given the growth population model 12000/3+e^-.02(t), what is the initial population and what is the maximum population?

Answers

Answer 1

The initial population for this model is 12,000 and the maximum population is 24,000. The equation 12000/3+e^-.02(t) is used to model population growth.

The initial population and maximum population can be found by examining the growth population model.
The initial population is represented by the term before the exponential function, which in this case is 12000/3. This means that the initial population is 4000.

The maximum population is represented by the term in the denominator of the fraction with the exponential function. In this case, the maximum population is 3. This means that the population will never exceed 3, even as time (t) increases.
In conclusion, the initial population is 4000 and the maximum population is 3 according to the given growth population model.

You can read more about population at https://brainly.com/question/29885712

#SPJ11


Related Questions

The area of a rectangular tablecloth is 8 3/4 square yards. The width of the tablecloth is 1 7/8 yards. What is the length, in yards, of the tablecloth?

Answers

The width of the rectangle is 4 2/3 yards.

Area of the rectangle:

The area of a rectangle is the measure of the total region that the rectangle occupies in two-dimensional space.

It is calculated by multiplying the length of the rectangle by its width.

The formula for the area of a rectangle is:

    Area = length × width

Here we have

The area of a rectangular tablecloth is 8 3/4 square yards.  

The width of the tablecloth is 1 7/8 yards

For simple calculation convert given fractions into improper fractions

=> 8 3/4 = 35/4 yards

=> 1 7/8 = 15/8  yards  

Let 'x' be the breadth of the rectangle

As we know Area of the rectangle = Length ×  width

=> x × 15/8 = 35/4

=> x = 35/4 × 8/15

=> x = 14/3

Here, 14/3 = 4 2/3 yards  

Therefore,

The width of the rectangle is 4 3/2 yards.

Learn more about Rectangles at

https://brainly.com/question/29129931

#SPJ1

In 2002, the population of the state was 6.7 million people and was growing at a rate of about 0.32% per year. At this growth rate, the function f (x) = 6.7(1.0032)x gives the population, in millions of x years after 2002. Using this model, find the year when the population reaches 7 million people. Round your answer to the nearest whole number.

Answers

Thus, 2002 + 23 = 2025 is the year at which the populace hits 7 million.

What sort of equation would that be?

The meaning of an equation in algebra is a mathematical assertion that demonstrates the equality of two mathematical expressions. For instance, the equation 3x + 5 = 14 consists of the two expressions 3x + 5 and 14, which are split by the 'equal' symbol.

To find the year when the population reaches 7 million people, we need to solve the equation:

f(x) = 7

where f(x) represents the population, in millions of x years after 2002, and x is the number of years after 2002.

Substituting the given function f(x) = 6.7(1.0032)x into this equation, we get:

6.7(1.0032)x = 7

Dividing both sides by 6.7, we get:

1.0032x = 1.0448

When we take the natural log of both parts, we obtain:

ln(1.0032)x = ln(1.0448)

Using the logarithmic identity ln(aᵇ) = b ln(a), we can simplify this to:

x ln(1.0032) = ln(1.0448)

Dividing both sides by ln(1.0032), we get:

x = ln(1.0448) / ln(1.0032)

Using a calculator, we find:

x ≈ 22.6

Therefore, the population will reach 7 million people approximately 22.6 years after 2002. Rounding this to the nearest whole number, we get:

x ≈ 23

So the year when the population reaches 7 million people is 2002 + 23 = 2025.

To know more about Equation visit:

https://brainly.com/question/22688504

#SPJ1

Which table shows a proportional relationship between x and y?

x 1 2 3 4
y 6 8 10 12

x 4 7 8 10
y 2 3.5 4 5


x 40 50 60 90
y 8 10 14 18

x 2 4 7 8
y 6 10 21 24

Answers

Answer:

Second option

Step-by-step explanation:

Check the relationship between the x digits and compare with y digits. It must be the same all through

In the second option x =2y for all the digits

4:2, 7:3.5,8:4,10:5

9 of 119 of 11 Items













Question
Jillian and Jacob are playing a game where they have to collect blue and yellow tokens. Blue and yellow tokens are worth a different amount of points. Jillian has collected 4 blue tokens and 7 yellow tokens and has 95 points. Jacob has collected 4 blue tokens and 3 yellow tokens and has 75 points. How many points are a blue token and a yellow token worth?













Question
Jillian and Jacob are playing a game where they have to collect blue and yellow tokens. Blue and yellow tokens are worth a different amount of points. Jillian has collected 4 blue tokens and 7 yellow tokens and has 95 points. Jacob has collected 4 blue tokens and 3 yellow tokens and has 75 points. How many points are a blue token and a yellow token worth?

Answers

A blue token is worth 15 points and a yellow token is worth 5 points.

What is Equation?

Two or more expressions with an Equal sign is called as Equation.

Let b  represent the point value of a blue token and

y represent the point value of a yellow token.

We can set up two equations:

4b + 7y = 95 (Jillian's score)

4b + 3y = 75 (Jacob's score)

Subtracting the second equation from the first, we get:

4b + 7y - (4b + 3y) = 95 - 75

Simplifying this, we get:

4y = 20

Dividing both sides by 4, we get:

y = 5

So a yellow token is worth 5 points.

Now we can substitute this value of "y" into one of the original equations and solve for "b".

4b + 7y = 95

4b + 7(5) = 95

4b + 35 = 95

4b = 60

b = 15

So a blue token is worth 15 points.

Therefore, a blue token is worth 15 points and a yellow token is worth 5 points.

To learn more on Equation:

https://brainly.com/question/10413253

#SPJ1

Simplify completely. Assume no denominators are zero. 2x^3 – 2x^2 – 40x/2x^2+5x-12÷ 6x^4 – 150x^2/8x^3 - 27

Answers

Simplifying the expression (2x³ – 2x² – 40x )/(2x² + 5x - 12) ÷ (6x⁴ – 150x²)/(8x³ - 27) will result to (x - 5)/(3x(x - 3)(x + 5)).

To simplify the given expression completely, we need to factor the numerator and denominator of each fraction, and then simplify by canceling out common factors.

(2x³ – 2x² – 40x )/(2x² + 5x - 12) ÷ (6x⁴ – 150x²)/(8x³ - 27)

= (2x(x² - x - 20))/(2x^2 + 5x - 12) ÷ (6x^2(x^2 - 25))/(8x^3 - 27)

= (2x(x - 5)(x + 4))/(2x² + 8x - 3x - 12) ÷ (6x²(x - 5)(x + 5))/(8x³ - 27)

= (2x(x - 5)(x + 4))/(2x(x + 4)(x - 3)) ÷ (6x²(x - 5)(x + 5))/(8x³ - 27)

= (2x(x - 5)(x + 4))/(2x(x + 4)(x - 3)) × (8x³ - 27)/(6x²(x - 5)(x + 5))

= (x - 5)/(x - 3) × (8x³ - 27)/(6x²(x - 5)(x + 5))

= (x - 5)/(x - 3) × (2x - 3)(4x² + 6x + 9)/(6x²(x - 5)(x + 5))

= (x - 5)/(x - 3) × (2x - 3)/(6x(x - 5)(x + 5))

= (x - 5)/(3x(x - 3)(x + 5))

Therefore, the simplified expression is (x - 5)/(3x(x - 3)(x + 5)).

Learn more about simplifying expressions here: https://brainly.com/question/15226965.

#SPJ11

The number of coins in a person's collection changes based on buying, selling, and trading coins. A function defined as f(t) = t³ - 6t² + 9t
is modeled by the table, which represents the number of coins in the coin collection t years since the person began collecting coins.

(Picture has the rest of the problem)

Answers

The statements that are true about the function when graphed on a coordinate plane include the following:

C. The relative minimum of the function is (3, 0)

E. When t > 3, the function is increasing.

How to determine the minimum and maximum function?

In order to determine the minimum and maximum of this function, we would have to determine the critical points where the derivative of the function is equal to zero or undefined, and then evaluate the function at these critical points and at the endpoints of the interval.

By taking the first derivative of the given function and factorizing, we have:

f(t) = t³ - 6t² + 9t

f'(t) = 3t² - 12t + 9  

3t² - 12t + 9 = 0

t² - 4t + 3 = 0

(t - 3)(t - 1) = 0

t = 3 and t = 1

Therefore, the critical points of the function are at t = 1 and t = 3.

By taking the second derivative of the given function and factorizing, we have:

f''(t) = 6t - 12

At point t = 1, we have:

f''(1) = 6(1) - 12 = -6 (it is less than zero).

Therefore, f(t) has a local maximum at t = 1.

At point t = 3, we have:

f''(3) = 18 - 12 = 6 (it is greater than zero).

Therefore, the function f(t) has a local minimum at t = 3.

At t = 4, f''(4) = 24 - 12 = 12

At t = 5, f''(5) = 30 - 12 = 18

In conclusion, the relative minimum of the function is (3, 0) and when t > 3, the function would increase.

Read more on function here: https://brainly.com/question/29230332

#SPJ1

Write a recursive definition for the following function. f(1)=500, f(2)= 100, f(3)= 20

Answers

The recursive definition for the function f given by f(x) = 500 * (1/5)⁽ˣ⁻¹⁾, for x = 1, 2, 3 is a definition that describes how the value of f for a given x can be calculated from its inputs.

What is a recursive definition?

A recursive definition of a function is when the definition of the function involves the function itself. This type of definition is used to express complex operations in a simpler form. It is an effective way to break down a complicated problem into simpler, manageable parts. It allows us to define a set of rules in terms of smaller versions of itself, which can then be worked out using a series of steps.

A recursive definition for the function f is a process by which the value of f for a given input can be defined in terms of the values of f for smaller inputs. In other words, a recursive definition for f is a definition that describes how f can be calculated from its inputs.

In this case, the recursive definition for the function f is given by:

f(x) = 500 * (1/5)⁽ˣ⁻¹⁾, for x = 1, 2, 3

This means that the value of f for a given x can be calculated by multiplying 500 (the value of f for x = 1) by 1/5 raised to the power of x-1. This is because f(1) = 500, f(2) = 100 (1/5 * 500), and f(3) = 20 (1/5 * 1/5 * 500).

This recursive definition can also be expressed in a more general form as:

f(x) = a * b⁽ˣ⁻¹⁾, for x = 1, 2, 3

Where a and b are constants. In this case, a is 500 and b is 1/5.

In conclusion, the recursive definition for the function f given by f(x) = 500 * (1/5)⁽ˣ⁻¹⁾, for x = 1, 2, 3 is a definition that describes how the value of f for a given x can be calculated from its inputs. This definition can also be expressed in the more general form of f(x) = a * b⁽ˣ⁻¹⁾, for x = 1, 2, 3.

For more questions related to function,

https://brainly.com/question/25638609

#SPJ1

Perri will be able to purchase a condominium by making a 7% down payment on its $364,000 purchase price. She estimates her closing costs to be 4.5% of the
purchase price. What total amount will Perri need when she gets the keys for the house at closing?
O $4,052,173.91
O $466,000.12
O $41,860
O $465,999.89

Answers

The total amount will Perri need when she gets the keys for the house at closing is $41,860.

Estimation and Percentages

Perri is making a 7% down payment on the $364,000 purchase price of the condominium, so her down payment will be

0.07 x $364,000 = $25,480.

Perri estimates her closing costs to be 4.5% of the purchase price, which is 0.045 x $364,000 = $16,380.

Therefore, the total amount Perri will need when she gets the keys for the house at closing is the sum of the down payment and the closing costs, which is $25,480 + $16,380 = $41,860.

So the answer is (C) $41,860.

Learn more on estimation and percentages here:https://brainly.com/question/17917903

#SPJ1

who knows, What is the area of a cross section that passes through the center of a sphere with a diameter of 7 centimeters? Express your answer in terms of π.

Answers

The area of a cross section that passes through the center of a sphere with a diameter of 7 centimeters will be 12.25π cm².

What is A sphere ?

Three-dimensional objects with a sphere-like shape exist in all three dimensions. Three axes, the x-axis, y-axis, and z-axis, are used to define the sphere. The key distinction between a circle and a sphere is this. In contrast to other 3D shapes, a sphere lacks any vertices or edges.

The sphere's points are evenly spaced apart from one another on its surface. In light of this, the sphere's surface and core are always equally separated from one another. The sphere's radius is the measurement between these points. Ball, globe, planets, and other objects are all examples of spheres.

Given : Diameter of Sphere = 7 cm

∴ Radius = 7/2 = 3.5 cm.

Since It is a cross section in a sphere, so, it would be circle.

So, Area of the cross section = Area of circle

Hence, Area of Cross section = πr²

                                                 = π (3.5)²

                                                 =  12.25π cm²

To learn more about Sphere, visit the link:

https://brainly.com/question/22807400

#SPJ1

PLS HELP AND HURRY! I WILL GIVE YOU BRAINLIEST IF YOU GIVE THE RIGHT ANSWER! PLS HURRY! IT IS IN THE PHOTO! PLEASE!

Answers

The next three terms in the sequence are 1/81, -1/243, and 1/729.

What is the geometric sequence?

A geometric sequence is a sequence of numbers in which each term is obtained by multiplying the previous term by a fixed number called the common ratio. The general form of a geometric sequence is:

a, ar, ar^2, ar^3, ...

where a is the first term, r is the common ratio

To identify the next three terms in the sequence, we need to first determine the pattern. Looking at the sequence, we can see that each term is obtained by multiplying the previous term by -1/3, which means that this is a geometric sequence with a common ratio of -1/3.

Using this common ratio, we can find the next three terms in the sequence as follows:

-1/3 * (-1/27) = 1/81

1/81 * (-1/3) = -1/243

-1/243 * (-1/3) = 1/729

Therefore, the next three terms in the sequence are 1/81, -1/243, and 1/729.

To learn more about the geometric sequence, visit:

https://brainly.com/question/24643676

#SPJ1

Given that tan t = 5. Find tan(t + 71). (Enter an exact number.) Need Help? Read It Submit Answer

Answers

The exact number for tan(t + 71) is -0.5846.

To find tan(t + 71), we can use the formula for the sum of two angles:
tan(t + 71) = (tan t + tan 71)/(1 - tan t * tan 71)

Given that tan t = 5, we can substitute this value into the formula:
tan(t + 71) = (5 + tan 71)/(1 - 5 * tan 71)

To find the exact number for tan 71, we can use a calculator or a table of trigonometric values. The exact value of tan 71 is approximately 2.9042.

Substituting this value into the formula, we get:
tan(t + 71) = (5 + 2.9042)/(1 - 5 * 2.9042)

Simplifying the expression, we get:
tan(t + 71) = (7.9042)/(1 - 14.521)
tan(t + 71) = (7.9042)/(-13.521)
tan(t + 71) = -0.5846

Therefore, the exact number for tan(t + 71) is -0.5846.

For more information about angles, visit:

https://brainly.com/question/25716982

#SPJ11

The cylinder below has a height of 31mm and a volume of 4700mm. Work out the radius of the cylinder. If your answer is a decimal, give it to two decimal places

Answers

Answer:

4700=πr²×31

4700/31=πr²

151.6.../π=r²

√151.6.../π=

6.946933566=r

r=6.95mm

Explain:

Volume of cylinder=

πr²×height

-2x-4+2x+32-2x-21=18​

Answers

Answer:

x = -5.5

Step-by-step explanation:

-2x - 4 + 2x + 32 - 2x - 21 = 18​

-2x - 4 + 32 - 21 = 18

-2x + 7 = 18

-2x = 11

x = -5.5

So, the answer is x = -5.5

can someone help me please


Answers

Answer:

ABD = 75 degrees

Step-by-step explanation:

ABD is the same as ABC + CBD

ABC = 30

CBD = 45

30+45 = 75 degrees

Therfore, ABD = 75 degrees

what input can you not use with the rule divide 10 by the input added to 3

Answers

Answer:

-0

Step-by-step explanation:

What is DC? please i am about to fail

Answers

The length of DC is √102, which is the simplest radical form.

How to find the required side

The proportion of corresponding sides in similar triangles is the same. This is known as the similar triangles theorem.

In other words, if two triangles are similar, then the ratio of the lengths of any two corresponding sides is the same.

Since DE is parallel to AB, we can use similar triangles to set up the following proportion:

DC/AC = DE/AB

Substituting the given values, we get:

DC/17 = 6/AB

Since AB is the same length as DC, we can replace AB with DC:

DC/17 = 6/DC

Cross-multiplying and simplifying, we get:

DC^2 = 17 * 6

DC^2 = 102

DC = √102 in simplest radical form

Learn more about similar triangles at:

https://brainly.com/question/2644832

#SPJ1

At the football team banquet, 60 out of the 80 people attending had dessert with their dinner. What percent of the attendees had dessert?

Answers

The percentage of the attendees that had dessert at the football team banquet is 75%.

What percent of the attendees had dessert?

Percentage is simply number or ratio expressed as a fraction of 100.

It is expressed as;

Percentage = ( Part / Whole ) × 100%

To find the percentage of attendees who had dessert, we can use the formula:

Percentage = (part/whole) x 100%

where:

part = the number of attendees who had dessert = 60whole = the total number of attendees = 80

Substituting the given values, we get:

percentage = (60/80) x 100%

percentage = 0.75 x 100%

percentage = 75%

Therefore, 75 perecent of the attendees had dessert.

Learn more about Percentages here: brainly.com/question/24159063

#SPJ1

A manufacturer of electronic calculators takes a random sample of 1200 calculators and finds 5 defective units. Construct a 95% confidence interval on the population proportion.
(Round the answers to 4 decimal places.)
(_____< p <_______)

Answers

The 95% confidence interval for the population proportion of defective calculators is (0.0015, 0.0069).

Hence, (0.0015 < p < 0.0069).

According to the given information

we can use the formula for calculating the confidence interval for a population proportion,

⇒ P ± z√(P(1-P )/n)

Where,

P = sample proportion of defective calculators = 5/1200

                                                                              = 0.0042

n = sample size = 1200

z = z-score for 95% confidence level = 1.96 (from standard normal distribution table)

Substituting the values in the formula, we get,

⇒ 0.0042 ± 1.96√(0.0042(1-0.0042)/1200)

Simplifying the expression gives us the confidence interval,

⇒ (0.0015 < p < 0.0069)

Therefore,

The 95% confidence interval for the population proportion of defective calculators is (0.0015, 0.0069).

To learn more about statistics visit:

https://brainly.com/question/30765535

#SPJ12

The amount of merchandise (in millions) that store A sold can be represented by A = 13x squared + 8x - 3. The amount of merchandise (in millions) that store B sold can be represented by B = 8x squared - 3x + 11. Find the total amount of merchandise that stores A and B sold.

Answers

The total amount of merchandise that stores A and B sold is 21x²+5x+8

What is equation?

An equation is a mathematical statement with an 'equal to' symbol between two expressions that have equal values.

For example, 3x + 5 = 15.

Given that, are two stores selling merchandise given by equation,

A = 13x²+8x-3 and B = 8x²-3x+11, we need to find the total amount of merchandise that stores A and B sold.

We add both the equations to find the same,

Total merchandise sold = 13x²+8x-3 + 8x²-3x+11

= 21x²+5x+8

Hence, the total amount of merchandise that stores A and B sold is 21x²+5x+8

Learn more about equations, click;

https://brainly.com/question/29657988

#SPJ9

Bank of America charges $22 for each overdraft check. Kelsie has $370 in her account. She recently wrote checks for $46, $82, $264, and $127.
How much does she owe the bank including any overdraft charges?

Answers

Answer:

Step-by-step explanation:

Kelsie has written checks for a total of $46 + $82 + $264 + $127 = $519.

Since she only has $370 in her account, this means she has overdraft by $519 - $370 = $149.

Therefore, the bank will charge her $22 for each overdraft, which gives a total of $22 * 7 = $154.

Thus, Kelsie owes the bank a total of $519 + $154 = $673. Answer: \boxed{673}.

Describe transformation from f(x)=√x +3 to g(x)=f(x)+k

Answers

The transformation applied to the function f(x) is a translation of 4 units up.

Which is the transformation applied?

Here we can see that:

f(x) = √(x + 3)

and g(x) is a vertical translation of k units:

g(x) = f(x) + k

To get the value of k, just look how many units the graph has been translated up ( remember that each of the smalls squares in the coordinate axis represents a single unit), we can see that it is 4 units up, then k = 4

We have a vertical translation of 4 units up.

Learn more about translations at:

https://brainly.com/question/24850937

#SPJ1

what is the measure of a

Answers

Answer:

∠ A = 19.8°

Step-by-step explanation:

the 3 angles of the triangle sum to 180°

sum the 3 angles and equate to 180

5x - 18 + 4x + x = 180

10x - 18 = 180 ( add 18 to both sides )

10x = 198 ( divide both sides by 10 )

x = 19.8

Then

∠ A = x = 19.8°

Which of the following are the coordinates of point B’, the image of point B after a translation of (x-4,y-3)?

Answers

The coordinates of point B' after the translation are given as follows:

B'(1,-2).

What is a translation?

A translation happens when either a figure or a function are moved horizontally or vertically.

The meaning of the translation for this problem is given as follows:

x - 4: 4 units left.y - 3: 3 units down.

The coordinates of point B are given as follows:

B(5,1).

Hence the coordinates of point B' are given as follows:

x = 5 - 4 = 1.y = 1 - 3 = -2.

Meaning that the last option is correct.

More can be learned about translations at brainly.com/question/28174785

#SPJ1

Capter 6a P(X < 8) = P(X < 8) O for all distributions. O for only continuous distributions. O for only discrete distributions. O for some discrete distributions but not all. Points possible: 1 Unlimited attempts. Submit

Answers

The correct answer is O for some discrete probability distributions but not all.

This is because the probability of a random variable X being less than 8 can vary depending on the type of distribution it follows. For some discrete distributions, such as a binomial distribution, the probability of X < 8 can be calculated by summing the probabilities of all possible values of X that are less than 8. However, for other discrete distributions, such as a Poisson distribution, the probability of X < 8 may not be as straightforward to calculate. Therefore, the statement that P(X < 8) = P(X < 8) is true for some discrete distributions but not all.

To learn more about Probability distributions :

https://brainly.com/question/28021875

#SPJ11

30 persons reap a field in 17 days. How much more people should be engaged to reap the same field in 10 days

Answers

The extra number of people that should be engaged to reap the field in 10 days is given by A = 21 people

What is Proportion?

The proportion formula is used to depict if two ratios or fractions are equal. The proportion formula can be given as a: b::c : d = a/b = c/d where a and d are the extreme terms and b and c are the mean terms.

The proportional equation is given as y ∝ x

And , y = kx where k is the proportionality constant

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Given data ,

Let the extra number of people that should be engaged to reap the field in 10 days be represented as A

Now , the number of people that should be engaged to reap the field in 10 days = n

The number of people that can reap the field in 17 days = 30 persons

So , the proportion is

30 x 17 = n ( 10 )

On simplifying , we get

Divide by 10 on both sides , we get

n = ( 30 x 17 ) / 10

n = 3 x 17

n = 51

And , the number of extra persons A = n - 30

So , the extra number of people that should be engaged to reap the field in 10 days A = 21 people

Hence , the proportion is A = 21 people

To learn more about proportion click :

https://brainly.com/question/7096655

#SPJ1

The concept time and work is used here to determine the number of people required to reap the same field in 10 days. The number of people required is 51.

What is time and work?

The time and work represents the time taken by an individual or a group of individuals to complete a piece of work and the efficiency of the workdone by each of them.

If 30 persons can reap a field in 17 days

1 person can reap = 30 × 17 = 510 days

In 10 days, number of persons needed = 510 / 10 = 51 persons

Thus 51 persons can reap the field in 10 days.

To know more about time and work, visit;

https://brainly.com/question/444583

#SPJ1

Which number line shows the solution to the inequality 5x-15>-65

Answers

The sοlutiοn tο the inequality is all values οf x greater than -10. This can be represented οn a number line as shοwn in the figure attached.

What is inequality?

A cοnnectiοn between twο expressiοns οr values that is nοt equal in mathematics is referred tο as inequality. Hence, inequity results frοm imbalance. In mathematics, an inequality establishes the cοnnectiοn between twο nοn-equal numbers. Equality and inequality are nοt the same.

Use the nοt equal symbοl mοst frequently when twο values are nοt equal (). Values οf any size can be cοntrasted using a variety οf inequalities.

By changing the twο sides until just the variables are left, many straightfοrward inequalities may be sοlved.

Nοnetheless, a variety οf factοrs suppοrt inequality: Bοth sides' negative values are split οr added. Exchange the left and the right.

5x - 15 + 15 > -65 + 15

5x > -50

5x/5 > -50/5

x > -10

Because the inequality is severe, the οpen circle at -10 shοws that it is nοt part οf the sοlutiοn set (i.e., x must be greater than -10, nοt greater than οr equal tο -10).

The right arrοw shοws that the sοlutiοn set gοes οn fοrever in that directiοn.

Hence, the sοlutiοn tο the inequality is all values οf x greater than -10. This can be represented οn a number line as shοwn in the figure attached.

To know more about inequality visit:

brainly.com/question/29914203

#SPJ1

Use the suggested substitution to write the expression as a
trigonometric expression. Simplify your answer as much as possible.
Assume 0≤θ≤π2.
√4x^2+100, x/5=tan(θ)

Answers

We are given the expression √4x^2+100 and the substitution x/5=tan(θ). Our goal is to use the substitution to write the expression as a trigonometric expression and simplify as much as possible.

First, let's substitute x/5=tan(θ) into the expression:

√4(tan(θ)*5)^2+100

Next, let's simplify the expression:

√4(25tan^2(θ))+100

√100tan^2(θ)+100

Now, let's factor out 100 from the expression:

√100(tan^2(θ)+1)

10√tan^2(θ)+1

Finally, let's use the trigonometric identity 1+tan^2(θ)=sec^2(θ) to simplify the expression further:

10√sec^2(θ)

10sec(θ)

Therefore, the expression √4x^2+100 can be written as 10sec(θ) using the substitution x/5=tan(θ).

To learn more about trigonometry here:

https://brainly.com/question/25618616#

#SPJ11

Mountain Equipment Co-op (MEC) wants to price a new backpack. The backpack can be purchased for a list price of $59.95 less a trade discount of 25% and a quantity discount of 10%. MEC estimates expenses to be 18% of cost and it must maintain a markup on selling price of 35%. 1. What is the cost of backpack? 2. What is the markup amount? 3. What is the regular unit selling price for the backpack? 4. What profit will Mountain Equipment Co-op realize? 5. What happens to the profits if it sells the backpack at the MSRP instead?

Answers

The cost of backpack is $38.97. The markup amount is $13.64. The regular unit selling price for the backpack is $52.61
Mountain Equipment Co-op will be $19.02.The profit will be $19.02, which is higher than the profit of $6.63 when selling at the regular unit selling price.

To find the cost, markup amount, regular unit selling price, and profit for the backpack, we need to use the following formulas:

1. Cost = List Price - Trade Discount - Quantity Discount
2. Markup Amount = Cost × Markup Percentage
3. Regular Unit Selling Price = Cost + Markup Amount
4. Profit = Regular Unit Selling Price - Cost - Expenses

Let's plug in the given values and calculate each of these:

1. Cost = $59.95 - ($59.95 × 0.25) - ($59.95 × 0.10) = $59.95 - $14.99 - $5.99 = $38.97
2. Markup Amount = $38.97 × 0.35 = $13.64
3. Regular Unit Selling Price = $38.97 + $13.64 = $52.61
4. Profit = $52.61 - $38.97 - ($38.97 × 0.18) = $52.61 - $38.97 - $7.01 = $6.63

Now, if MEC sells the backpack at the MSRP (Manufacturer's Suggested Retail Price), the profit will be different. The MSRP is typically higher than the regular unit selling price, so the profit will be higher as well. Let's say the MSRP is $65. The profit would be:

Profit = MSRP - Cost - Expenses = $65 - $38.97 - ($38.97 × 0.18) = $65 - $38.97 - $7.01 = $19.02

So, if MEC sells the backpack at the MSRP, the profit will be $19.02, which is higher than the profit of $6.63 when selling at the regular unit selling price.

Learn more about mark up amount at https://brainly.com/question/17960775

#SPJ11

Convert 0.2 to a percent​

Answers

Answer:

20%

Step-by-step explanation:


Formula - multiply decimal by 100

0.2- Word form= two tenths

Fraction * 2/10 *

0.2 (multiply by 100)

0.2 x 100 = 20

20% is 0.2 as a percent


( hope this helps I’m online so ask any questions you need)

I have exam in 1 hr HELP I MKE BRAINLIEST ALSO

Answers

Answer:

Multiply the numerator and denominator by the conjugate.

a with a small 3 b with a small 5 and check under it will be a small a and small b

Step-by-step explanation:

Other Questions
INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose? PLEASEEEE HELP ASPPPPP Cambodia rice export to EU countries within EBA (research purpose) 4: 7 and 12 : whats the ratio To organize this text, the author divides it into sections with subheadings. What is described in the section with the subheading "Darwin Is Stumped"? I How does the author's use of the word "assaulted* in paragraph 2 contribute to ourunderstanding of Hitler's propaganda?A.It shows that German citizens would not readily believe propaganda.B.It reveals that German citizens were physically attacked with propaganda.C.It emphasizes that the German government's propaganda campaign wasforceful.D.It shows readers that German citizens didn't like the propaganda they wereexposed to. What is the area of this polygon?16 cm224 cm240 cm218 cm2 Given that 224 hours of work need to be done to complete a project. (1) How long will it take 4 men, each working an 8-hour day to complete the project? (II) If each of them is paid 57-50 per hour, how much will it cost to employ them altogether? (iii) How many hours of overtime must they put in per day if the project is to be completed in 4 days? (iv) Given that the overtime rate of payment is l times as much as the regular hourly rate, find the cost of the project now. 8. DEF is an equilateral triangle.The midsegments of ADEF form AAB.What type of triangle is AABC? Explain your reasoning. Table 1: Time Required for Methylene Blue Color Change (10 points)Milk Sample Start Time/Date (Step 10) End Time/Date (Step 11) Time Elapsed (End Time- Start Time)0 hours 1 hour 3 hours 4 hours A rectangle has a length of 6 centimeters and a width of x + 10 centimeters. Write an expression to represent the rectangles: area (square centimeters Alex has a pile of two pence coins. She swapped exactly half of them for the same number of 10p coins. Now she has 4.20. How much money did Alex have initially?" For the given word problem, write a system of equations, clearly define any variables, and show work for full credit.A photographer is mixing 5% acetic acid solution with a 10% acetic acid solution to get two liters of a 7% solution.How many liters of each solution should he add? What is the velocity of a 1,000.0 kg car if its kinetic energy is 200 kJ? Which expressions are polynomials?Select each correct answer.-7x+ 5/3x6x + 5xx^2+ 5x1/5-x^2+5x What is a common writing problem that should typically address when completing one's work