Horses……fly (use can)

Answers

Answer 1

answer is Horses use to fly


Related Questions

aoqewgzxzc. j oin m ee t f or talki ng​

Answers

Answer:

joining

Explanation:

lemme join

are you alright ?? /gq

PLEASE HELPPPPP!!!!!!!

What is a question you can ask when analyzing the structure of a text?

How are allusions used for effect?
How are main ideas developed?
How are the examples effective?
How are the points organized?

Answers

D) How are the points organizes

Explanation:

Seems to make the most sense.

PLEASE HELP MEDICAL TERM..

Answers

Answer:

missing opportunities for new, better approaches ⇒ over-reliance on past experience

making a poor decision based on incorrect data ⇒ not gathering enough pertinent information

taking too long to make a decision ⇒ fear of making independent decisions

are the phrases "this is interesting to do" and "doing this interests me" and "I am interested in doing this" the same

Answers

Answer:

Yes, they mean the same. These sentences are just different ways to say that something is interesting to you.

Hope this helps!!

Why are most natural monopolies established?
O A. To earn maximum profits for shareholders
O B. To increase competition in a struggling industry
O C. To help governments provide public services
O D. To let companies avoid taxes and regulations
**Economics**

Answers

Answer:

D is the answer u understand

Natural monopolies are established to help governments provide public services. Hence, the correct answer is C.

What are natural monopolies?

Natural monopolies are industries where a single firm can produce at a lower cost than any potential competitor due to economies of scale. This means that as the firm produces more, the cost per unit decreases. Consequently, it becomes more cost-effective for a single company to provide the service rather than having multiple companies each producing a fraction of the output.

Most natural monopolies are established to help governments provide public services. The government may find it more efficient to have a single provider of the service, such as water or electricity, rather than having multiple providers. By doing so, the government can ensure that the services are provided at a reasonable cost and with an adequate level of quality.

Therefore, natural monopolies are established to help governments provide public services.

Learn more about natural monopolies, here:

https://brainly.com/question/29765560

#SPJ7

drought (drout) n. 1. a long period of lack of rain 2. a serious shortage A. adjective B. noun C. adverb D. preposition

Answers

Answer:

I think it's a long period of lack of rain

A character battling the elements is a


character vs. self conflict.

character vs. nature conflict.

character vs. society conflict.

character vs. character conflict.

Answers

Answer:

Character vs Nature

Explanation:

The elements are a part of nature, therefore they are battling nature. Hope this helps :)

Which are the three required parts of a text ad?

Answers

Answer:

1. headline text

2. a display URL

3. description text

Explanation:

List the subject and verb in this sentence. You woke up late this morning ​

Answers

Answer:

'You' is the subject. 'woke up' is the verb.

What did Storm hide from the owner and carefully “cover” it up?

Answers

Answer:passage?

Explanation:

A_ _ _ _ _ _ _ is the most important metal used in air plane manufacturing.

Answers

Answer:

Aluminum is the most important metal used in airplane manufacturing

Explanation:

What is the mood is "aunty misery"

Answers

Answer:

Third, both “The Monkey's Paw and “Aunty Misery” convey the moral that fate should not be changed, for it brings only horrible consequences with it. The life lesson that “The Monkey's Paw” conveys is that destiny should not be interfered with.

Answer: mood aunty

Explanation:

so aunty is big in chemestry

Question is "In at least three complete sentences, write a character analysis for the protagonist in your selected novel. Include literal, interpretive, and evaluative information about the character. " My novel is In the Time of the Butterflies.

Answers

Explanation:

?????????????????????????????????

Which of the following is associated with Wernicke's area?
Multiple Choice
Language innovation
Language production
Language intonation
Language comprehension

Answers

Language comprehension

The idea of the Wernicke's area was developed by Carl Wernicke.The language issue that is associated with Wernicke's are is;

Language comprehension

The Wernicke's area is located in the left hemisphere of the brain. It is located in the third posterior region of the upper temporal convolution.

Someone who has the is area disrupted for any reason can suffer from Wernicke's aphasia. In this condition, they are fluent in speech but forms words that do not make sense.

Summarily, Wernicke's area is associated with Language comprehension.

Learn more here:

https://brainly.com/question/24552101

According to a recent survey, 65% of young people would like to study in a foreign country.

Opinion

Fact

Approximately one in three people who take part in voluntary activities say that it has made them feel better about themselves.

Opinion

Fact

Professor Mark Thompson believes that people from wealthy backgrounds tend to volunteer more than people from poorer ones.

Opinion

Fact

It has been proven that the main reason people volunteer is to help other people, although some people also do it in order to try a new experience.

Opinion

Fact

‘Instead of making people busier and more tired, taking part in voluntary activities may actually help decrease people’s stress levels,’ comments Clara Coleman, a researcher at Princeford University.

Opinion

Fact

‘Employers don’t appreciate people who do volunteer work alongside their normal jobs,’ suggests Joel Gateman.

Opinion

Fact

Answers

Answer:

1. Opinion

2.Fact

3.Opinion

4.Fact

5.Opinion

6.Opinion

Explanation:

I think that this would be correct

Read these lines from the poem and answer the question.
The monument sticks like a fishbone
in the city's throat
In these lines, the poet suggests that
the monument should have been torn down along with the aquarium
the monument is not attractive
the monument makes the people of the city uncomfortable because of the history behind it
the monument should have been placed in another part of the city

Answers

Explanation:

the monument makes the people of the city uncomfortable because of the history behind it

Why did Ralphie have to stop after every block on his way to the library?
He was delivering newspapers.
B
The chain kept coming off his bike.
C
His handlebars were loose and had to be tightened.
D
He was tired because the library was so far from his house.

Answers

Answer:

D. He was tired and the library was so far from his house..?

Explanation:

Which of the following words best describes the emotional state depicted in the drawing? a. angry b. sad c. smug d. shocked

Answers

Answer:

bro we need the picture or we can't answer

Answer:

you didn't upload the file

Which theme do the actions of Della and Jim suggest most clearly?
A. Being wealthy make life easier.
B. Love is the greatest gift.
C. Beauty is in the eye of the beholder.
D. Time heals all wounds.

Answers

Answer:

B.) Love is the greatest gift. I hope this helped.

B love is the greatest gift

PLEASE HELP! I NEED EXAMPLES! GIVING POINTS :)!
Write 4-5 sentences about this image.

Answers

The lord ganesh is floating on water

In conclusion more people should eat at home because?

Answers

Answer:

so u wont spread the corona virus

Eating at home is much more comfortable than having dinner or lunch in a public place. At home, we can be more relaxed than in a restaurant. We can wear comfortable, casual clothes; even pajamas. We can sit in a comfortable position on our favorite chair, on the sofa, or the floor. If we wish, we can watch TV or a video, or listen to a radio program. None of these can be done at a restaurant. Furthermore, at home, we do not have to worry about disturbing other diners and can talk and laugh as loudly as we want without fear of upsetting people sitting nearby us. In conclusion, it is my opinion that for reasons of comfort, cost and health, eating at home is preferable to eating in a restaurant or at a food stand. Although I enjoy eating out now and again and usually do so about once a week, it is not something I could do every day. Sitting in my comfortable clothes, in front of the TV, and with a good, home-cooked meal in front of me, I am happy and that is why I like eating at home more than eating at a food stand or in a restaurant.

Which central idea does Emerson develop in "Self-Reliance"?
OTo live authentic lives, people should practice nonconformity.

O To improve oneself, it is necessary to consider others' viewpoints.

O People who openly share their opinions are most respected in society.

O Fate is predetermined so there is little value in trying to change.

Part B
Which detail from the text best reflects the development of the central idea in Part A?
o "In every work of genius we recognize our own rejected thoughts..."

o "Accept the place the divine providence has found for you..."

o "Speak your latent conviction, and it shall be the universal sense..."

o "Insist on yourself, never imitate."

Answers

Part A:

The central idea developed by Emerson in "Self-Reliance" is A. To live authentic lives, people should practice nonconformity.

 

According to Ralph Waldo Emerson, nonconformity means relying on self-judgment, self-choices, and enjoying freedom from institutional and societal influences.

 

Self-reliance should triumph over every pursuit and can only be enjoyed by one who listens to their inner voice without allowing the world to quench the essence of the message.

 

Part B:

The detail from the text that best reflects the central idea in Part A is D. "Insist on yourself, never imitate," in the words of Emerson.

 

For Emerson, one who imitates makes a caricature of himself and does not value his self-worth. Emerson insists that everybody should highly rate their unique gifts and make something great out of them.

 

Thus, for Emerson, a nonconformist is what every achiever should be.

Read more about Emerson's Self-Reliance at https://brainly.com/question/6906114

Answer:

Explanation:

I took the test :)

Which sentence describes the main conflict in this story? Sasha and Connie are best friends at Franklin Middle School. They are both members of the debate team. One day, they are forced to debate each other at the Franklin Middle School Debate Tournament. Sasha holds back, but Connie doesn't. Connie wins, and Sasha can't forgive her.

A. Sasha and Connie don't want to debate.

B. Sasha and Connie must debate each other.

C. Sasha and Connie can't work together.

D. Sasha and Connie may lose their friendship.​

Answers

Answer:

D.

Explanation:

ok its either B. or D. but I think its D. more than B.

Answer:

B

Explanation:

the question is what sentence describes the main conflict and the issue between them is that they have to debate tho D could be it D is more the result of and not the cause of

what is the main idea of this passage?

Answers

Answer:

Since there is no passage provided here is the definition of a main idea

Explanation:

The main idea of a passage is the central idea or most important part of a paragraph.It is usually identified as the larger part of the passage

Hope this helps

Dont forget to smash that heart at the bottom <3

Plz Mark Brainliest

Have a great day!

Is the sentence below written in the active voice or passive voice?
Pacha was given a cherry tree to plant in his garden.

Answers

the answer is passive
It is written in a passive voice

10. Nancy visited one of her elderly neighbors and noticed that she had a gun locked away in one of her

cabinets. During the visit, Nancy turned to her neighbor and asked, "Why do you have a gun in your

house?" Her neighbor simply said, "I am exercising my right to own a gun legally.".

Answers

2nd amendment— the right to bear arms

please help me!! please!​

Answers

1) My cat's name is Nisa

2)Like most cats,she has her own ways.

3)She scratches people when they pull her tail.

4)When the children goes out of the room she usually comes in

5)I think she is afraid of them.

6)She watches birds for a long time, but she doesn't catch them

7)I don't know why she often chases the vacuum cleaner

You just need to unscramble the words to make it have sense.

The paragraph:

My cat's name is Nisa.Like most cats,she has her own ways.Some examples of this is that she scratches people when they pull her tail.When the children goes out of the room she usually comes in.I think she is afraid of them.She watches birds for a long time, but she doesn't catch them.I don't know why she often chases the vacuum cleaner.

Answer:

1. My cat's name is Nisa

2. Like most cats, she has her own ways

3. She scratches people when they pull her tail

4. When the children goes out of the room she usually comes in

5. I think she is afraid of them

6. She watches birds for a long time, but she doesn't catch them

7. I don't know why she often chases the vacuum cleaner

Explanation:

Discuss different trade policies that are currently enacted and if they should be updated in some way. Then create your own policy about an area in the economy is currently not addressed in current trade policies.

Answers

The different trade policies are Unilateral Trade Agreement, Bilateral Trade Agreements and Multilateral Trade Agreements.

What are trade policies?

Trade policies are the policies that are made related to the import and export of the goods and services between countries.

There are different trade policies such as import tariffs,  voluntary export restraints, import quotas,  export subsidies, export taxes, etc.

Thus, the different trade policies are  Unilateral Trade Agreement, Bilateral Trade Agreements and Multilateral Trade Agreements.

Learn more about trade policies

https://brainly.com/question/27622280

#SPJ1

hi! please help quickly

Which of these is an example of a theme?

the reasons why a young boy hates sports
the importance of being there for your friends
the set of challenges that a blind child faces
the problems faced by a stray pup

Answers

Answer:

the answer would be the 2nd option! (the importance of being there for your friends)

Explanation:

themes can usually fall under an umbrella of categories, like that one! but the other options are too specific to just one story

Can ……outside?

Children play

Children plays play children

Answers

Answer:

Can children play outside ?

Answer:

I believe it's can children play outside

Explanation:

It sounds most clear rather then the other ones

Other Questions
Based on what you know about portable parts, which of the following words best completes the sentence below? The test ____, was in that it covered all the information from the whole year. O A. conjoin O B. persuasive O C. militant O D. comprehensive RIGHT ANSWERS ONLY. Below are four euphemisms for the phrase in bold in the following passage. Which one best matches the tone of the passage?So I followed Goofballs directions to the joint where I was to meet the big man. Big man is right! The guy was really fat, to say the least! Man, I bet the guy could eat the back end of a cow, then wash it down with a Himalaya sundae!a. chunkyb. big-bonedc. a super porkerd. quite portly need explanation with these problems! help me please! Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko.