How do you do the second part of the problem?

How Do You Do The Second Part Of The Problem?

Answers

Answer 1

Answer:

8

Step-by-step explanation:

According to the Alternating Series Estimation Theorem:

│aₙ₊₁│≤ ε

1 / (4 (n + 1)⁴) ≤ 0.00005

4 (n + 1)⁴ ≥ 20000

(n + 1)⁴ ≥ 5000

n + 1 ≥ 8.41

n ≥ 7.41

n must be an integer, so n ≥ 8.


Related Questions

Please write down the steps.

Answers

Answer:

are you beginer band

what is the expanded form of 1 to the 10th power?​

Answers

Answer:

1

Step-by-step explanation:

since 1*1 will always be 1, 1 raised to any power will be 1.

If boxes of chocolates contain chocolates in total, calculate how many chocolates boxes of chocolates will contain

Answers

That question don’t make sense

Six equilateral triangles are connected to create a regular hexagon. The area of the hexagon is 24a2 – 18 square units. Which is an equivalent expression for the area of the hexagon based on the area of a triangle?

6(4a2 – 3)
6(8a2 – 9)
6a(12a – 9)
6a(18a – 12)

Answers

it would be 6(4a2 - 3)
you would factor out just the 6 because the 18 doesn’t a a term with it like 34a2 does. then just divide normally to get ur answer 6(4a2 - 3)

Pls help! What is the expression in simplest radical form?

√504

Answers

the answer is 6 square root of 14

Amount of cd after 3 years using simple interest formula if the principle is $2,000 and the interest 4%

Answers

Answer:

Amount of cd after 3 years=2240

Step-by-step explanation:

principal==$2000

simple interest=4%

interest /year =80

for 3 years =80 x 3 = 240

If f(–2) = 0, what are all the factors of the function f(x)=x3-2x2-68x-120 ? Use the Remainder Theorem.

Answers

Answer:

it would be option C)  (x – 10)(x + 2)(x + 6)

Step-by-step explanation:

You have to divide x^3 -2x^2 -68x -120 by x + 2 to get x^2 - 4x -60 and then factor

The factors of the function are  (x + 2)(x - 10)(x + 6).

What is a polynomial?

Any expression which is formed by using constants, variables, and exponents is polynomial, it is solved with the help of mathematical operators. Polynomial is made by the parts "poly" and "nominal"  here "poly" means many and "nomial" means terms.

Given f(-2) = 0

f(x) = x³ - 2x² - 68x - 120  .........(1)

one factor of function is x + 2

divide the function by x + 2

multiply x² by x +2

x²(x + 2) = x³ + 2x²

subtract the term from equation 1 we get,

x³ - 2x² - 68x - 120 - x³ - 2x²

= -4x² - 68x -120 ......(2)

now multiply -4x by x + 2

-4x(x + 2) = -4x² - 8x

subtract the term from equation 2 we get

-4x² - 68x -120 - (-4x² - 8x)

-60x - 120 ........(3)

again multiply -60 by (x + 2)

-60(x + 2) = -60x - 120

subtract from equation 3

-60x - 120 - (-60x - 120) = 0

The quotient we get from the division is,

x² - 4x - 60

here are the factors of x² - 4x - 60 = (x - 10)(x + 6)

Hence, the factors of polynomials are (x + 2)(x - 10)(x + 6).

Learn more about polynomials;

https://brainly.com/question/11536910

#SPJ2

6(1+x)+x=-14
Please help solve for x

Answers

Answer:

X is equal to -10

Step-by-step explanation:

#1. Multiply 6 to (1+x). Doing this makes this equation: 6+x+x=-14

#2. Move 6 to the other side of the equation, to the side of the answer and change its abbsolute value. Doing this will make x+x=-14-6.

#3. Simplify both sides. 2x=-14-6  ---->  2x=-20

#4. divide -20 by 2, this equals -10. x is equal to -10. WooHoo!

Answer:

Answer x=-[tex]\frac{20}{7}[/tex]

Step-by-step explanation:

6(1+x)+x=-14

(multiply bracket with 6)

6+6x+x=-14

(-6 for both sides)

6x+x=-20

(add x terms together)

7x=-20

(divide by 7 for both sides)

x=-[tex]\frac{20}{7}[/tex]

Based on the lesson, identify the first operation needed to solve the following equation. x/11 - 2 = 3 multiplication subtraction addition division

Answers

The number 2 should be added to both sides of the given linear

equation to enable the variable x be made the subject of the equation.

Response:

The first operation that needed to solve the equation is; Addition

Which sequence of steps are needed to solve the given equation?

The given equation is presented as follows;

[tex]\mathbf{\dfrac{x}{11} - 2} = 3[/tex]

The solution of the above equation van be found by making x the

subject of the equation.

Removing the 2 from the left hand side of the equation will isolate the [tex]\dfrac{x}{11}[/tex]

, from which the value of x can be found by multiplying by 11.

First operation;

To remove the 2, we have;

2 - 2 = -2 + 2 = 0, adding 2 to both sides of the equation gives;

[tex]\dfrac{x}{11} - 2 \mathbf{+ 2 }= 3 + 2[/tex]

[tex]\dfrac{x}{11} + 0 = 3 + 2 = 5[/tex]

[tex]\dfrac{x}{11} = 5[/tex]

Second operation;

[tex]\dfrac{x}{11} \times 11 = 5 \times 11 = 55[/tex]

x = 55

The first operation that needs to be needed to solve the given equation

is therefore;

Addition

Learn more about solving equations here:

https://brainly.com/question/26589787

Answer: It would be addition

Mark as brainliest <3

At the restaurant, the cost of the meal before tax was
$40. The tax is 8.5%, and Sheri wants to leave at least
an 18% tip. Explain how to approximate the total cost of
the meal.

Answers

Answer:

so you add then multiply then subtract

Step-by-step explanation:

Answer:

First we estimate the percent's. 8.5% - 10%, 18% - 20%. Then we do the equation. If you add percent's you get 30% multiply that by 40 and you get 12. Add that to you problem and you get $52.  

Step-by-step explanation:

Since the tax and gratuity were 4 and 8 dollars you can just add those up to the 40, but I did it another way.

This is the sample response if you want a better explanation.

The gratuity is about 20% of $40, which is $8. The tax is about 10% of $40, which is $4. So, the total cost is about $40 + $8 + $4 = $52.

Translate the sentence into an equation.
Nine less than the product of 8 and a number is 7.
Use the variable b for the unknown number please help me out

Answers

(8•7)-9=b or (8x7)-9=b

After translate the sentence into equation, the equation is,

⇒ 8b - 9 = 7

Where, b is any number.

What is an expression?

Mathematical expression is defined as the collection of the numbers variables and functions by using operations like addition, subtraction, multiplication, and division.

We have to given that;

The algebraic expression is,

⇒ Nine less than the product of 8 and a number is 7.

Now, Let a number = b

So, We can formulate the mathematical expression as;

⇒ 8 × b - 9 = 7

⇒ 8b - 9 = 7

Thus, The equation is,

⇒ 8b - 9 = 7

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ2

John was gifted a pack of crayons. He gave 13 crayons to his friend Rhea
and was left with 11 crayons. How many crayons did the pack contain?

Answers

Answer:

24

Step-by-step explanation:

13+11=24

so 13(the amount he gave Rhea) +11(the amount he has left) = 24 . total in the container was 24 .

Question 3/3 Devon opened a bank account with $225. He saves $25
per month. What is the least amount of months it will take him to save $750?

Answers

Answer:

21 Months

Step-by-step explanation:

If he already has $225, we can do 750 - 225 to get 525. $525 represents how much more money he needs to reach his goal of $750. So we can do 525 divided by 25, since that is how much he makes per month, giving us 21. 21 is how many months it will take until he gets to $750 without spending anything.

Mrs. Santos can cook the menu for a party in 4 hours. Mr. Salonga can work to fast as she can. If they work together to cook, how many hours will it cake them to finish cooking.​

Answers

2 hours and 40 minutes

Step-by-step explanation:

Let a be Mrs Santos

Let b be Mr. Salonga

Mrs. Santos can cook the menu for a party in 4 hours

a = 4 hours

Mr. Salonga can work twice as fast as she can.

b = 2 ( 4) = 8 hours

The word time formula is

1/a +1 /b = 1/t

Where t is the total time

Substitute the values

1/4 + 1/8 = 1/t

1/4 + 1/8 = 2/8 + 1/8 = 3/8

Therefore

3/8 = 1/t

Doing cross multiplication

3*t = 1 * 8

3t = 8

Dividing both sides by 3

3t/3 = 8/3

t = 8/3 hours

t =2 \frac{2}{3}t=2

3

2

hours or 2 hours and 40 minutes

There are 35 students in the drama club. 2 out of every 5 students in the club are boys. How many student clubs are boys?


Answers

Answer:

14

Step-by-step explanation:

6 divided by 938 long division

Answers

answer: around 0.0064
i rounded it to the nearest hundred thousandth because the number will keep going on forever.

Which of the following numbers could be the probability of an event? 1, 1.39, -0.53, 0, 0.02, 0.26

Answers

Answers:

A) 1D) 0E) 0.02F) 0.26

If x is a probability value, then [tex]0 \le x \le 1[/tex]

A probability of 0 means "impossible" while a probability of 1 means "100% certain".

the product of k and three

Answers

Answer:

3k

Step-by-step explanation:

I am a two digit number
My ones digit is equal to 7minus 3
My tens digit and my ones when added together equals to an even number
What number am I?

Answers

I think 14, because 7-3=4 and then 10+4= and even number

4 divided by 1/5 plzzzz helppppppppppppppppppppppppp

Answers

Answer:

the answer is 20

Step-by-step explanation:

Answer:

Your answer is: 20

One of two or more expressions that are multiplied together to get a product.

Factor the numerator and denominator and cancel the common factors.

Step-by-step explanation:

Hope this helped : )

The circus had 43,475 guests last year. The fair had 8,034 fewer guests
than the circus. How many guests did the fair have?

Answers

Answer:

This year, the circus had 35,441 guests.

Step-by-step explanation:

You just subtract 8,034 from 43,475.

I really hope this helped you!

Suppose that COP and TOD are vertical angles, m COP = 11x - 17
and m TOD = 9x + 11.

Determine the Measure of COD
Determine the measure of POT

Answers

Answer:

Step-by-step explanation:

If COP and TOD are vertical angles, then they are equal to each other because vertical angles are equal.

m COP  =  m TOD

Given

COP = 11x - 17

TOD = 9x + 11.

Substitute:

11x-17 = 9x+11

11x-9x = 11+17

2x = 28

x = 28/2

x = 14

Get <COD

<COP = 11(14)-17

<COP = 154-17

<COP = 137

<COD = 180-<COP

<COD = 180-137

<COD = 43°

Similarly:

<POT = 180 - <TOD

<POT = 180 - [9(14)+11]

<POT = 180 - 137

<POT = 43°

What is the cardinal number of the set containing all negative integers greater than −8?

Answers

Answer: positive 7

Step-by-step explanation:

Cardinal number of the set containing all negative integers greater than −8 is 7.

What are cardinal number?

In mathematics,cardinal numbers or cardinals for short, are generalization of the natural numbers used to measure the cardinality of sets. The cardinality of a finite set is a natural number: the number of elements in the set.

Now the given set is all negative integers greater than -8.

Let S be the set,so

S = {-7,-6,-5,-4,-3,-2,-1}

now to find the cardinality, we see that set S has 7 elements.

Cardinality of Set S is 7.

Hence, cardinal number of the set containing all negative integers greater than −8 is 7.

More about Set and Cardinality :

https://brainly.com/question/27965678

#SPJ2

IM TIMED HELP PLS , solve the system of equations using substitution method , y = 2x + 8 , y = 4x - 2

Answers

Answer:

x=5, y=18

Step-by-step explanation:

y=2x+8

x= (y-8)/2

Substitute in second equation,

y= 4((y-8)/2) -2

y= 2(y-8)-2

y= 2y-16-2

16+2=2y-y

18=y

Replace y value in first equation to find x,

18= 2x+8

18-8=2x

10=2x

5=x

Which is the value of this expression when a=5 and k=-2?
[3^2a^-2]^k
[3a^-1]

Answers

Answer: 125/27 as a decimal 4.62963

Step-by-step explanation:

((32)(5−2))−2(3(5−1))

((32)(5−2))−2(3(5−1))

Find the value of x and y that satisfy both of the equalities x /y= 2/3 and y/12 = 3/4.

Answers

Answer:

x=6;y=9

Step-by-step explanation:

First you try to find y in the second equation --> y/12=3/4

You divide 12 by 4 to see how many times y/12's denominator and numerator is bigger. 12/4 is 3, so to find y you multiply 3*3. so 9/12=3/4. To check this, you multiply 3 on each side of the fraction -->

3*3=9  4*3=12.

Then, you can just put y into the first equation, which is x/y=2/3. Pluck that in, and you get x/9=2/3. Do the same thing you did in the first step, and you should get 6/9=2/3. Hope this helped :)

Answer:

x=6; y=9

Step-by-step explanation:

Find the value of the missing side. a=9 b=12 c=

Answers

Answer:

a=9b=12c=15

Step-by-step explanation:

Write the standard form of the equation:
Slope= 3 y-intercept= -1

Answers

Answer:

y=3x-1

Step-by-step explanation:

y=mx+b

y=3x+b

y=3x-1

determine the range of the following graph:

Answers

Answer:

The range of a function is the set of outputs the function can give

The y-axis on the graph shows as the output of the function

From the graph, we can see that the outputs of this specific function range from 0 to 5

Therefore, the range of this function is:   [0 , 5]

Which general rule maps abc onto a b c

Answers

A b c can it is not a general a rigrid motion
Other Questions
(1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there.