Hello please help me I am putting 90 points please

Hello Please Help Me I Am Putting 90 Points Please

Answers

Answer 1

Ties to Soviet officials, beliefs about communism and its containment, and application of military force and technology. There were some similarities and variations between the two presidents' strategies.

How did Dwight D. Eisenhower handle the Cold War?

From 1953 through 1961, the Eisenhower administration concentrated on the Cold War with the Soviet Union and its satellites. To stave off military threats and save money while reducing the number of expensive Army combat units, the United States accumulated a stockpile of nuclear weapons and nuclear delivery systems.

How did the strategies for the Cold War differ under Truman and Eisenhower?

Both Truman and Eisenhower supported civil rights and worked to eradicate communism, but Eisenhower focused more on domestic civil rights concerns while Truman placed more emphasis on foreign affairs and the American economy.

To know more about Soviet visit:-

https://brainly.com/question/12497750

#SPJ1


Related Questions

Choose one of the goals listed in the Preamble. How do you think creating rules for a new government to follow could help meet that goal?

Answers

One of the goals listed in the Preamble is to promote the general welfare. Creating rules for a new government to follow could help meet this goal.

Creating rules for a new government to help achieve this goal by ensuring that the government is structured in a way that allows for the efficient and equitable distribution of resources and services that promote the well-being of all citizens. For example, the government could enact policies ensuring that all citizens, regardless of socioeconomic status, have access to healthcare, education, and basic necessities. By enacting rules and regulations that priorities the general welfare, the government can help to reduce poverty, improve public health, and create a more equitable society. Furthermore, these rules may ensure that the government operates in a transparent and ethical manner, which can aid in the development of public trust and civic engagement, thereby promoting the general welfare of the population. One of the goals listed in the Preamble is to promote the general welfare. Creating rules for a new government to follow could help meet this goal.

Learn more about Preamble:

https://brainly.com/question/28959887

#SPJ1

the principles of Utilitarian theory.

Answers

Answer:

Explanation:

Utilitarianism is an ethical theory that was first proposed by philosophers like Jeremy Bentham and John Stuart Mill in the 18th and 19th centuries. The basic principle of Utilitarianism is that an action is considered morally right if it results in the greatest amount of happiness or pleasure for the greatest number of people affected by the action. Here are the key principles of Utilitarian theory:

The principle of utility: This is the central principle of Utilitarianism. It states that an action is morally right if it maximizes happiness or pleasure and minimizes suffering or pain for the greatest number of people affected by the action.

The greatest happiness principle: This principle states that the goal of human action should be to promote the greatest amount of happiness or pleasure for the greatest number of people.

The consequentialist principle: Utilitarianism is a consequentialist theory, which means that it evaluates the moral worth of an action based on its consequences. The consequences of an action are more important than the intentions behind the action.

The impartiality principle: Utilitarianism holds that all people's happiness and suffering are equally valuable, and therefore, moral decisions should be made impartially, without favouring any particular individual or group.

The aggregation principle: Utilitarianism assumes that happiness and suffering can be quantified and compared, and therefore, the moral value of an action can be determined by adding up the total amount of happiness or pleasure produced and subtracting the total amount of suffering or pain produced.

The utilitarian calculus: In order to determine the moral value of an action, Utilitarianism requires a calculation of the expected consequences of that action for all parties involved. The utilitarian calculus involves considering the intensity, duration, certainty, and extent of the happiness or suffering that will result from an action.

Overall, Utilitarianism is a consequentialist ethical theory that prioritizes the greatest happiness and pleasure for the greatest number of people, while minimizing suffering and pain.

PLS MARK ME BRAINLIEST

How does the paragraph help develop Burnett ideas?

Answers

Burnett's ideas on mindset development are based on decades of research in psychology and education.

What is development?

Development refers to a process of growth and change that results in an improvement in the quality of life of individuals and society as a whole. It encompasses a wide range of economic, social, political, and environmental factors that contribute to the well-being of people. Economically, development involves increasing productivity, expanding employment opportunities, and improving access to basic needs such as food, water, and shelter. Socially, development entails promoting equality, justice, and human rights, as well as enhancing health, education, and cultural diversity. Politically, development means creating a stable and transparent governance system that encourages citizen participation and protects the rights of minorities. Environmentally, development aims to achieve sustainable resource use and mitigate the impact of climate change. Overall, development is a multifaceted process that seeks to create a fair, inclusive, and sustainable society.

To learn more about development, visit:

https://brainly.com/question/30867645

#SPJ1

Students will choose a position on a controversial issue and fill out the graphic organizer below.

Make certain you refer to the definitions below for clarification.
Definitions/Examples


Claim—taking a position on an issue. A claim can be a thesis for an essay. When writing a claim, you do not begin the sentence with “I think, I feel, or I believe”.
Examples:
The death penalty should be allowed in every state.
Write your own amendment and defend it.
Should reproductive rights be protected by the federal government or the state government?
Should there be censorship on social media and Tik-Tok?
Is it the responsibility of the federal government to improve prison conditions or are they fine the way they are now?
Should immigration be restricted?
Should professional athletes be allowed to make more money than the President of the United States?
Black Lives do Matter.
College student loans should be forgiven by the government.
Police brutality against minorities has gotten out of control.
Global warming/climate change must be addressed now to save future generations.
Gun control should not be enforced.


Evidence—Proof of your claim. Remember, evidence can be a sentence from the text, a direct quote, or an inference (an educated guess).

Counterclaim: an opposing claim; opposite point of view.

*Thesis (Claim):


*Two statements supporting your thesis:

1.

2.

*One statement supporting the opposite of your thesis:



2. Restate your claim and summarize your reasoning.

Answers

Explanation:

Claim—taking a position on an issue. A claim can be a thesis for an essay. When writing a claim, you do not begin the sentence with “I think, I feel, or I believe”.

Examples:

The death penalty should be allowed in every state.

Write your own amendment and defend it.

Should reproductive rights be protected by the federal government or the state government?

Should there be censorship on social media and Tik-Tok?

Is it the responsibility of the federal government to improve prison conditions or are

help please anyone its due right now

Answers

In the assigned video, Mother Tynnetta Muhammad highlights the significance of comprehending and harnessing the power of our minds to achieve our goals and fulfill our life's purpose.

What is  Mother Tynnetta Muhammad saying?

She states that the mind is a potent tool that can be trained and enhanced through discipline and consistent practice, just like how we train our bodies through exercise. Additionally, she stresses the importance of seeking knowledge from experts in our areas of interest and learning from their experiences.

To me, this video holds importance as it reinforces the notion that we can shape our own destinies through our thoughts and actions. It also emphasizes the value of continuous learning and seeking guidance from those who have already achieved what we aspire to.

Therefore, From watching the video, several points caught my attention such as: The concept of training the mind as we would train the body stood out to me as a fascinating and valuable idea. Furthermore, the emphasis on seeking knowledge from experts and learning from their experiences resonated with me. I found the idea of aligning our actions with our life's purpose and utilizing our abilities and talents to make a positive impact on the world inspiring. Lastly, the concept of mental transcendence and the power of the mind to overcome limitations was intriguing.

Read more about Scientists  here:

brainly.com/question/458058

#SPJ1

See text below

link for 20 Year Training Directly From The Scientists from Mother Tynnetta Muhammad:

Question 1: Describe: Briefly summarize what you have learned from the assigned video and discuss why these are important to you. (Max 250 word count.)

Question 2: List -four things that stood out to your from watching the video.

Bullet point 1

Bullet point 2

Bullet point 3

Bullet point 4

How did the Atlantic Slave trade impact Africans?

Answers

Millions of Africans were evicted from their homes, and cities and towns were deserted. Many Africans were shot down or sold into slavery in Africa as a result of slaving wars.

Based on the map, which statement best summarizes the oil industry in Texas into the 20th century?


Responses

A) Many of the oil wells found in Texas were located in the North Central Plains of Texas.

B)Texas became the most popular U.S. state due to the amount of oil discovered.

C)Oil wells in Texas were discovered in the late 1800s through the early 1900s.

D)Several new oil fields are still being discovered, increasing the industry in Texas.

Answers

The easiest way to sum up the Texas oil business in the 20th century is to say that Texas rose to become the most populated state in the union as a result of how much oil was found there.

How has Texas' economy changed since oil was discovered there?

Opportunities were provided to Texas by the oil business. Texas evolved became the nation's hub for oil exploration and production. Cities grew up in a lot of rural areas. There were new job categories made.

How long has oil been produced in Texas?

When Spanish explorer Luis de Moscoso of the DeSoto expedition first discovered oil in Texas in July 1543, it was in the Galveston Bay, between High Island and the Sabine Pass, close to Port Arthur.

To know more about Texas visit:-

https://brainly.com/question/13104506

#SPJ1

Which best describes Babylonian law under Hammurabi ?
A. It was made up by local judges.
B. It was universal throughout the empire.
C. It did not include punishments.
D. It treated everyone equally

Answers

I think it is b

I hope that this helps you

which life experience would most
likely cause a shift in a person's political ideology?
SELECT AN ANSWER
O attending college
O going on vacation
O starting a new career
O discovering a new hobby
SUBMIT

Answers

Education, gender, occupation, family, etc. Some of them. The "family", one of these factors, is the most important institution in which all social and political processes are inherited since the birth of the individual. A lot of research reveals that the family of an individual adopts and maintains political attitude.

Many people believe a judge who acts as a 13th juror gives unchecked power to state judges. In your opinion, should state governors push legislator to change the practice of judges being allowed to act as a "13th Juror".
Directions: Write 3-6 sentences explaining your answer.

Answers

In my opinion, the practice of allowing state judges to act as a 13th Juror should not be allowed, as it does indeed give them unchecked power in the courtroom.

What is courtroom?

A courtroom is a formal location where trials and other legal proceedings take place. This is where the judge, jury, lawyers, and other parties involved in a case will meet to present evidence, make arguments, and ultimately decide the outcome of a legal dispute. During the proceedings, the judge will serve as the presiding officer and ensure all parties adhere to the laws and court rules of procedure.

It is important to maintain the separation of powers between the executive, judicial and legislative branches of government, and allowing judges to act as jurors compromises this balance of power. As such, I believe state governors should push their legislators to change the practice and ensure that all trials are judged by a panel of twelve jurors. Doing so would ensure that justice is served and that the rights of both plaintiffs and defendants are respected and upheld.

To learn more about courtroom
https://brainly.com/question/30287423
#SPJ1

BRAINLIST! Help pls According to NELP, why is inequality a problem? Inequality-not paying people equally.

Answers

Answer: Inequality is a drag on economic growth and fosters political dysfunction, experts say. Concentrated income and wealth reduces the level of demand in the economy because rich households tend to spend less of their income than poorer ones. Reduced opportunities for low-income households can also hurt the economy.

Explanation: there You go

Disparities in opportunity have an effect on life expectancy as well as access to necessities like healthcare, education, clean water, and sanitization. They can limit someone's human rights by treating them unjustly, abusing them, or interfering with the legal process.

Why is social disparity a problem?

According to analysts, inequality hinders economic progress and encourages political dysfunction. Concentrated wealth and income lower economic demand because wealthy families typically spend a smaller percentage of their income than do impoverished households. The economy may suffer from fewer chances for low-income households.

When people are not treated equally depending on their financial situation and employment chances, what type of inequality is that?

The unequal distribution of money and opportunity among distinct socioeconomic groups is known as economic inequality. It is a worry for almost every country in the globe, and many individuals are locked in poverty with little prospects to rise in society.

Learn more about economic inequality: https://brainly.com/question/30239024

#SPJ1

What is the answer for number 33

Answers

Answer:

10 + 23

Explanation:

hope it helped you

Do you agree or disagree with the recent calls, (including former presidents Obama and Trump, and now president Biden), to end filibuster? Explain your answer.

Answers

President Joe Biden said Thursday at the first formal press conference of his presidency that he agreed with former President Barack Obama that the filibuster was "a relic from the Jim Crow era,".

 

Who are filibusters?

A filibuster is a Senate rule that requires 60 votes to end debate on most laws, effectively allowing a small number of senators to block legislation from passing.

Some argue that filibusters encourage compromise and bipartisanship because they must pass laws by overwhelming majority, while others argue that they are undemocratic, impeding progress and allowing minorities to hijack the legislative process.

Calls to end filibusters have increased in recent years, with some claiming minority political parties are using filibusters to thwart important laws.

Some argue that it would give too much power to the majority party and could prompt a rapid shift in policy with each new government.

Ultimately, whether to end the filibuster is a complex issue, and there are valid arguments on both sides.

Policy makers and citizens must weigh the pros and cons and make decisions based on what they believe is best for the country.

To know more about filibusters, visit:-

https://brainly.com/question/31180335

#SPJ9

history of china's great wall​

Answers

Answer:

The Great Wall was continuously built from the 3rd century BC to the 17th century AD on the northern border of the country as the great military defence project of successive Chinese Empires, with a total length of more than 20,000 kilometers. The Great Wall begins in the east at Shanhaiguan in Hebei province and ends at Jiayuguan in Gansu province to the west. Its main body consists of walls, horse tracks, watch towers, and shelters on the wall, and includes fortresses and passes along the Wall.

The Great Wall reflects collision and exchanges between agricultural civilizations and nomadic civilizations in ancient China. It provides significant physical evidence of the far-sighted political strategic thinking and mighty military and national defence forces of central empires in ancient China, and is an outstanding example of the superb military architecture, technology and art of ancient China. It embodies unparalleled significance as the national symbol for safeguarding the security of the country and its people.

Loss of manufacturing jobs and rollback of government protections most
likely contributed to:
A. a decline in services being provided in cities.
B. increased poverty rates for Black people living in cities.
C. a rollback for civil rights protections for low-income people.
D. the rise of the Black middle class in suburban areas.

Answers

B. Increased poverty rates for Black people living in cities.

The loss of manufacturing jobs and rollback of government protections have had a significant impact on urban areas, particularly on the Black community. As manufacturing jobs moved overseas or were automated, many urban residents lost their jobs, making it harder to find good-paying jobs. The rollback of government protections also left many low-income people, including Black people, without the support they needed to make ends meet. This has contributed to increased poverty rates for Black people living in cities. The decline in manufacturing jobs also led to a decline in the availability of good-paying jobs in urban areas, making it harder for Black people to achieve upward mobility and contributing to the persistence of racial and economic inequality.

Final answer:

The decline in manufacturing jobs and the rollback of government protections have likely led to increased poverty rates among Black urban dwellers due to the loss of stable income sources and diminishing job security.

Explanation:

The loss of manufacturing jobs and the rollback of government protections most likely contributed to increased poverty rates for Black people living in cities. When manufacturing jobs decrease, it has a domino effect on local economies. Such jobs often provide a steady income and benefits and are vital to lower and middle-class families. Additionally, government protections, such as labor laws and regulations aimed at providing job security and promoting equality, are incredibly important. If these protections are rolled back, it could lead to higher rates of unemployment and lower wages, disproportionately affecting already vulnerable populations, such as Black residents of cities.

Learn more about Poverty here:

https://brainly.com/question/32412332

#SPJ2

What tax policies did the Han dynasty create to fund the government?

All citizens were taxed, but some groups like merchants had to pay higher taxes.
Citizens living in poverty paid the most taxes because they needed the most services.
Elite citizens were exempt from taxes, as they provided for their own well-being.
Most citizens were taxed based on their social status and ability to provide for others.

Answers

Answer:

Explanation:

The tax policies of the Han dynasty were primarily based on the principles of social status and the ability to provide for others. The government collected taxes in the form of labor, goods, and money, which were used to fund the imperial bureaucracy, military, and public works projects. Here are some specific tax policies implemented during the Han dynasty:

Taxation based on social status: The Han dynasty divided its citizens into four social classes, with each class paying a different tax rate. The highest class, which included scholars and officials, were exempt from taxes, while the other classes paid taxes in the form of labor or goods.

Taxation of merchants: The Han government taxed merchants and traders at higher rates than other citizens. This was because merchants were seen as less productive members of society who profited from the labor of others.

Taxation based on ability to pay: Citizens living in poverty paid the most taxes because they were required to provide a certain amount of labor or goods to the government regardless of their income level. This policy was designed to ensure that everyone contributed to the needs of society.

Land tax: The government also collected taxes in the form of land, which was measured based on the quality and productivity of the land. Landowners were required to provide a certain amount of labor or goods based on the size and productivity of their land.

Overall, the Han dynasty created a complex system of taxation based on social status, ability to pay, and productivity. While the tax policies were designed to fund the government and provide for the needs of society, they also perpetuated inequality and favored the wealthy and powerful.

what is the proper balance with national security rights and individual rights​

Answers

The freedom of association

By 1864, Lincoln had chosen as his General - in - Chief to command the war effort:

A- Ambrose Burnside

B- Stonewall Jackson

C- Robert E Lee

D- Ulysess Grant

Answers

Answer:

D- Ulysses Grant

Explanation:

In March 1864, President Lincoln appointed Ulysses S. Grant as General-in-Chief of the Union Army, giving him overall command of all Union armies fighting in the Civil War. Lincoln chose Grant because of his aggressive tactics and his ability to lead and coordinate large armies. Grant had already achieved significant victories in the western theater of the war and was known for his determination and perseverance. Lincoln believed that Grant could bring the war to a close and end the Confederacy's rebellion. Grant went on to implement a strategy of total war, which helped bring about the eventual Union victory in 1865.

The____ was a burtal and terrifying journey that carried ____ to the Americas

1st blank options:
a)western route
b)middle passage silk road
c)silk road

2nd blank:
a)enslaved Africans
b) raw materials
c)manufactured goods​

Answers

1. Middle Passage 2. enslaved Africans

Answer: 1. Middle Passage 2. Enslaved Africans

Explanation: Plato

Discuss your environmental reaction based on the discussion/lecture made by AL Gore
from the documentary film an inconvenient truth . Relate it at present environmental condition.

Answers

My environmental reaction to the discussion/lecture made by Al Gore in the documentary film An Inconvenient Truth is one of great concern.

Gore's presentation was very sobering and thought-provoking, as he highlighted the very real and serious environmental issues we are currently facing and the need to take action now. Gore pointed to the increase in global temperatures and the melting of the polar ice caps as some of the most pressing issues, and he outlined the consequences of these discussion. He highlighted how extreme weather events such as floods, droughts, and hurricanes are becoming more frequent, and how these events are likely to worsen as the climate continues to warm. He also stressed the need for us to reduce our carbon emissions in order to mitigate the effects of climate change.

To know more about discussion refer :

brainly.com/question/617725

#SPJ1

PLEASE HELPPP
I will mark brainlist to whoever answers first
Read all of "Letter from
Birmingham Jail" written by Mather King Jr and Write 3 analytical paragraphs that explain allusion include evidence from the text

Answers

Answer: Here it is!

Explanation:

Dr. King’s letter from Birmingham jail was a letter that defended the strategy of nonviolent actions, which argued people naturally had the urge to break unjust laws. While king was in jail, an ally smuggled in a newspaper that contained an article called “A Call for Unity” which provoked king to write a response to the clergymen criticizing his methods. However, even though the article was written by clergymen in which Dr. King understood their importance and status in the church, Dr. King still managed to write the letter to them in a scholarly way. From another point of view, Malcom X, human rights activist, delivered his public speech at Cory Methodist Church in Ohio. Malcom X separated from the Nation of Islam, which had disagreements …show more content…

King opens this letter with addressing the clergymen who criticized his actions during protests in Birmingham. Dr. King refers to their claims of him being an “outsider” and defends himself in a straightforward tone, and explains that he was there because of his organizational ties with the SCLC who asked for his nonviolent action program to fight the injustice in Birmingham. Dr. King believed that all cities and towns should work together and all carry the same amount of freedom and justice wherever it is practiced. All states should work together as they all have commons and are interrelated. Dr. King states, “If injustice is practiced somewhere, then it threatens justice everywhere.” Dr. King’s process in taking nonviolent action is in four steps: collecting facts to determine where the injustice is present; negotiation; self-purification; then direct action. The steps already have been taken and he implies racial injustice covers the community. The Negro community has waited for their justice, for a while actually. The word “Wait!” became “Never!”, as they have waited almost 340 years for their justice. There are two types of laws, just and unjust laws. Everyone has a moral responsibility to follow just laws, but the opposite with unjust laws. Dr. King states, “An unjust law is no law at all”. He criticizes the white moderates and believed that they were the largest obstacle in obtaining their justice. Dr. King hopes the community will eventually see the justice of

The Dixiecrats were one of the major dishonesties within the system. The Dixiecrats were basically southern democrats, but they were given a name as they were a group that basically controlled the smaller committees that ran the government. The Dixiecrats had seniority because they originated from a state where the Negro can’t vote. Malcom X asks, “Why can’t they simply pass something that will help you and me?” The issue here is the house, especially the Dixiecrats, hold the bills like a giant con game that they call a filibuster. A filibuster is the right to unlimited debate.

I hope this is what you wanted, and I hope this helped you. A brainilist would be extremely appreciated! <3

Refer to the map below to answer the following question:

A map image of ancient China is shown. The region is divided into sections. The map shows the population change over a period of time in China. In the northeast, the population has decreased. In the northwest, the population has increased slightly or remained the same. In central and south China, the population has increased considerably. In the southeast, the population reached the highest level of increase.

In what part of China did the population decrease the most?

In the northeast
In the northwest
In the southeast
In the southwest

URGENTTTTT PLS ANSWER FAST!!!!!!!!!!!!

Answers

The northeastern region of ancient China is where the population shrank the most, as can be seen from the map.

In what part of China did the population decrease the most?

Compared to other areas of China, this region saw a significant decline in population over time. Natural disasters, climate change, or inter-human conflicts may be to blame for this decline in population. On the other hand, the population of central and southern China increased significantly, which can be attributed to elements like a good climate, a supply of resources, and better living conditions. China's northwest saw a slight rise in population or stayed about the same, showing stable population growth over time. China's southeast region saw the largest population growth, which may be related to the area's economic growth and development.

To Know more about China Visit:

brainly.com/question/9695945

#SPJ1

The Yangtze River, also known as the Yangtze River (English: Yangtze River), was called Jiangshui and Dajiang in ancient times, referred to as Jiang. It is the longest river in Asia and the third longest river in the world. The main stream originates from Geladandong Peak in the Tanggula Mountains in the eastern part of the Qinghai-Tibet Plateau, passes through southwest China (Qinghai, Tibet, Yunnan, Sichuan, Chongqing), central (Hubei, Hunan, Jiangxi), and eastern (Anhui, Jiangsu), and enters Shanghai East China Sea. The Yangtze River Basin covers one-fifth of the land area of ​​mainland China and supports one-third of the population of mainland China. The Yangtze River Economic Belt is also one of the largest economic belts in China.

Answers

That's accurate. With a length of around 6,300 kilometres, the Yangtze River, also known as the Changjiang River in Chinese, is the third-longest river in the world and the longest in Asia (3,915 miles).

In addition to serving as a crucial transit route, it provides China with water for farming and hydroelectric power.

Almost one-fifth of the land area of mainland China, or 1.8 million square kilometres (695,000 square miles), is covered by the Yangtze River basin. A third of China's population lives in the basin, including several of the country's major cities including Shanghai, Chongqing, and Wuhan.

To encourage economic growth and development in the Yangtze River basin, the Chinese government has proposed the Yangtze River Economic Belt. Through promoting sustainable development via environmental preservation, innovation, and modernization, the policy intends to integrate the economies of the riverside areas.

To know more about Yangtze River

https://brainly.com/question/18597024

#SPJ1

2.) State the greas es interation among people of Centre of Civilisation in pre-Colontal Nigeria​

Answers

The pre-colonial period in Ni g e ria was characterized by the existence of various centers of civilization, each with its unique culture, beliefs, and social organization.

How close were the people?

The people of these centers of civilization interacted with each other through trade, intermarriage, and cultural exchange. The exchange of goods and services was a significant part of their interaction, and it led to the development of trade routes and markets.

The exchange of ideas and beliefs also occurred, leading to the adoption of new practices and the adaptation of existing ones. This interaction fostered unity and diversity among the people of N i g e ria, contributing to the richness of their cultural heritage.

Read more about colonization here:

https://brainly.com/question/510352

#SPJ1

The decorations of independence was once used To govern The united states of america True or false

Answers

Answer:

True.

Explanation:

The Declaration of Independence was a document adopted by the Continental Congress on July 4, 1776, which announced that the thirteen American colonies then at war with Great Britain were now independent states, and thus no longer a part of the British Empire. It played a crucial role in the American Revolution and the formation of the United States of America. Although it is not a governing document, it has served as a source of inspiration for the country's founding principles and ideals.

What is a widespread criticism of representative democracy?
A. The representatives become the elites
B. The people have no power
C. The representative becomes monarchs
D. The voices of the people go unheard

Answers

Unpredictability in politics. Democracy has recently come under fire for lacking adequate political stability. The policies of democratic nations constantly shift both domestically and internationally since governments are frequently elected and deselected.

What is meant by Democracy?In a democracy, the populace has the power to enact legislation and select the individuals who will represent them in that capacity. Given that "democracy" is derived from the Greek words "demos," which means "people," and "Kratos," which means "power," it can be described as the "power of the people" and refers to a form of government that is based on popular desire. The term "constitutional" alludes to the fact that the Constitution, which serves as the ultimate law of the United States, serves as the foundation for American governance."A state where the people and their elected representatives hold ultimate power and where the president is chosen by the people or appointed by them rather than being a monarch."

To learn more about Democracy, refer to:

https://brainly.com/question/3710021

Character
Earhart
Putnam
Description
Evidence.

Answers

Answer:

Character: Amelia Earhart

Description: Amelia Earhart was an American aviation pioneer and author who was the first female aviator to fly solo across the Atlantic Ocean. She was known for her courage, determination, and adventurous spirit, as well as her advocacy for women's rights and gender equality.

Evidence: Earhart's many accomplishments and achievements serve as evidence of her strong character. In addition to her solo flight across the Atlantic, she set numerous aviation records and paved the way for women in the field of aviation. She was also a vocal advocate for women's rights, serving as a member of the National Woman's Party and promoting gender equality through her writing and public speaking. Her bravery and determination in the face of adversity, including surviving a plane crash and continuing to fly despite criticism and opposition, further demonstrate her strong character. Finally, her legacy as an inspiration to future generations of women and aviators is a testament to the enduring impact of her character and achievements.

Character: George Palmer Putnam

Description: George Palmer Putnam was an American publisher and author who was known for his support of aviation and his marriage to Amelia Earhart.

Evidence: Putnam's support for aviation, particularly his partnership with Earhart, serves as evidence of his character. He was instrumental in promoting and publicizing Earhart's flights, helping to secure funding and sponsorships, as well as arranging speaking engagements and book deals. He was also an author in his own right, writing numerous books on aviation and adventure, and was a proponent of progressive social and political causes, including women's rights and civil rights. Finally, his dedication to Earhart and their marriage, despite the challenges of their respective careers and the pressures of public scrutiny, demonstrates his loyalty and commitment as a character trait.

Explanation:

Uncle Tom’s Cabin was made into a play. Which do you think left a more powerful impression on Northerners: the play or the book?

Answers

The play, due to the visuals.

Answer:

Uncle Tom's Cabin was a best-selling novel that had a significant impact on the public opinion of slavery in the United States. The book's vivid descriptions of the harsh realities of slavery and the suffering of enslaved people helped to build sympathy for them in the North and abroad.

The play, on the other hand, had a more immediate impact as it was a visual and emotional experience that allowed people to see the characters and the events of the story come to life on stage. The play was able to reach a larger audience and generate more discussion and debate about the issue of slavery in the United States.

Overall, both the book and the play were important in shaping public opinion on the issue of slavery and were influential in the abolitionist movement.

Explanation:

What were the segregation laws enacted in the South after Reconstruction called?

A. Jim Crow Laws
B. Voting Rights Act
C. Separate But Equal laws
D. Poll Tax

Answers

Answer: A. Jim Crowe Laws

Explanation:

When Marshall says that the problems of racism have not been solved, to what was he referring?

Answers

Plessy v. Fergusson had been overturned, so what was Marshall alluding to when he said that the issues surrounding racism had not been resolved. Nowadays, integrating schools was a difficulty.

What obstacles did the civil rights movement have to overcome?

They were prohibited from using public facilities, denied the right to vote, and subjected to violence, including lynchings, throughout most of the South. Moreover, they could not rely on the courts to provide justice. To the North,

Who fought against the civil rights movement?

Leading the opposition to civil rights were elected officials, journalists, and community figures who shared racist ideas, closed down public parks and schools to stop integration, and incited violence against civil rights advocates.

To know more about racism visit:-

https://brainly.com/question/12395639

#SPJ9

Other Questions
which of the following is an internal control procedure used to safeguard a company's assets? multiple choice all of these answer choices are correct segregation of duties depositing cash receipts in a bank on a timely basis preparing a bank reconciliation what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3