How does consumerism affect identity and people?

Answers

Answer 1

consumption has become a fundamental mode of self-formation and self-expression”(Zavestoski 175). The obsessional drive towards material goods has tremendously has modified the way people consider themselves and also others around them.

Answer 2
Consumerism can exhaust and tire the mind which isn’t healthy to you or your mindset. This causes depression and anxiety and other kinds of disorders. Consumerism tends to limit yourself while trying to follow certain rules, directions or trends.

Related Questions

Which of Crichton's lines best supports the idea that the group is stranded on the island?

We were driven out of our course, my lady; I fear far from the track of commerce.


I didn't invent it, my lady. I seem to see it growing all over the island.


My lady, I disbelieved in equality at home because it was against nature, and for that same reason I as utterly disbelieve in it on an island.


There must always, my lady, be one to command and others to obey.

Answers

Answer:

C

Explanation:

It proves that they are no longer at home, but on the  island where they are stranded.

Which of the following would be a good thesis statement for a persuasive
essay?
A. If each person would start recycling daily instead of just throwing
things away, our world would be less strained for resources.
B. Don't you know that unless you recycle what you can, the earth will
run out of natural resources in less than 50 years?
C. People are so trashy - everyone needs to recycle reusable items!
D. Recycling is just a fad - ignore it, and it will eventually fade into
the woodwork

Answers

Answer:

B. Don't you know that unless you recycle what you can, the earth will

run out of natural resources in less than 50 years?

Explanation:

This is attracting the readers attention and leading into other statements that may persuade a reader to recycle more often

Answer:

It's A.

Explanation:

Just got ot right in 8.1.2 A p E x quiz

4. PART B: Which detail from the text best supports the answer to
Part A?
O A “That word – 'guys'– might earn smiles and nods of
understanding in that world, but it brought the ultimate
insult in my neighborhood." ( Paragraph 5)
OB "With one boy in particular, my mother had to sit me down
and explain: 'Son, perhaps there's another reason why his
parents keep making excuses for why we can't get together."
(Paragraph 18)
O c "Painful as some of these experiences were, I was grateful to
have them in middle school and high school, so that when the
time came to head for college, I already had some fluency
navigating between different cultures" ( Paragkaph 12)
OD "I watched as too many others from my hometown and other
predominantly black cities struggled in a university setting
where suddenly they really were a minority." (Paragraph 20

Answers

Answer:

“With one boy in particular my mother had to sit me down and explain.”

Explanation:

Perhaps this one “boy” doesn’t want to be a boy anymore and gets offended when the main character refers to them as a “guy” or was never a guy to begin with. In that case it would make sense that the boy would get offended

which of the following Gothic elements appears most frequently in To one in Paradise

Answers

Answer:

Gothic elements of the supernatural world or afterlife appear most frequently in "To one in paradise".

Explanation:

what is the saddest fruit​

Answers

Answer:

blueberry

Explanation:

Answer:

The Blueberry is the saddest fruit.

Explanation:

Is the really a question?

what does the dog eat​

Answers

Answer:

meat and burgers is what I do not have a great day to be a great day to be a great day to be a one night only person that is not an issue in

Answer:

The cat-

Explanation:

I'm just kidding! Dog food :3

“fateful journey “what elements of the story did he invent? And what did he alter ?

Answers

Sorry but there is no story.

NO LINKS OR I REPORT
The following question has two parts. First, answer part A. Then, answer part B.


Part A

How are the doctors from the 1700s and modern doctors similar?


A.

They use the best medical information available at the time.


B.

They believe that a person can have too much “bad blood.”


C.

They understand that it is important to clean their tools.


D.

They do not always do what the patient wants.


Part B

Which detail from the text best supports your answer in part A?


A.

"carefully cleaning hands"


B.

"had to be balanced for a person to be healthy"


C.

"did the best they could with what they knew"


D.

"asked to be bled when he became very sick"

Answers

Answer:

Part A: A

Part B: C

These are the awnsers hope they help

Part A: They use the best medical information available at the time.

Part B: "did the best they could with what they knew".

How does the evidence support your idea?

Words, concepts, and information taken from the sources studied during research serve as evidence or examples. The arguments are strengthened in a more specific way by the usage of this borrowed content.

Include just those sources that are pertinent to your paper's argument.

Use critical thinking techniques to assess the veracity, authority, and applicability of your sources.To arrange the information you have acquired, create your own information management system.

Often, a paragraph will contain all of the supporting details that help to prove a certain major point. Yet, it is advisable to do so if it would make the writing more understandable to divide a lengthy paragraph into multiple smaller ones (but a paragraph cannot be made of a single sentence).

Learn more about evidence here:

https://brainly.com/question/15880833

#SPJ3

Help please i need it

Answers

Answer:

C is the answer

Explanation:

brainliest plzzzzzz

Student E made the claim, “The legal driving age in the U.S. should be 18 years old.” Which of the following is an example of an appropriate counterclaim the student might make?

Select one:

Many people feel that there should be an upper age limit for driving: elders over the age of 80 tend to lose the mental capacity to safely drive a vehicle.


It might appear as if cars are well-made and are thus safe to drive.


It is often supposed that smoking inhibits a teenager’s mental senses.


Many people argue that teenagers are developmental capable of driving by 16, or even younger.

Answers

Answer:

4. fourth one

Explanation:

Answer:

n

Explanation:

Fire: heat as night : darkness analogy

Answers

Answer:

It's a cause and affect analogy as when there is fire, there's heat, and when it is night, there is darkness.

Which transition would best fit in the blank?
Alan hoped to visit the Space needle as soon as he arrived in Seattle; [____], he planned to check out the Museum of Flight.
A. Indeed
B. Therefore
C. Previously
D. After that

Answers

Answer:

B. Therefore.

Answer:

D. After that

Explanation:

Plz help me with this

Answers

Answer:

Poem

Explanation

I hope this helps, and thanks! Tell me if I am wrong, I didn't take this class. BRAINLIEST PLEASE!

The correct answer is; Poem

Read the passage.

Prepare the fuel for your fire by arranging it in a loose pile.
Use your source of ignition, either a match or a striker.
Fan the flame to provide it with oxygen.
Add additional fuel until the fire is burning steadily.
Which is the most likely purpose for reading this text?

to learn how to build a campfire
to enjoy a story about a camping trip
to know how campfires impact nature
to determine what camping tools to buy

Answers

to learn how to build a campfire

what is the theme of the book, "The Song of Achilles"?

Answers

Answer:

There are several but Fate, and some of the seven deadly sins are your best picks

Explanation:

In Homer's Iliad, several themes are underlined--fate, honor, wrath and that most Greek combination of pride and arrogance, hubris

If you are given the opportunity to invent anything useful to current season, what will you create as your own invention?​

Answers

Answer:

I would have a GPS System set up to sync with all Traffic lights and Emergency Services.

When an ambulance leaves a property headed for the hospital they would hit the home button on the Navigation system in the vehicle.

That would then set the route and send a signal ahead of time warning all traffic lights that a Emergency Vehicle is approaching.

The lights would have an extra colour light ( say purple for example) which would activate when the Ambulance was within a certain distance from those lights giving motorists enough time to move safely out of the way allowing the Ambulance to have a clear path through the intersection.

This would save seconds, minutes all which are vital and could mean so many more lives saved as well as less accidents and confusion on the roads when an emergency vehicle is trying to get through the traffic to a Hospital or accident to save peoples lives

Explanation:

Roles of journalist
towards Sexual
based Violence?

Answers

I don’t think you can ask things like this

At the end of the story, before Anna's leg breaks through the windshield, it thumps against the glass over and over. What effect does this have on the mood of the story? Support your answer with details from the text. Answer

Answers

Answer:

I don't know what story you're talking about, but I will attempt to make an educated guess.

It may make the story more exciting with action, but it also may induce sorrow as well.

Unfortunately since I don't know the backstory to this I cannot provide details from the text, however I hope this gave you a jumpstart!

Hope this helps! c:

Answer:

tension and suspense because at the end of the passage it says " and then everything went black" leaving the reader on a cliff hanger.

3. Reread the passage in which Ponyboy remembers when Steve's female cousin
from Kansas visited. How did the gang choose to treat her? Why?

Answers

Answer:

The gang chooses to treat Steve's cousin in a polite and gentle manner. They do this, because that is how they treat the family of gang members.

Explanation:

This question is about the novel "The Outsiders" where we know the story of Ponyboy a boy who struggles to find his own identity in an environment to which he does not feel comfortable and adapted. In the novel we got to know two street gangs, one of which Steve and Ponyboy are members of. These gangs have rules, which are strictly followed by all members, one of these rules says that the family of the gang members should be treated with kindness and for this reason, Steve's cousin is treated in a polite and kind manner.

a is a mountain or hill a vent through which lava erupted from the Earth's?​

Answers

Answer:

A mountain is more likely to have a vent through which lava erupts from the Earth.

Explanation:

By the way, can you follow me on Brainly?

Thanks!

discuss what you can add to that college community

Answers

Answer:

You can add extreme learning programs for the advanced ones and maybe after-college helping or community services.

Explanation:

Hope this helped, and please mark as Brainliest :)

Friends and fellow citizens: I stand before you tonight under indictment for the alleged crime of having voted at the last presidential election, without having a lawful right to vote. It shall be my work this evening to prove to you that in thus voting, I not only committed no crime, but, instead, simply exercised my citizen's rights, guaranteed to me and all United States citizens by the National Constitution, beyond the power of any state to deny.

—“On Women’s Right to Vote,”
Susan B. Anthony

Which statement is true about the audience for "On Women’s Right to Vote?"

Anthony is trying to appeal to women, men, and lawmakers.
Anthony is trying to appeal to women only.
Anthony is trying to appeal only to men who vote.
Anthony is trying to appeal to judges.

Answers

Answer:

How can a change in genotype affect the phenotype?

How can a change in genotype affect the phenotype?How can a change in genotype affect the phenotype?

Explanation:

What is one way in which early twentieth-century American literature differed from nineteenth-century American literature?


a. Early twentieth-century American literature often focused on dangerous people and conflicts about how to handle them.


b. Early twentieth-century American literature often focused on extraordinary people and conflicts among society's elite.


c. Early twentieth-century American literature often focused on highly educated people and conflicts among thinkers.


d. Early twentieth-century American literature often focused on ordinary people and everyday conflicts.

Answers

Answer:

d. Early twentieth-century American literature often focused on ordinary people and everyday conflicts.

Explanation:

I just took the test.

an informal letter to a family member telling them how I enjoyed hiking during the holidays​

Answers

Answer:

i had so fun going hiking because Hiking Improves Health and Fitness and By doing so, you increase muscle strength,I love when I feel the power behind my legs, the rocks underneath my feet, I even love when I feel that familiar burn in my lungs up the steep parts. Lately I've been feeling more grateful for my body, imperfections and all, and the places it allows me to go.

Hiking clears the mind and reduces stress,Hiking makes us happier,hiking imporoves sleep quality, Improve your memory through hiking...Hiking is a wonderfully restorative and its so nice how you get to feel the fresh mountain air. It’s so clean and refreshing, just like sipping on ice-cold water on a hot sunny day.

i missed half of my class for this hope it helped <3

Choose a single thing as your subject, such as a room, a house, a park, or a person,
and describe it in a stream of consciousness style.
The assignment focuses on:
Establishing a clear and consistent point of view
Exploring a particular problem or conflict connected to your narrator(s)
.
Using vivid imagery to convey personality and tone
.
Using grammar and organization to express an internal monologue

Answers

Answer:

I walk into my room, pushing open the tall white door with the gold handle. I take a step in, and look around. I see the dusty rose colored walls, and the LED lights around the perimeter of the room, set to the color blue. I look to my right, and I see the gold XOXO decal on the wall, taking up every square inch of the light pink wall. I look to the ground, and I see the wood floor, the planks of wood under my feet. I look to my left, and see my white nightstand, with a green succulent on it. I see the book "5 Feet Apart" sitting on top of the nightstand, waiting for me to pick it up and finish reading. I look past the nightstand at my bed, with the rose designed bedsheets and the gold canopy outline. I see the white curtains hanging from the canopy. I see the black pillows sitting on my bed, waiting till the time comes for my to lay my head down on them. I look straight ahead, and see the light pink curtains with the light shining through, making my room bright without me having to turn on a light. I suddenly frown, I need something more. I need something to cover up the empty wall next to my windows.

(you can finish the rest if you'd like!)


What is the first step you should take when you want to open a savings account?

Answers

Answer:

Compare

Explanation:

First, I would compare various options. There are many institutions that offer accounts, so compare to see which one is best.

Next, gather all your documents. You do not want to have no information/legal documents about yourself when you open the account either online or in-person.

Those are the first two steps.

Happy learning!

Answer: compare the savings accounts companies.

Explanation:

more interest in a short amount of time

more times to withdraw money from a bank

additional customer service

I think that you should ... your decision( consider)​

Answers

Answer: wdym

Explanation:

Answer wdym explain

Does ross believe what he tells lady McDuff

Answers

Do you have a picture of the question or story?


One of the biggest challenges that we all face, at least in
my opinion it's a challenge, is making difficult decisions,
life-altering decisions. These decisions are not only
difficult to make, but they can also bring consequences
that are not easy to live with. However, if decisions are well
thought out and carefully considered they will be easier to
make and easier to live with.
What feedback would be most helpful feedback to give the writer of this
paragraph?
A. Improve the spelling and grammar.
B. Make the claim more personal.
C. Revise the claim to make it clearer.
D. Address a counterclaim.

Answers

Answer:

revise the claim to make it clearer

The feedback that would be most helpful to give the writer of this paragraph is revise the claim to make it clearer. So, option C.

What is meant by feedback?

Feedback is defined as the action of responding or commenting to the idea of someone's statement.

Here,

In the given statement, the person is speaking about making decisions in life.

Each and everyone in their life are responsible for making decisions in certain stages of their life. Even though it seems harder, we are meant to face our own life situations.

I believe making decisions on your own can make you more confident in life. Nothing is impossible in life. If something seems impossible, you need to make them possible.

Decisions are to be made carefully, because the decisions we make, can make consequences too.

So, from the given statement, I would say, you will be clear with the statements, if you revise them.

Hence,

The feedback that would be most helpful to give the writer of this paragraph is revise the claim to make it clearer.

To learn more about feedback, click:

https://brainly.com/question/30449064

#SPJ7

What effect is accomplished by the sudden mention of "sorrows" in the first stanza of the second poem?
A)It lets the reader know that this poem will have a different tone and focus than the first.
B)It causes the reader to conclude that children are a sorrowful thing.
C)It makes the reader wonder if sorrow and joy could actually be one and the same thing.
D)It dispels the notion that sorrow is a consequential force in everyone's life.

Answers

Answer:

B)It causes the reader to conclude that children are a sorrowful thing.

Explanation:

Answer:

The correct answer is It lets the reader know that this poem will have a different tone and focus than the first.

Other Questions
How do you write 20% as a decimal? HELPPP!!! Using the following data, which is the correct rate law of the sample reaction?A5B + 6C 3D + 3EExperiment (A) (M) [B] (M) [C](M) Initial Rate (M/s)10.35 0.35 0,35 8.0 x 10420.700.350.353.2 x 10-30.700.700.356,4 x 10-840.700.350.703.2 x 10-3A.) K[A]^2 [B]^1 [C]^1B.) K[A]4 [B]^2 [C]^1C.) K(A)^2 [B]^1 [C]^OD.) k[A]^1 (B)^2 [C]^O if it costs 21.6$ for 12 brownies, how much would it cost for 1 Isaac paid $81 for a new surfboard. The amount paid was 60% of his total savings. How much money did he have in his savings before buying the surfboard? help btw it needs to be rounded to the hundredths BRAINLIEST IF CORRECT which evidence best supports the following topic sentence? Another reason the school should open an after school computer lab is that the lab would offer safeguards for internet use that students do not get out of school. Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) El permetro de una circunferencia es de 40 cm, y tiene un ngulo de 130. Calcula el rea del sector de dicha circunferencia. Read each sentence below and identify the adjectives with the nouns they describe. Nancy was angry when Fred picked her up late A rectangle is 12 cm long and 8 cm broad.The length and breadth of the rectangle areboth increased by the same amount, dcm.If the area of the rectangle is now 221 cm,find the value of d. with a digram HELP PLEASE 1. 5x + 7 = 2x + 162. 3x + 4 = 5x 10 A wind turbine is most like a _______________A; windmillB; windsockPlease I need it for my test :( Consider the following argument: Any piece of software that is in the public domain may be copied without permission or fee. But that cannot be done in the case of software under copyright. So, software under copyright must not be in the public domain. The conclusion of the argument is: What does paragraph 4 reveal about George's change in attitude towardthe townspeople? *A. He realizes that they care about his well-being.B. He is worried they will make him miss his train.C. He becomes suspicious about their motives.D. He hopes they won't embarrass him any further. Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10