help me with this if possible

Answer:

Franklin took Photo 51 after scientists confirmed that DNA contained genes. Maurice Wilkins, Franklin´s colleague showed James Watson and Francis Crick Photo 51 without Franklin´s knowledge. Watson and Crick used that image to develop their structural model of DNA.

Explanation:I took that but if ya read it you will know what it is trust me.

Answer:

the point of science is to disprove hypothesis so having a hypothesis that doesn't allow that to happen is not good science

2. they don't fit in our mouths so are a trait from when we had larger jaws

3. bones of your lower jaw, middle ear and voice box (they aren't actually gills fyi, they just look like them)

4. likely yes as their bones were hollow but likely only able to fly short distances, the thought was that they couldn't do their size and weight but with hollow bones they were able to like a quail would

5. no because they could be sister taxa, you would have a hard time proving exactly that this new fossil is the common ancestor that birds came from to replace the old hypothesis (guess) of which one did.

Explanation:

Answer:

A: It is wrong to form a theory that cannot be disproven because the whole point of a theory is to test the theory and prove it.

B: Wisdom Teeth are considered to be a vestigial trait because it is passed along in genetics of humans and is a almost a 100% chance of occurrence.

C: This bird could fly because fossils and research has shown that this creature had similar bone structure to a common day bird.

D: This does not invalidate evolution because many geographic events can happen that may alter the positioning of these fossils like: Any type of corrosion or weathering, or maybe ancient civilization have dug up these fossils and then they were reburied.

Explanation:

For C you can look up archaeopteryx and find an article for evidence

Answer:

Answer:

Hydrogen bond

Explanation: Pretty much just a type chemical bond

Answer:

prophase, metaphase, anaphase and telophase

Explanation:

The cell membrane pinches in and eventually divides into two daughter cells.

Answer:

a heritable characteristic that evolves

Explanation:

The best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.

An adaptation is a feature or characteristic of an organism that helps it to be able to survive in its environment.

Adaptations are important to an organism in order for it to grow and reproduce in its environment.

For example, polar bears have thick furs to enable rhem survive the cold environment of the polar regions.

Therefore, the best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.

Learn more about adaptation at: https://brainly.com/question/29594

Answer: The correct statements are 1 and 2:

1.Self-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant.

2.Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species.

Explanation:

Pollination is the transfer of pollen grains from an anthers to a receptive stigma. In most species of flowering plants, external agents bring about pollination. Also, flowers have evolved special structures and mechanisms to ensure successful pollination.

There are two types of pollination

--> Self pollination: This takes place when mature pollen grains from the anther of a flower fall on the stigma of the same flower or that of another flower on the same plant. This type of pollination brings the male gametes and egg cells of the same plant together. The resultant offspring show very little genetic variation.

--> Cross pollination: This occurs when mature pollen grains of a flower are transferred to the stigma of a flower of another plant of the same or closely related species. This brings the male gametes and egg cells of two different parent plants together. Therefore, there is greater genetic variation among the offspring.

Answer:

False

Explanation:

you only need like 6 lol

Answer:

All life we know of on Earth is mostly based on molecules containing the element carbon.

True.

Explanation:

Answer:

No I think its C

Explanation:

Photosynthesis is a process that takes place due to water, sunlight, carbon dioxide and creates oxygen.

All the green plants carry out the process of photosynthesis in the presence of sunlight, the carbon dioxide, and water.  

Giving out the chemical energy in the form of sugar and air to breathe. Hence the correct option is C.

Learn more about the Photosynthesis uses all of the following except.

brainly.com/question/21413948.

Answer:

More than 8.7 million species are living on the planet. Every single species is composed of a cell and it includes both single-celled and multicellular organisms.

The cells provide shape, structure and carries out different types of functions to keep the entire system active. The cell contains different functional structures which are collectively called Organelles, and they are involved in various cellular functions.

Also Read: Difference between organ and organelle

Let us learn more in detail about the different types and functions of Cell Organelles.

Table of Contents

What are Cell Organelles?

List of Cell Organelles and their Functions

Plasma Membrane

Cytoplasm

Nucleus

Endoplasmic Reticulum

Mitochondria

Plastids

Ribosomes

Golgi Apparatus

Microbodies

Cytoskeleton

Cilia and Flagella

Centrosome and Centrioles

Vacuoles

A Brief Summary on Cell Organelles

Answer:

False

Explanation:

The number of chromosomes is doubled during mitosis, but each daughter cell (new cell) has the same number as the mother (original cell)

Mitosis is a cell division cycle in which the parent cell divides to produce equivalent daughter cells. It can occur in the body for growth, replacing dead cells etc.

The statement is False.

The sentence can be explained as:

Therefore, chromosomes do not get doubled at the end of the division.

To learn more about mitosis follow the link:

https://brainly.com/question/17364997

Answer:

Explanation:

Frogs:

Frog's evolutionary pathway resembles the water cycle. This is quite fitting, because all frogs statistically enjoy bodies of water. Seafrogs absorb salt-water through holes, which emit inside the snout. First, they grow two limbs, or legs, to swim. These turn into fins, which, eventually, allow for hopping and balancing-capacity. Capabilities, include: tongue-roll, sticky toes, bubbly neck, multi-eggs, and more

Frogs are incredibl(y) mammalian(s)!

Answer:

A

Explanation:

The end result of repeated experiments supporting a hypothesis is for the hypothesis to become a theory.

In science, a hypothesis is a general statement that needs to be validated or invalidated by experiments. Once a hypothesis is found to be valid by several independent but similar experiments, such a hypothesis becomes a theory.

Formulation and testing of hypotheses (via experiments) represent two of the key steps in the scientific method.

The correct option is A.

A cactus plant, a snake, and a hawk can be members of the same called community.

Community ecology is an expanding and wealthy subfield of ecology. Ecologists examine the factors that impact biodiversity, community system, and the disbandment and surplus of species.

These characteristics include relations with the abiotic world and the diverse array of interactions that occur between species.

Thus, a cactus plant, a snake, and a hawk can be members of the same called community.

To learn more about the community click here:

https://brainly.com/question/18100115

Answer:

nitrogen gas, dentrification

Explanation:

APES class

Nitrates are the compounds that are converted back into the atmospheric nitrogen and the process is called as denitrification. The atmospheric nitrogen is given back to atmosphere and the composition of nitrogen is the most highest in the atmosphere.

The atmospheric nitrogen is the highest amount in the atmosphere that  is 78% where the nitrogen is present in different forms.

The process where the ammonia and the nitrates along with the nitrites are given back to the atmosphere via nitrification, ammonification and denitrification. There are certain bacteria in the atmosphere as well that fix the nitrogen.

Rhizobium and Nitrobacter are the bacteria that help to fix the nitrogen present in soil as well. Nitrogen fixing bacteria is present in the root nodules of gram plant.

Learn more about denitrification at :

https://brainly.com/question/13624886

#SPJ2

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

During transcription, a specific DNA sequence is used as template to synthesize a specific RNA sequence, usually a messenger RNA (mRNA). During this process (transcription), Uracil (U) bases replace Thymine (T) bases. Transcription has three stages: initiation, elongation and termination. Subsequently, the resulting mRNA is used to synthesize a protein, in a process known as translation.

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

Answer:

malleability

Explanation:

ce caps

What property of metals allows it to make coins the same thickness?2 malleability

A chemical reaction produces two new substances, and each product has a mass of 25 grams. What was the total mass of the reactants?3 50 gram

Answer:

Nervous System

Explanation:

The nervous system works to send signals throughout the body. The Nervous System: Doctors estimate that every person has about 100 billion neurons in their brain, which are responsible for sending and receiving messages.

Answer:

Food provides the glucose that is a reactant in cellular respiration.

Answer:

This is a math question not a biology question

Answer:

Explanation:

the germ theory explains why they might not have known

Answer:

Animalia

Explanation:

Answer: A evolution is a process in which someone/something upgrades over the course of time. It usually leads to improvement in lifestyle of that species/thing.

Explanation:

Answer:

1. and 2. only

Explanation:

rRNA is sometimes called a ribozyme or catalytic RNA.

Molecules of rRNA are synthesized in a specialized region of the cell nucleus called the nucleolus, which appears as a dense area within the nucleus and contains the genes that encode rRNA.

mRNA is Messenger RNA which are synthesized during DNA transcription as templates for the production of a specific proteins.

The molecules are produced during transcription are - Messenger RNA and Ribozymes that is - I and II only.

Transcription is the first step in decoding a cell's genetic information. During transcription, enzymes called RNA polymerases build RNA molecules that are complementary to a portion of one strand of the DNA double helix

thus, The molecules are produced during transcription are - Messenger RNA and Ribozymes that is - I and II only.

Learn more about transcription:

https://brainly.com/question/11430054