:

the author implies it during the following sentences:

Line 1 - 4

"There was once a child named Todd,

who had many posters in his room.

All of them had planets and galaxies,

along with constellations from outer space."

Line 10 - 11

"There would be men landing on the moon.

Todd's eyes widened, and he shouted with joy."

Line 27 - 30

"Liftoff! We have a liftoff!"

The newsreader shouted with joy.

Up the rocket went,

And so did Todd's dreams, oh boy!

Line 33 - 35

"Inspired by the men who bravely stepped on the moon,

Todd worked with passion,

And so made his dream a reality."

according to apa format, how long should an abstract be?

Answers

No more then 250 words.

which actions should you take as you start your presentation? multiple select question. wait until the audience has quieted down to begin speaking establish eye contact with the audience before you begin speaking after reaching the podium, review your notes before speaking be sure to start speaking as soon as you reach the podium

Answers

Answer: Wait until the audience has quieted down to begin speaking

Establish eye contact with the audience before you begin speaking

Explanation:

the power of media in elections can be substantial because it can sway uncommitted voters, who often decide the election results. true/false

Answers

The statement "the power of media in elections can be substantial because it can sway uncommitted voters, who often decide the election results" is TRUE because the media have the power to influence the thinking of the public. The media can make or break political campaigns.

They can help political parties or candidates gain public trust and votes or destroy their credibility and reputation.

Media coverage is important during elections because it helps people become more aware of the candidates and their platforms. It is through the media that candidates can reach a wider audience, especially those who are undecided.

The media can also shape the narrative of the election by highlighting certain issues, framing stories in a particular way, and creating a sense of urgency or importance around a particular candidate or issue.

The media has the power to create an illusion of support or popularity for a particular candidate or party. This can influence how people perceive the election and how they decide to vote. Therefore, the media plays a critical role in elections, and their coverage can significantly impact the election results.

To know more about media refer to-

brainly.com/question/14047162#
#SPJ11

What is a claim?
a.A specific statement that you want to prove is true
b.A question that you ask the reader
c.A piece of supporting evidence stated in a simple sentence
d.A story that is told as a part of the introduction

Answers

Answer:

I think its either "a" or "c"

Writing Prompt:
Part One -
In the introduction, Judy Bernstein who helped the Sudanese boys transition to the United States, shared a bit of her observations of the boys transitioning into the American culture. Please write three sentences of how this initial transition was for the boys using details from the story. Please also write three sentences on a time where you had to become accustomed to a new area. This could be a new place, a new school, or even a new country/culture. Describe your thoughts of this transition in at least three sentences.

Part Two -
Alepho shared about how he viewed himself and what life was like in Dinkaland before having to leave. Describe how Alepho thought of himself as a young person and what home meant to him. Please write at least four sentences for this response.

Answers

Some thoughts on the transition that the  Sudanese boys go through is they struggled with learning English.

The way that Alepho thought of himself was with a sense of pride and honor for his tribe's traditions and values.

What happens with the transition of the immigrants ?

Judy Bernstein observed that the Sudanese boys had a difficult time adjusting to the American culture. They struggled with learning English, using appliances such as toasters, and with the new food. The boys were also surprised by the amount of personal space and freedom Americans have.

Alepho viewed himself as a Dinka warrior. He saw himself as strong and capable, able to protect his family and his people. Home was a sacred place for Alepho, where he felt safe and secure with his family and community.

Find out more on transitioning at https://brainly.com/question/11869813

#SPJ1

What does the quote “Thirty—the promise of a decade of loneliness, a thinning list of single men to know, a thinning brief-case of enthusiasm, thinning hair" mean?

Answers

The quote "Thirty—the promise of a decade of loneliness, a thinning list of single men to know, a thinning brief-case of enthusiasm, thinning hair" is a reflection on the experience of turning thirty years old.

The phrase "promise of a decade of loneliness" suggests that the speaker expects to feel isolated and disconnected from others during their thirties. The "thinning list of single men to know" implies that the speaker may be looking for a romantic partner and is concerned that their pool of potential candidates is shrinking as they get older.

The phrase "thinning brief-case of enthusiasm" suggests that the speaker may be feeling less passionate or energized about their work or personal pursuits. Finally, "thinning hair" is a literal reference to the physical effects of aging that may contribute to the speaker's feelings of diminishing vitality and attractiveness.

Overall, the quote expresses a sense of apprehension and resignation about the challenges of entering a new decade of life and facing the realities of aging.

how are ellen and jo still alive in season 6 of supernatural? didn't they both die to hellhounds in season 5?

Answers

No, Ellen and Jo were not killed by the hellhounds in season 5.

Instead, they faked their deaths and went into hiding, eventually joining forces with Bobby Singer to fight against the forces of evil. In season 6, they join Sam and Dean Winchester in their fight against the Leviathans. In season 6, they join Sam and Dean Winchester in their fight against the Leviathans.

In season 6, Castiel and the angelic host join Sam and Dean Winchester in their fight against the Leviathans. The angels are not powerful enough to fight them on their own, so they rely on the Winchesters to help defeat the monsters and protect humanity.

The angels provide the Winchesters with assistance and advice, as well as the occasional angelic power boost. They also enlist the help of other supernatural creatures, such as Crowley and the demon Meg, in order to gain an edge against the Leviathans. In the end, the angels and the Winchesters are able to defeat the Leviathans and restore order to the world.

To learn more about Ellen and Jo link is here

brainly.com/question/17434291

#SPJ4

Select the correct text in the passage.
Which two sentences support the claim that Americans have greater equality than people in other countries?
adapted from "What is an American?" in Letters from an American Farmer
by J. Hector St. John Crevecoeur

I wish I could be acquainted with the feelings and thoughts which must agitate the heart and present themselves to the mind of an enlightened Englishman, when he first lands on this continent. He must greatly rejoice that he lived at a time to see this fair country discovered and settled; he must necessarily feel a share of national pride, when he views the chain of settlements which embellishes these extended shores. When he says to himself, this is the work of my countrymen, who, when convulsed by factions, afflicted by a variety of miseries and wants, restless and impatient, took refuge here. They brought along with them their national genius, to which they principally owe what liberty they enjoy, and what substance they possess.

Here he sees the industry of his native country displayed in a new manner, and traces in their works the embryos of all the arts, sciences, and ingenuity which flourish in Europe.

Here he beholds fair cities, substantial villages, extensive fields, an immense country filled with decent houses, good roads, orchards, meadows, and bridges, where an hundred years ago all was wild, woody and uncultivated!

What a train of pleasing ideas this fair spectacle must suggest; it is a prospect which must inspire a good citizen with the most heartfelt pleasure.

The difficulty consists in the manner of viewing so extensive a scene.He is arrived on a new continent; a modern society offers itself to his contemplation, different from what he had hitherto seen.It is not composed, as in Europe, of great lords who possess everything and of a herd of people who have nothing. Here are no aristocratical families, no courts, no kings, no bishops, no ecclesiastical dominion, no invisible power giving to a few a very visible one; no great manufacturers employing thousands, no great refinements of luxury. The rich and the poor are not so far removed from each other as they are in Europe. Some few towns excepted, we are all tillers of the earth, from Nova Scotia to West Florida. We are a people of cultivators, scattered over an immense territory communicating with each other by means of good roads and navigable rivers, united by the silken bands of mild government, all respecting the laws, without dreading their power, because they are equitable.

We are all animated with the spirit of an industry which is unfettered and unrestrained, because each person works for himself.

If he travels through our rural districts he views not the hostile castle, and the haughty mansion, contrasted with the clay-built hut and miserable cabin, where cattle and men help to keep each other warm, and dwell in meanness, smoke, and indigence.

A pleasing uniformity of decent competence appears throughout our habitations. The meanest of our log-houses is a dry and comfortable habitation. Lawyer or merchant are the fairest titles our towns afford; that of a farmer is the only appellation of the rural inhabitants of our country.

We have no princes, for whom we toil, starve, and bleed: we are the most perfect society now existing in the world.Here man is free; as he ought to be; nor is this pleasing equality so transitory as many others are.

Many ages will not see the shores of our great lakes replenished with inland nations, nor the unknown bounds of North America entirely peopled.

Who can tell how far it extends? Who can tell the millions of men whom it will feed and contain? For no European foot has as yet travelled half the extent of this mighty continent

Answers

"There are no aristocratic families, no courts, no kings, no bishops, no ecclesiastical dominance, no unseen power granting a few a very visible one.

No huge manufacturers employing thousands, no vast refinements of luxury here. As opposed to Europe, the rich and the poor are not as apart from one another. "Since everyone works for himself, the industry is unrestricted and unbridled, and this mentality permeates us all. Our homes exhibit a nice homogeneity of acceptable competence. The meanest of our log homes is a dry and cosy residence. "We are the most ideal society currently existent in the world. We have no princes for whom we labour, suffer, and bleed.

To know more about aristocratic refer to the link below :

brainly.com/question/3098889

#SPJ1

Choose the complete verb (the helping verb and the participle) from the sentence below.

Lucille will be playing on the softball team next year.

Complete verb:
A. softball team
B. Will be playing
C. will be

Answers

The complete verb from the given sentence is option B. Will be playing.

What is a complete verb?

A complete verb is a verb that consists of a main or helping verb and any accompanying auxiliary or modal verbs, as well as the participle or infinitive that follows. A sentence requires a complete verb to express a complete thought and make grammatical sense. For instance, in the sentence "Lucille will be playing on the softball team next year," the complete verb is "will be playing," consisting of the helping verb "will" and the present participle "playing." Understanding complete verbs is crucial in writing and communicating effectively as it enables one to construct grammatically correct sentences that convey a clear meaning. By identifying the complete verb in a sentence, one can analyze the structure of the sentence and determine the appropriate tense, voice, and mood to use to convey the intended message.

To learn more about verbs, visit:

https://brainly.com/question/28632809

#SPJ1

Answer:

will be

Explanation:

Pick the option that tabulates 1-4 under the headings (1)-(2)​

Answers

The proper response is (a) I 3,4,5 (ii) 1,2. The possibility that tabulates values 1-4 underneath the headings (i)- must be chosen (ii).

I. Eco-friendly clothing (A business or clothing line that makes an effort to reduce its negative effects on the environment, the health of its customers, as well as the employment environment of its garment-makers is considered eco-fashion.)

3) Choose jackets dyed with vegetable colors rather than ones made with animal dyes.

4) Making patches from of my father's damaged pants for my carry-on luggage.

5) Buying jewelry from a store that pays its artists a minimum of 10% of their revenue in addition to their salaries.

(ii) Ethical fashion ('Ethical' fashion refers to clothing made in a setting aware of and involved in the numerous social concerns the fashion business influences.)

1) Giving wonderful sweaters I no longer fit to a nearby nonprofit.

2) Having a skirt fashioned out of a grandparent's silk saree. The proper response is therefore a) I 3,4,5 (ii) 1,2.

To know more about environment click here

brainly.com/question/30465308

#SPJ4

What is the best meaning of “shiftlessness” as it is used in the following passage on page 32?

“‘I told that boy about the ice.’ Myrtle raised her eyebrows in despair at the shiftlessness of the lower orders.
‘These people! You have to keep after them all the time.’”

A. Laziness
B. Ugliness
C. Liveliness
D. Selfishness

Answers

Answer:

Laziness

Explanation:

Answer:

The best meaning of "shiftlessness" as it is used in the following passage on page 32 is:

A. Laziness

Explanation:

The word "shiftlessness" is used to describe the lower orders or working-class people who, according to Myrtle, are lazy and need to be constantly reminded of their duties. The word suggests a lack of ambition or motivation to work hard and be productive, which is often associated with the working-class in society. Myrtle's use of the word highlights her disdain for people she perceives as beneath her social status, and her belief in the superiority of the wealthy and powerful.

In your own words one sentence

How are the Articles of Confederation and the Constitution different?

Answers

Answer:

The Articles of Confederation gave more power to individual states, while the Constitution established a stronger federal government with more centralized power.

Explanation:

Answer: The Articles sovereignty resided in the states, and the Constitution was declared the law of the land when it was ratified

Explanation:

write a persuasive essay proving what character you think is blameworthy in the death of romeo and juliet.

Answers

A persuasive essay to prove which character is blameworthy for the death of Romeo and Juliet: The blame for the death of Romeo and Juliet is often attributed to many different characters, but one character stands out as the most responsible: Friar Laurence.

Friar Laurence is an adult in the play, and he should know better than to agree to perform such a risky and dangerous marriage, especially when he knows that the two young lovers barely know each other.

Furthermore, Friar Laurence could have been more careful with his plan to help Juliet escape her arranged marriage with Paris. He could have informed Romeo of the plan and made sure that it was carried out smoothly. Instead, he sends a letter to Romeo with another friar, which is ultimately delayed, leading Romeo to believe that Juliet is dead and causing him to take his own life.

know more about Romeo and Juliet here

https://brainly.com/question/10468114#

#SPJ11

What does the title of the poem reveal about the speaker's descriptions of himself and his
lover in lines 28-36?

Answers

The speaker implies in poem that he and his loved one may pass away together ("by love") just as they did when they were together.

What does the book The Canonization's title mean?

In the Catholic Christian faith, "canonization" refers to the act or process of elevating a regular religious person to the status of a saint. This title alludes to the poet and his beloved's potential destiny as "saints of love."

How do paradox and irony work in poetry?

The use of words so that their intended meaning differs from their real meaning is known as irony. But the paradox is the combination of a number of seemingly incompatible ideas that reveals a secret.

To know more about poem visit:-

https://brainly.com/question/4870965

#SPJ1

Which supporting reason would best back up this claim, based on the
information in the source?
Claim: Companies in the United States should consider switching to a
four-day workweek.
Findings in source: One company in Japan reported that its workforce
was 40 percent more productive when it switched to a four-day
workweek.
A. Employees are more productive when they work fewer days per
week.
B. People would have more time for the important things in life, like
friends and family.
C. Shorter workweeks would attract talented people looking to work
fewer hours.
D. Parents would better be able to juggle the demands of work and
parenting.

Answers

Out of the four given options, Employees are more productive when they work fewer days per week is the best fitting one. Option A is correct.

Why should Companies in the United States consider switching to a four-day work week?

The source provides the example of a company in Japan that saw a 40% increase in productivity after switching to a four-day work week. Therefore, the supporting reason that "employees are more productive when they work fewer days per week" would be the most relevant and effective in backing up the claim.

Option B is not the best supporting reason because it focuses on personal benefits to the employees rather than business benefits to the company. Option C is not the best supporting reason because it only focuses on the potential for attracting talented people, without necessarily addressing whether a four-day workweek would be beneficial for the company itself. Option D is not the best supporting reason because it only focuses on benefits for parents, without considering the broader impacts of a four-day workweek on company productivity and efficiency.

To know more about work weeks, visit:

https://brainly.com/question/6484775

#SPJ1

Read the following passage:
The days become shorter, just by a few minutes each day. Many tree and shrub leaves begin changing from green to their
autumn colors, ever so slightly.
Choose the option that effectively uses a transition to create coherence.
The days become shorter, just by a few minutes each day. Also, many tree and shrub leaves begin changing from green to
their autumn colors, ever so slightly.
The days become shorter, just by a few minutes each day. Before, many tree and shrub leaves begin changing from green
to their autumn colors, ever so slightly.
The days become shorter, just by a few minutes each day. In contrast, many tree and shrub leaves begin changing from
green to their autumn colors, ever so slightly.
The days become shorter, just by a few minutes each day. Rather, many tree and shrub leaves begin changing from green to
their autumn colors, ever so slightly.

Answers

Answer:

The days become shorter, just by a few minutes each day. Also, many tree and shrub leaves begin changing from green to their autumn colors, ever so slightly.

Learning Task 6: Get a article from a newspaper, journal or other online sources. Copy or cut-and-paste it in your notebook. Then, highlight each modal used in the article. Then, identify if the highlighted modals express permission, obligation or phobition

Answers

the internet or copy-paste articles. However, I can explain what modals are and provide some examples to help you identify them in a given text.Modals are a type of auxiliary verb used to express various

meanings such as permission, obligation, prohibition, possibility, ability, intention, etc. They modify the main verb in a sentence to convey different shades of meaning. Some common modals include: can, could, may, might, must, shall, should, will, and would.Here are some examples of modals expressing different meanings:Permission: May I borrow your book? (using "may" to ask for permission)

Obligation: You must complete the assignment by Friday. (using "must" to express a mandatory obligation)

Prohibition: You can't smoke in the building. (using "can't" to express a prohibition)

By identifying the modals in a text, you can gain a better understanding of the writer's intentions and the message they are trying to convey.

learn more about copy-paste articles here:

https://brainly.com/question/15662625

#SPJ4

what new york governor resigned due to a prostitution scandal?

Answers

Former New York Governor Eliot Spitzer resigned in 2008 due to a prostitution scandal.

It was revealed that he had been a client of a prostitution ring, which led to an investigation by federal authorities. After the investigation became public, Spitzer apologized and announced his resignation, citing a violation of his obligations to his family and to the public.

A prostitution scandal typically refers to a situation in which a public figure, such as a politician, is involved in a scandal related to paying for or engaging in prostitution. Such scandals often involve allegations of illegal or unethical behavior and can have serious consequences for the individuals involved, as well as for their careers and reputations.

In some cases, prostitution scandals can also raise broader questions about issues such as the regulation of sex work and the role of personal morality in public life.

To know more about prostitution scandal here

https://brainly.com/question/31082968

#SPJ4

Other Questions
which of the following is not calculated in the corporate income tax formula? group of answer choices regular tax liability taxable income gross income adjusted gross income the term for a specific molecule on which an enzyme acts is the The number of miles driven by Bo is directly proportional to the number of gallons he used.Number of Gallons UsedNumber of Gallons UsedNumber of Miles DrivenNumber of Miles Driven881881883434799799444410341034How many miles would he drive on 38 gallons? I need help with this please 6c+4d-c-7d simplified in chronological order, what are the countries where prokofiev lived? which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover PLEASE HELP WILL MARK BRAINLIEST!A portion of the quadratic formula proof is shown. Fill in the missing statement. James is a new project manager and is struggling to meet deadlines. He approaches his director and begins to complain to him about all the problems with the project. James is obviously stressed and not thinking clearly. His director calmly slows James down and has him start from the beginning and asks him to focus on one question or problem at a time. Soon, James is speaking clearly and each question and problem is addressed.What problem solving method did James director use to improve the situation? For the function p = 2 - 3q. what is the instantaneous rate of change function? A piece of property contains 1,758.1066 sq. yards. How many yards are on each side of the square? How did the passage of Jim Crow laws in the South affect Black Americans?A. Jim Crow laws forced Black Americans to move North.B. Jim Crow laws forced Black Americans to move to Africa.C. Jim Crow laws took away rights from Black Americans.D. Jim Crow laws encouraged the development of the sharecroppingsystem. PLEASE HELP ME MATH. I WILL GIVE BRAINLISEST mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply. true or false? two proofs are required to establish the provable equivalence of two sentences of tfl. Why was the National Association of REALTORS Code of Ethics created? One pump can fill a swimming pool in 4 hours. A second pump can fillthe pool in 6 hours. If the pool starts empty, what part of the pool will befilled in each situation?The first pump works for 2 hours and the second pump works for 3hours.Pls help HELPhat is the approx. volume of the figure (Use 3.14 for pi) the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA