Grammar Section Answer the questions as requested:

Help me , it’s a exam

Grammar Section Answer The Questions As Requested:Help Me , Its A Exam

Answers

Answer 1

Answer:

1) I go swimming once a week to relieve stress.

2) Took

3) So

4)Study

5) older

6)larger

7) ?

8)was

9) those

10)when


Related Questions

What does it mean to include five (5) key points with elaboration in a project?

Answers

How to Create a Realistic Project Plan in 5 StepsCollect requirements from key stakeholders. ... Define the scope of the project. ... Create a work breakdown structure. ... Define project activities. ... Sequence project activities. ...

What is Krakauer's most likely purpose in using the following epigraph?
I wished to ... find, amidst the solitude and grandeur of
the western wilds, more correct views of human nature
and of the true interests of man. The season of snows was
preferred, that I might experience the pleasure of suffering,
and the novelty of danger.
-Estwick Evans, A Pedestrious Tour
A. To show that McCandless's risk-taking behavior was not unique
B. To emphasize the importance of reading books about the
wilderness
C. To point out the problems in the thought processes of both Evans
and McCandless
D. To explore the relationship between human nature and winter
weather

Answers

I think it’s b I think so

1 Do you think we need to produce more food or change our consumption habits? Why?
2 Are you willing to pay more for locally grown food? Why or why not?

Answers

Answer:

1.Adopting new, healthier habits may protect you from serious health problems like obesity and diabetes. New habits, like healthy eating and regular physical activity, may also help you manage your weight and have more energy. After a while, if you stick with these changes, they may become part of your daily routine.

2.

Consumers Increasingly Value Local Food

Survey results from Forager show that over three-quarters of respondents would be willing to pay up to 20% more for local food.

described a time in the discussion when someone made a really good point and backed it up with strong reasons and evidence help! I have a project and it needs to be done in a hour

Answers

Answer:

Okay  time when i had a discussion when my friends had really good points about boys.

Explanation:

My explanation is thatg when someone has a really good appinion about something listen to them

1. Tim ………………go fishing with his father when he was young.
A. used to B. has used to C. is used to D. was used to

Answers

The correct answer is:

A.) used to

Revise and edit the argumentative research essay you wrote in Lesson 2, based on feedback from your peers and from your instructor. Your revised essay should show that you paid special attention to the feedback you've received and that you've made a major effort to improve the assignment. Your essay should also be as free as possible of sentence-level issues such as typos and confusing wording.

Your assignment should include the following elements:

A claim, supporting reasons, and evidence from at least five sources

An introduction paragraph, body paragraphs, and a conclusion paragraph

A counterclaim, followed by a response that supports your argument

Transitions to show how the claim, reasons, evidence, and counterclaim are related

Answers

Before you start, it can help to create a basic assignment structure. This can be as detailed as you like but the basic structure should contain your introduction points, your key arguments and points, and your planned conclusion. Expert tip: Try writing out your plan on sticky notes.

How do you start an assignment introduction?

Start with a board idea about the topic. After that narrow down the discussion to the area, you focus on in your assignment. We also need to explain why this assignment is useful and important. Then discuss briefly the tasks to be tackled and this usually includes the objectives and purpose of an assignment.

How do you start an assignment introduction?

Start with a board idea about the topic. After that narrow down the discussion to the area, you focus on in your assignment. We also need to explain why this assignment is useful and important. Then discuss briefly the tasks to be tackled and this usually includes the objectives and purpose of an assignment.

Learn more about assignments here: brainly.com/question/25950911

#SPJ2

Answer: HOPE THIS HELPS

Freedom of Speech was first established in 1791. It is the essence of freedom of religion, freedom of the press, and the right to assemble. It has not been changed, so why start now? Modifying forms of free speech is negative for the people that the amendment is designed to protect. Our freedom of speech is a privilege and is one of the reasons the United States stands out so much. Secondly, everyone should be able to express their ideas and opinions regardless if others do not agree. Freedom of speech is the right to express ourselves without censorship so individuals, companies, and so the government can't make statements that are not necessarily true.

Our first amendment is something to be grateful for and not take for granted. A report by the Committee to Protect Journalists states, "All domestic radio, television, and newspapers are controlled by the government. Radio and television receivers are locked to government-specified frequencies." The leader of North Korea is Kim Jong Un, he controls all forms of information for the public. In addition, his goal is to display his country as perfect when that is not the case. In 2004, there was a deadly train explosion near the Chinese border which he tried to hide. This ruler cared more for the overall image of his country, over his citizens. Not to mention, North Korea suffers from overpopulation, and citizens cannot freely travel due to strict policy.

In summary, the first amendment was the very first right that was given to us and should not be adjusted whatsoever. This allows us to critique our government without having to be afraid nor punished, this is an action many countries cannot do. Secondarily, freedom of speech is the right to express ourselves without censorship so individuals, companies, and the government can't make statements that are not necessarily true. Our freedom allows us to believe and practice whatever religion we desire. Freedom of speech and press allows people to voice their opinions and ideas publicly and to publish them without our government stopping us.

help me pleaseeeeeeeeeeeee

Answers

Answer:

Dr. Bruce Baines,

About your trip to Italy next week, I'm just attaching the details of your trip. Unfortunately, the business college in Perugia canceled the appointment on Wednesday. Can you give the same presentation in Bologna?

It'd be much appreciated if you could verify the times of your flight as soon as possible. Let me know if you need any help.

Thanks,

Tuan Vu

Explanation:

What do readers learn about the first Olympic Torch Relay from "The Torch Runner of 1936" that they do not learn from "The Summer Olympics of 1936"?
A
Eifrig was overly confident about being the best of 3,331 other runners.
B
Eifrig had moral doubts about taking part in an event founded by Hitler.
C
Eifrig was both deeply honored and a little nervous about being the final runner in this relay.
D
One lone runner would complete the relay of runners carrying the torch from Greece to Germany.

Answers

The lesson that readers learn about the first Olympic Torch Relay from Siegfried Eifrig, "The Torch Runner of 1936," is C . Eifrig was both deeply honored and a little nervous about being the final runner in this relay..

The readers do not learn Eifrig's state of mind from the "The Summer Olympics of 1936" but from "The Torch Runner of 1936."

Siegfried Eifrig, the German-born athlete, carried the relay torch that was used to light the Olympic Fame for 1936 in Berlin, Germany.  His was the first Olympic Torch Relay that started from Greece to Germany.  It involved 3,331 relay runners.

Elfrig did not show over-confidence or moral doubts because of Hitler's founding of the event.  He was not the only runner for the relay and did not carry the torch from Olympia, Greece to Berlin, Germany.

Thus, Elfrig indicated that he was highly honored by being chosen as the final runner to carry the torch but a little nervous that things might go wrong.

Read more about Siegfried Eifrig at https://brainly.com/question/19738390

7 Paragraph Paper- Native American Alcoholism(affects on community-mortality rate-% of drunks) 3 Point thesis.

Answers

Explanation: let me be honest i dont know  the answer is a really dificcult question im sorry hopefuly someone helped u or helps you

2. ( psychologists/ we /more / and /our / can’t /useful / , /other /is / say /sociologists / need / the/ one / life/ We / in /than/ .) *(Rearrange the words)*

Answers

Answer:

pls dont delete

Explanation:

pls

Who ______ responsible for this mess in the bathroom?
A. are
B. does
C. is
D. were

Answers

Answer:

c

Explanation:

because there's only one person responsible so the answer is a b

Who is responsible for this mess in the bathroom?

What are linking verbs?

The linking verb implies verbs that are used for connecting the subject of the sentence from other parts of the sentence.  It is used for generating extra information in the sentence related to activity and tense.

Therefore, the sentence is written in the present tense and refers to the singular person that requires it to connect the sentences properly.

Learn more about verbs here:

https://brainly.com/question/9126317

What can the reader conclude from paragraph 14?
A) The author’s advice has been followed by great speakers in the past
B) A background in sales is helpful when writing an effective speech
C) The author’s suggestions for writing strong speeches apply in many situations
D) Most world leaders rely on professional writer to create speeches for them

Answers

Answer: The correct Answer is C) The author’s suggestion for writing strong speeches apply in many situations.

Explanation: It is in fact correct

Answer:

c

Explanation:

Question 6)
What is the literary term MOST often used to refer to the way the personalities of fictional individuals are depicted in stories?

A.
profiling
B.
identification
C.
characterization
D.
attribution

Answers

Answer: C. Characterization

1. 5:30  ………………………………………………………………
2. 7:15  ………………………………………………………………
3. 8: 10  ………………………………………………………………
4. 6:35  ………………………………………………………………
5. 10:50  ………………………………………………………………
6. 2: 40  ………………………………………………………………
7. 9:05  ………………………………………………………………
8. 4:25  ………………………………………………………………

Answers

Answer:

Socratic Q&A logo. Search icon. What is (1/5) of 30? Prealgebra. 1 Answer. George C. Apr 15, 2016. 6. Explanation: 30=5⋅6. So: 15⋅30=305=5 ⋅65 =6.

Two years blank A. are. B. Is. a long time to live away from your family and friends..
Wich one could it be a or b plz help doing homework

Answers

Answer:

The answer is "A. are"

"Two years are a long time to live away from your family and friends."

Explanation:

What does Emma Watson ask for women to be equal with men?​

Answers

Answer:

Both men and women should feel free to be sensitive. Both men and women should feel free to be strong. It is time that we all perceive gender on a spectrum, instead of two sets of opposing ideals.

Explanation: PLS MARK BRAINLIEST^_^

What can the reader mainly infer about Coleman from the following passage (paragraph 15)?

“Coleman's funeral in Jacksonville on May 2, 1926, was attended by more than 5,000 mourners, many who were
prominent members of black society. Three days later her body arrived in Orlando, Fla., where thousands more attended
a funeral at Mount Zion Missionary Baptist Church. Her final journey took her back to Chicago, where more than 10,000
people filed past her coffin to pay final respects before her burial in the Lincoln Cemetery”.

A. She lessened discrimination against African Americans.

B. She had always craved attention.

C. She was widely popular in America.

D. She was practically unknown in her homeland.

Answers

I think it is D.she was practically unknown in her homeland

The thing which the reader can mainly infer about Coleman from the following passage (paragraph 15) is:

D. She was practically unknown in her homeland.

What is Inference?

This refers to the use of deduction to draw conclusions about something based on available evidence.

With this in mind and from the given passage, there is the use of inference to draw some conclusions about Coleman based on the interactions in paragraph which is that she is practically unknown in her homeland.

Read more about inference here:
https://brainly.com/question/16750080

What I want to learn about Decision making in vote?​

Answers

Answer:

Every decision-making process produces an outcome that might be an action, a recommendation, or an opinion. Since doing nothing or remaining neutral is usually among the set of options one chooses from, selecting that course is also making a decision.

_d's
s
4) Why does this article mention both the Egyptian and Roman glass
artifacts before it describes the glass factory?
A)
in order for the reader to have background
information on what makes glass special
B)
in order to demonstrate why Kerry Morelli is so
fascinated by the creation of glass
0
in order for the reader to realize that glass does not
really have an interesting history
D)
in order to demonstrate that the technology to make
glass hasn't really changed over time
5) The opening three paragraphs of the essay make the point that
A) glass is important because it is often overlooked.
B)
glass is important because people can see right
through it.
0
glass is important because without it life would be
less fun.

Answers

Answer:

4.B

5.D

Explanation:

#carryonlearning

Based on what you know about portable parts, which of the following words best completes the sentence below? The test ____, was in that it covered all the information from the whole year. O A. conjoin O B. persuasive O C. militant O D. comprehensive​

Answers

Answer:d comprehensive

Explanation:

"Not a crumb to be found

On the snow covered ground;

Not a flower could he see,

Not a leaf on a tree."

(a) Who is ‘he’ in the above lines? What does he need?


(b) What does ‘he’ decide to do to fulfil his need?


(c) From where has this poem been adapted?


(d) What is the rhyme scheme of the stanza?

( Correct ans will be marked as brainliest) and plz dont send spam

Answers

Answer:

the "he" is the person viewing or the poet

Explanation:

Contrast compare write
essay iphone vs samsung

Answers

samsungs work very slow they arent as dependable as iphone i did a switch from samsung to iphone i just tell a big huge diffrence it is crazy.ipones have a way better camera and evreything is organized

(hope this helps)

How did the fact of a largely illiterate Anglo-Saxon society affect entertainment during this time period? Explain

Answers

Being illiterate, the Anglo-Saxons established types of entertainment that did not include reading and writing, but that featured physical activities and arts.

We can arrive at this answer because:

Although reading was a form of entertainment for many years, some ancient peoples, such as the Anglo-Saxons, could not read.That's because writing hadn't been invented yet.However, Anglo-Saxon society found other forms of entertainment, generally focused on physical activities such as hunting and horse racing.They also held parties, where they performed artistic representations through dance and music.

Although they were illiterate, Anglo-Saxons also told stories as a form of entertainment. These stories were conveyed through conversations between people.

More information:

https://brainly.com/question/3641622?referrer=searchResults

She speaks so fast that she cannot be followed

Answers

Answer:

She is a fast speaker.

Explanation:  

2. (psychologists/ we /more/ and /our / can't /useful /, /other /is / say /sociologists / need / the/
one / life! We / in /than/ .) (Rearrange the words)

Answers

After rearranging the words, this is what we have:

We need psychologists and sociologists in our life! We can't say one is more useful than the other.

For this type of question, a few steps may be helpful in the process of answering:

Look for nouns/pronouns and verbs first. This will help you figure out which words may be the subject of the sentence and what action that subject is performing.Try different possibilities and then try including the prepositions and others words left. If it makes sense, it means you are most likely on the right path.Pay attention to the punctuation. A question mark indicates an interrogative sentence, which means we need to have an auxiliary verb placed before the subject.

Learn more about the topic here:

https://brainly.com/question/17434623?referrer=searchResults


Talk to a parent or another trusted adult about why libraries
are good for your community. Then write a paragraph about
why you think libraries are important. Edit your paragraph to
make sure you capitalize proper nouns.

Answers

Answer:

Very important

Explanation:

I believe libraries are very important because they bring knowledge and have been around for a long time. Even though we have millions of answers at our fingertips, libraries store much information that isn't on the internet or is easier to gather through books. Libraries are essential in communities for lower-income families who can't afford technology as well as to keep physical books on hand in case technology goes out or some people learn better through physical books rather than a computer screen. There is so much a library can offer that many people in my community use it for. Like printing school work, having a quiet place to read, finding interesting books, searching for something on the web, and so much more! I believe students will have a harder time without libraries in my community. When I enter community libraries I always see people of all ages and genders which proves that it isn't just for some people. Its for all to use which makes it essential.

Could i get help? for this question

Answers

A, its changed in shape, but not in volume.

The volume should remain at 100 mL.

From The Diary Of Anne Frank
How does she start writing her diary?

Answers

Answer:

Explanation:

Anne began her diary in June 1942, when she turned thirteen years old, just weeks before her family went into hiding in the annex behind the business office of her father, Otto, at 263 Prinsengracht, in order to escape the persecution of Jews in Nazi-occupied Amsterdam.

which sentence contains personification? (ANSWER FAST PLEASE)
A. the angry river swooped around the bend to deceive us.
B. Jamal is walking around school like hes Elvis or something.
C. to sailors, stars are like signposts that point the way home.
D. im as sleepy as a cat after its second meal of the afternoon.

Answers

Answer:

A

Explanation:

can ariver be angry like a person ?

No , so it's personification.

Write a short paragraph (80 - 100 words) to introduce yourself

Answers

Answer:

My name is ABC.  I am a senior in high school. Everyone can agree that I am a good student and that I like to study. My favorite subjects are chemistry and biology. I am going to enter the university because my goal is to study these subjects in future and to become a respected professional in one of the fields.

I can say that I am a responsible and a hard-working student. Moreover, being a sociable person, I have many friends since I like to communicate with people and get to know new interesting individuals. I enjoy my time at school: it is really nice to study and the students are very friendly and ready to help. The atmosphere cannot but make me want to go there every time. I like to receive and deal with challenging tasks. I am a very enthusiastic student and I think this is a strong point of mine.

Other Questions
Based on the maps, what region did more railroads tracks develop - the North or South? Why do you think so? Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas?