He doesn't fancy ............ beach volleyball because he hates sand. (play)

Answers

Answer 1

Answer: playing

Explanation:

Answer 2
he doesn’t fancy playing beach volleyball because he hates (the) sand

Related Questions

Topic: Grammar
Progress
Que:
The movement of the progress bar may be uneven because questions can be worth more or less (including zero) depending on your answer
Read this sentence.
Liza bakes four dozen chocolate cookies each year for the bake sale.
Which of the following answers shows the subject and main verb in this sentence?
O subject: dozen; verb: four
O subject: cookies, verb: chocolate
O subject: year: verb: sale
subiect Liza: verb: bakes

Answers

Answer:

subject: Liza, Verb: bakes

Explanation:

a verb is an action someone is doing, and the subject is who is doing that action. Liza Bakes, so Liza is the subject and the thing that she does is bakes.

Subject: Liza; Verb: bakes. Therefore, option (D) is correct.

What is a verb?

In a sentence, an action or state of being can be communicated through the use of a word known as a verb. Because it gives the most important details about what is being said or depicted, it is frequently regarded as the most important component of a phrase or clause. When referring to the time at which an action took place, verbs can be expressed in a variety of tenses, including the present, the past, or the future.

In addition, verbs can be classified as transitive or intransitive, based on whether or not the action they describe requires the participation of an object. It's also possible for verbs to be regular or irregular, and this distinction is based on whether or not they follow a typical pattern of inflection. Verbs, in general, are extremely important tools for conveying meaning and constructing sentences that are comprehensible and efficient.

Learn more about verb, here:

https://brainly.com/question/30515563

#SPJ7

Answer the following Questions:
William Shakespeare lays out the first problem in the play. Before Romeo and
Juliet can fall in love, they must meet. What is is standing in the way of their meeting at this point of this play

Answers

They both come from rival families that are trying to keep them apart

Why would Swift write such a proposal?
What do believe motivated him to present such an argument?

Answers

He wished to invoke pity for the Irish and to create immense dislike for the narrator, who he wrote to be an apathetic member of the upper class. Swift was motivated to present this argument because of the economic troubles and famine the Irish were facing at the time, as well as the lack of support from the British.

What is the main purpose of this article? a. To inform people of precautions to take against the plague c. To talk about cures for the plague b. To inform people about a historically important plague d. To tell how friars dealt with the plague.

Answers

Answer:

B, to inform people about a historically important plauge.

Explanation:

Got it right on edge.

What goal are you setting for yourself to finish the year strong?

Answers

Answer:

read more, drink more water, stop complaining

Explanation:

The moon has no wind, no weather, and no people. Because of this, these objects have all been sitting there undisturbed for decades.

Combine these two sentences into one sentence that starts with Because.

Answers

Answer:

Because the moon has no wind, no weather, and no people, these objects have all been sitting there undisturbed for decades.

My side of the mountain
What food does the narrator find after losing track of the crow?

Answers

Sam finds a patch of dogtooth violets.

What is one feature you believe all poems should have

Answers

Answer: meter, rhyme, form, sound, and rhythm (timing). Different poets use these elements in many different ways.

Explanation:

Answer:

A good poem is a symptom of the author's effort to make sense of the world. And often, ideas that can't be expressed in prose can sometimes be expressed through strong images. A good poem often uses clear, memorable, concrete images to make a point.

Explanation:

hope this helps

NEED ANSWER ASAP

Vivian is writing instructions for a visitor guide to a public garden. Which three statements are written in the imperative verb mood, or as direct commands?

Entry to the garden is restricted. You’ll need a ticket to visit the greenhouse. The orchid displays are on the right as you exit the greenhouse. Keep to the left side of the path. There may be several water sprinklers in some areas. Watch out for sudden sprays. Most of the paved areas are open to the public. Do not walk on the grass. If you wish to take home some seedlings, you can fill out a form available at the central gate.


Options are
A) Entry to the garden is restricted.
B) Keep to the left side of the path.
C) There may be several water sprinklers in some areas.
D) Watch out for sudden sprays.
E) Do not walk on the grass.

Answers

Answer:

B) Keep to the left side of the path.

D) Watch out for sudden sprays.

E) Do not walk on the grass.

Explanation:

These are telling you to do things, or are commands.

Which excerpts from Things Fall Apart provide evidence to support Okonkwo’s contradictory feelings about showing affection when the priestess takes Ezinma to the shrine of the Oracle? Select all that apply. "But the Hills and the Caves were silent as death." "Okonkwo was also feeling tired, and sleepy, for although nobody else knew it, he had not slept at all last night. He had felt anxious but did not show it." "It was only on his fourth trip that he had found Ekwefi, and by then he had become gravely worried." "Okonkwo and his wife followed at a respectful distance."

Answers

Answer:

"Okonkwo was also feeling tired, and sleepy, for although nobody else knew it, he had not slept at all last night. He had felt anxious but did not show it."

"It was only on his fourth trip that he had found Ekwefi, and by then he had become gravely worried."

Explanation:

Chinua Achebe's "Things Fall Apart" revolves around the family life of Okonkwo and in general, the life of the Igbo tribe in Africa. The novel deals with themes of family relations, traditions, beliefs, change, social transformation, colonialism, etc.

When Priestess Chielo came to take Ekwefi to the Agbala, the Oracle, Okonkwo at first pleaded to let the child sleep and they will come after that. Despite maintaining himself as a manly, 'emotionless' man in the eyes of everyone, Okonkwo still worries and cares about his family, especially in this case, for his daughter. He had not slept peacefully the previous night and now, he was looking for his wife and the priestess that took his daughter. He followed his wife who had done the same thing, following the priestess despite the curses that Chielo had uttered. Okonkwo came with a machete to replace his wife in waiting at the mouth of the cave, a sure sign of his worried state for his daughter.

Thus, the two pieces of evidence that show how worried Okonkwo was, contrary to his feelings about showing affection, are the second and third options.

"Okonkwo was also feeling tired, and sleepy, for although nobody else knew it, he had not slept at all last night. He had felt anxious but did not show it."

"It was only on his fourth trip that he had found Ekwefi, and by then he had become gravely worried."

PLS HELPPPP ME ASPAN PLSSSS !!!!!!!!!! Which shows the relationships of cause to effect?
virus is to fever as refreshment is to activity
determination is to accomplishment as carelessness is to error
ascent is to summit as amusement is to entertainment
theater is to destination as vehicle is to transportation

Answers

Answer:

B.

Explanation:

Determination causes accomplishment as an effect

Carelessness causes error as an effect.

Answer:

B. determination is to accomplishment as carelessness is to error.

Explanation:

If you stay determined, you will accomplish your goals. If you are careless, you will most likely fail. These are both cause to effect relationships.

Have a great day!

Prompt
PLEASE HELP!!( 5 paragraph essay )Writing prompt: Write an argumentative essay for or against maintaining traditional coming-of-age ceremonies, such as a quinceañera

Answers

Gurl nobody's writing an essay for 8 points

Read the sentence below, which is a run-on sentence:

The Incas were an ancient people who lived in Peru they worshiped a sun god and grew many different kinds of potatoes.

There are several ways to fix this sentence. Which is NOT a good way to fix it?
1.The Incas were an ancient people. The Incas lived in Peru and worshiped a sun god and the Incas grew many different kinds of potatoes.
2.The Incas were an ancient people who lived in Peru and worshiped a sun god. They grew many different kinds of potatoes.
3.The Incas, an ancient people who lived in Peru, worshiped a sun god and grew many different kinds of potatoes.
4.The Incas were were an ancient people who lived in Peru. They worshiped a sun god and grew many different kinds of potatoes

Answers

The answer is (A) the first one

The Incas were an ancient people. The Incas lived in Peru and worshiped a sun god and the Incas grew many different kinds of potatoes.

Who are the Incas?

The Incas were an ancient people who lived in Peru and worshiped a sun god. They grew many different kinds of potatoes. The Incas, an ancient people who lived in Peru, worshiped a sun god and grew many different kinds of potatoes.

The Incas were were an ancient people who lived in Peru. They worshiped a sun god and grew many different kinds of potatoes. The Incas were an ancient people who lived in Peru they worshiped a sun god and grew many different kinds of potatoes.

Therefore, The Incas were an ancient people. The Incas lived in Peru and worshiped a sun god and the Incas grew many different kinds of potatoes.

Learn more about potatoes on:

https://brainly.com/question/28963219

#SPJ3

Read this poem:
Roses are red,
violets are blue,
milk cows go moo,
and I like swimming.
What is the poem's rhyme scheme?
A. aabb
B. abab
C. abbc
D. abcd
O

Answers

‘ the answer is C. Cause the milk cows go moo don’t rhyme

The answer to it is option C. The correct answer is option abbc.

What is a poem ?

These are the words and feeling or the expressions expressed in poetry.

A poem's rhyme scheme is the pattern of end rhymes in its lines. It is often represented using letters of the alphabet to indicate which lines rhyme with each other. For example, if a poem has a rhyme scheme of "ABAB," it means that the first and third lines rhyme with each other, and the second and fourth lines rhyme with each other.

There are many different types of rhyme schemes, and they can be used to create different effects in a poem. Some common examples include:

AABB: The first and second lines rhyme with each other, and the third and fourth lines rhyme with each other. This is sometimes called a "couplet" rhyme scheme.

ABAB: The first and third lines rhyme with each other, and the second and fourth lines rhyme with each other. This is sometimes called a "cross" rhyme scheme.

ABBA: The first and fourth lines rhyme with each other, and the second and third lines rhyme with each other. This is sometimes called a "enclosed" rhyme scheme.

AAAA: All four lines rhyme with each other. This is sometimes called a "monorhyme" or "aaaa" rhyme scheme.

Therefore, Rhyme schemes can also be more complex, with multiple sets of rhymes or variations within a single poem.

Learn more about rhyme schemes at :

https://brainly.com/question/17419574

#SPJ7

Just look at the screenshot and asnwer ASAP

Answers

I’m pretty sure it’s D

Answer:

the answer is A

Explanation:

Dracula
by Bram Stoker (excerpt)

Then without warning the tempest broke. With a rapidity which, at the time, seemed incredible, and even afterwards is impossible to realize, the whole aspect of nature at once became convulsed. The waves rose in growing fury, each overtopping its fellow, till in a very few minutes the lately glassy sea was like a roaring and devouring monster.

1
Select the correct answer.
Which motif does Stoker use in this excerpt from Dracula?
A.
blood
B.
animals
C.
natural forces
D.
Christian iconography

Answers

Answer:

C.

natural forces

............

Stoker use natural forces in this excerpt from Dracula. So, The correct answer is C. natural forces. Bram Stoker employs the theme of natural forces to evoke a sense of dread and peril in this passage from Dracula.

The sudden and intense storm is a picture of the evil that is going to come out. The sea resembles a "roaring and devouring monster" as the waves rise in "growing fury." This symbolism implies that Dracula is a strong and dangerous being, and that the powers of nature are in his favor.

The other options are incorrect.

Although blood is a recurring theme in Dracula, it is not the main subject of this extract.

In this excerpt, animals are also referenced, but not in a symbolic fashion.

This excerpt makes no use of Christian symbolism.

To know more about natural:

https://brainly.com/question/30406208

#SPJ2

Who got into a fight? *
O Kiawa and Dave Jensen
O Lee Strunk and Rat Kiley
O Jimmy Cross and Dave Jensen
O Lee Strunk and Dave Jensen

Answers

The answer is c. Plz make sure to post a pic to we can know

The girls, how does this poem describes gender norms for women’s

Answers

Answer:

That women are objects to men and can just be thrown away when they are bored

Explanation:

What’s a verb list? Make one to, please

Answers

Answer:

is a verd list and also thx for the points

Explanation:

Be Become Been

Being Feel Grow

Is Look Remain

Seem Smell Sound

Stay Taste Turn

In 1956 he imported some African queen bees.
a
sentence
fragment

Answers

Answer:

I'm not sure I understand the question. If I'm right tho it would be a sentence fragment.

i don’t understand this question that well but i suppose it’s a sentence fragment

HELP ME PLEASEEEE!!!!!! TT

Answers

Answer:

1. easier

2. compelling

3.  hottest

4.  hardest

5.  better

6.  thrilling

7. smartest

8. the oldest

9. key

10. costs more

11. well known

12. simple

Explanation:

2.
Which of the following relative pronouns best completes this sentence? "______________ wants candy has to sneak it into the movie theater themselves!"
Whoever
He
Whomever
Whom

Answers

A⁣nswer i⁣⁣⁣s i⁣⁣⁣n a p⁣⁣⁣hoto. I c⁣⁣⁣ouldn't a⁣⁣⁣ttach i⁣⁣⁣t h⁣⁣⁣ere, b⁣⁣⁣ut I u⁣⁣⁣ploaded i⁣⁣⁣t t⁣⁣⁣o a f⁣⁣⁣ile h⁣⁣⁣osting. l⁣⁣⁣ink b⁣⁣⁣elow! G⁣⁣⁣ood L⁣⁣⁣uck!

bit.[tex]^{}[/tex]ly/3a8Nt8n

Answer:

The answer is A Whoever wants candy has to sneak it into the movie theater themselves!"

Explanation:

In a sentence, does whom replace the subject or the object?



WILL GIVE BRAINLIST



ENGLISH

Answers

you can replace the word with he or she or another subject pronoun, use who. If you can replace it with him or her (or another object pronoun), use whom.

Organizing and Outlining Your Ideas

Outline
I. ___________(1)
A. ___________(2)
B. ___________
C. ___________
D. ___________
E. ___________
II. ___________(3)
A. ___________(4)
1. ___________(5)
a. __________
b. __________
c. __________
2. __________
a. __________
b. __________
c. __________

Choose the best answer from the choices provided
a. First Point
b. First Subpoint
c. Detail
d. Introduction

Please select the best answer from the choices provided

Answers

Answer:

B. First Subpoint

Explanation:

I calculated it logically

What type of noun is the word Saturn’s as it is used in the following sentence?
Saturn’s rings are made almost entirely of ice, though they have traces of rocky material.

a.Singular noun
b.Plural noun
c.Possessive noun
d.Not a noun

Answers

I think it’s plural noun

(1) In 1751, the Philadelphia Provincial Assembly had a bell made. (2) It was for the new State House. (3) The bell weighed more than 2,000 pounds. (4) The bell was 12 feet in circumference around the bottom. (5) It came to be known as the Liberty Bell because it was inscribed with a motto about liberty. (6) Unfortunately, the Liberty Bell cracked in 1752 during a test ring. (7) To fix the bell, the Philadelphia Assembly had it recast. (8) Some people say the bell cracked again in 1835. (9) It was tolling for John Marshall’s funeral. (10) However, that is probably just a legend. (11) It is a fact that on February 22, 1846, the bell cracked again. (12) That crack could not be fixed. (13) The Liberty Bell has had a crack in it ever since. Which is the most effective way to combine sentences 8 and 9?

A.Some people say the bell cracked again in 1835 while it was tolling for John Marshall’s funeral.
B, Cracked again in 1835, some people say while tolling for John Marshall’s funeral.
C. Some people say the bell cracked again in 1835 and was tolling for John Marshall’s funeral.
D. Although some people say the bell cracked again in 1835, it was tolling for John Marshall’s funeral.

Answers

Most people frown about #4. It is a comma splice which means that 2 main clauses hung together by a comma. The better way to do it is with a ; since the two statements are unrelated. In this case it is a very fine point of grammar which is more annoying than wrong.

#1 is wrong because there is no main clause. The bell is the beginning of the main clause.

#2 is passive. It's not wrong, but the writing style could be better.

#3 <<<< answer The and is the proper way to connect 2 predicates.

If you can give me brainliest than that will be amazing. Thank You!

Which word below requires an ending of -ally instead of -ly?
Select one:
a. Glad
b. Music
c. Sick
d. Smug

Answers

Answer:

B. Music

Explanation: The bolded words are not correct when you apply -ally to them =

1. Glad-   Gladly  -Gladally

2. Music-  Musicly-  Musically

3. Sick- Sickly- Sickally

4. Smug- smugly- Smugally

Hope this helps! I can explain it in another way if you can't understand =)


Which of the following sentences uses the pronoun correctly?
A.
Dwight is a person who has trouble making up his mind.
B. Dwight is a person who has trouble making up their minds.

Answers

Which of the following sentences uses the pronoun correctly?

Answer : A.

Dwight is a person who has trouble making up his mind.

Answer:

B. Dwight is a person who has trouble making up their minds

this is correctly pronoun

I hope it's helpful for you.....

tials
Question 14 Not yet answered
Marked out of 1.00 Flag question
The population of rabbits in Phoenix Park increases in number by 11 percent each year. A survey
counted the number of rabbits in the park at the start of a particular year. If the number of rabbits counted
was K, which of the following is the correct formula connecting the current number,
N, with time t in
years since the initial count.
Select one:
0 K = N x 1.11
Ot=Nx K1.11
ON= K x 11+
O N = K x 11 xt
O N= K x 1.11%
N = K x 1.11 xt
S​

Answers

Answer:

i don't now

Explanation:

Which of the following sentences is punctuated correctly?
O Ms. Dietrich will take the company car because it's bigger than hers'
O
Ms. Dietrich will take the company car because its bigger than hers.
O O Ms. Dietrich will take the company car because it's bigger than hers.
O Ms. Dietrich will take the company car because its bigger than her's.​

Answers

Answer:

Ms. Dietrich will take the company car because it's bigger than hers.

Explanation:

The sentence that is punctuated correctly is the third option.

This is because, "it's" is properly used as it means "it is" and also the use of the pronoun "hers" is properly used.

Other Questions
PRODUCTOR11. (Circle one) Oxygen is areleased?)REACTANTof respiration? (In other words, is it needed or Determine if 0.875 is rational or irrational and give a reason for your answer. PLEASE HELP :DDDDDDDDDD Find the volume of the rectangular prisim 6cm 4cm 12cm If the vehiche has a speed of 24.0 m/s at point a what is the force of the track on the vehicle at this point? Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!!