Germán religious group that printed America’s first German bible

Answers

Answer 1

The German religious group that printed America's first German Bible was the Lutheran Church.

The German religious group that printed America's first German Bible was the Lutheran Church.

The first German Bible to be printed in America was the "Acht Bücher der Propheten" ("Eight Books of the Prophets"), which was printed by the Lutheran pastor and theologian Johann Gottfried Kunze in 1743. It was followed by the "Göttingische Bibel" ("Göttingen Bible"), which was printed by the Lutheran pastor and theologian Johann Jakob Schütz in 1745.

The early German Bibles were printed for the use of German-speaking immigrants in America who were members of the Lutheran Church.

Learn more about the German at

https://brainly.com/question/3238930

The question is -

Which German religious group printed America’s first German bible?


Related Questions

What was Ronald Reagan's campaign theme in 1980?

Answers

Reagan's presidency saw considerable growth in the national debt due to fiscal deficits brought on by tax cuts combined with higher war spending.

Reagan pledged that if given the chance to become president in 1980, he would appoint the first female justice to the Supreme Court. When he selected Sandra Day O'Connor to replace the vacancy left by Justice Potter Stewart's retirement, he was given the chance to seize it during his first year in office. On September 21, 1981, the Senate gave O'Connor its approval. From the time of her appointment until her retirement in 2006, she worked. Ronald Reagan, a Republican from California, was elected president in 1980 after trouncing Democratic incumbent President Jimmy Carter in a landslide. Reagan's presidency saw a considerable growth in the national debt due to fiscal deficits brought on by tax cuts combined with higher war spending.

Learn more about Reagan's presidency here:

https://brainly.com/question/11048841

#SPJ4

Why did we put Japanese in internment camps?

Answers

Numerous Americans feared that people of Japanese origin might operate as spies or saboteurs for the Japanese government.

In internment camps, were Japanese killed?

Inadequate medical care and the psychological strains they experienced contributed to some Japanese Americans' deaths in the internment camps. In response to suspected order-resistance, several were slain by military guards stationed.

What did the Japanese do while being housed in internment camps?

The internees established farms, schools, churches, and newspapers, and they were permitted to live in family units. Sporting activities and other hobbies were enjoyed by kids.

In internment camps, were Japanese employees paid?

Interns were initially not paid for their labor, however this policy was eventually modified. The sort of work done and the employee's skill level affected the pay rates.

To know more about  internment camps visit:

https://brainly.com/question/14039461

#SPJ4

What kinds of cases does the Supreme Court hear?

Answers

Answer:

The United States Supreme Court is a federal court, meaning in part that it can hear cases prosecuted by the U.S. government. (The Court also decides civil cases.) The Court can also hear just about any kind of state-court case, as long as it involves federal law, including the Constitution.

Cases of great matter and security

why were U.S settlers opposed to Mexican laws?

Answers

Answer: Mexico banned settlers in the 1830's because American settlers ignored Mexican laws. Mexico felt like it was losing control over the growing American population, so they banned further settlement. The American settlers were angered and began to consider independence from Mexico.

Explanation:

Read the oath that Lincoln required of people seeking amnesty.

“I, __________, do solemnly swear, in presence of Almighty God, that I will henceforth faithfully support, protect, and defend the Constitution of the United States and the Union of the States thereunder; and that I will, in like manner, abide by and faithfully support all acts of congress passed during the existing rebellion with reference to slaves, so long and so far as not repealed, modified, or held void by congress, or by decision of the supreme court; and that I will, in like manner, abide by and faithfully support all proclamations of the President made during the existing rebellion having reference to slaves, so long and so far as not modified or declared void by decision of the supreme court. So help me God.”

–Proclamation of Amnesty and Reconstruction,
Abraham Lincoln

According to the oath of allegiance, under what conditions might someone be a slaveholder again? Check all that apply.

if Congress changed laws about slavery
if the person once again rebelled against the United States
if the Supreme Court determined antislavery laws to be unconstitutional
if the president made a new proclamation on slavery
if the Supreme Court voided the president's proclamation on slavery

Answers

if Congress changed laws about slavery

if the Supreme Court determined antislavery laws to be unconstitutional

if the Supreme Court voided the president's proclamation on slavery

Thus options A, C, and E are correct.

What is the Proclamation of Amnesty and Reconstruction?

The Proclamation of Amnesty and Reconstruction, President Hitler's first rehabilitation strategy, was announced on December 8, 1863. Those who swore a pledge of loyalty and agreed to the eradication of slavery were given complete remission as a result of this proclamation.

if Congress altered the rules governing slavery. if pro government legislation was ruled to be illegal by the Supreme Court. if the Administration's declaration on slavery was revoked by the Supreme Court

As slaveholders depend on labor camps to maintain their businesses, enslaved slaves regularly used work delays and absences to bargain a few of the obligations of their labor. Therefore, option A, C, and E is the correct option.

Learn more about the Proclamation of Amnesty and Reconstruction, Here:

https://brainly.com/question/10039783

#SPJ1

dalawang relihiyon mula sa india na nagsagawa ng magkahiwalay ng pagkilos laban sa mga kanluranin​

Answers

What do u want us to do with this?

Which of the following represents a difference between communist and democratic countries during the Cold War?


1)

Democratic countries believed in popular elections, while communist countries did not.

2)

Communist countries believed in the need for a system of checks and balances of powers, while democratic countries did not.

3)

Communist countries supported the development of private business, while democratic countries preferred government control.

4)

Communist countries supported religious freedom, while democratic nations did not

Answers

Answer:

1. is the correct answer I believe

Explanation:

1.) Democratic countries believed in popular elections is the correct answer.

2 is wrong because the US is democratic and has a checks and balances system. 3 is wrong because communist countries have government owned businesses, not private. And 4 is wrong because communist countries typically do not have much religious freedom.

How did braceros help the united states in the war effort?

Answers

The braceros played a crucial role in helping railroad lines for the movement of people, commodities, and military supplies across Oregon throughout the war.

What did Braceros help out?

The Bracero program, which gets its name from the Spanish word bracero, which means "manual worker" or "one who works using his arms," began when the United States and Mexico signed the Mexican Farm Labor Agreement on August 4, 1942. The agreement guaranteed that a percentage of the farmworkers' salaries would be put in a private savings account in Mexico, as well as a minimum pay of 30 cents per hour, exemptions from military enlistment, and other benefits.

In the early years of World War II, it also allowed for the temporary entry of contract laborers from Guam.

To know more about "Braceros help out", check out:

https://brainly.com/question/25872543

#SPJ4

What was one of the main advantages of the South?
A. a larger population
B. Excellent military leaders
C. Belief in states rights
D.Strong industries

Answers

Answer: B- Excellent military leaders

What did Lenin do before the revolution?

Answers

Lenin relocated to Saint Petersburg in the end of 1893. He began there as a barrister's assistant before moving up the ranks of a Marxist revolutionary group there that went by the name of the Social-Democrats in honor of the Marxist Social Democratic Party of Germany.

What is Lenin's contribution?

In the 1917 Russian Revolution, he was a crucial figure. implementing extensive land changes. Lenin was credited with the Bolsheviks' triumph during the Russian Civil War, which lasted from 1917 to 1922.

                     The New Economic Policy, which he introduced, was a synthesis of many economic systems with the state playing a decisive role.

What is the abbreviation for Russian Revolution?

When the Russian working class and peasants rose up in 1917 to overthrow Tsar Nicholas II's administration, it is known as the Russian Revolution.

                      Vladimir Lenin, along with a group of revolutionaries known as the Bolsheviks, served as their leader. The Soviet Union was a nation founded by the new communist regime.

Learn more about Russian Revolution

brainly.com/question/8387382

#SPJ4

Why would its inhabitants want to create a separate state of West Virginia?

Answers

The main reason people wanted to create a separate state of West Virginia was to separate from Virginia which had declared its secession from the Union during the Civil War. West Virginians wanted to remain loyal to the Union, and they wanted to have a state government that reflected their anti-slavery beliefs and values. They also wanted to have more political autonomy and representation in the federal government. Additionally, they sought greater economic opportunity and development in the region.

Explain how each of the following was important for the Roman Republic: two consuls; the senate; the veto; the tribunes; the Law of the Twelve Tables.

Answers

Two Consuls: The two consuls were the most powerful political figures in the Roman Republic, and they were elected by the people. The two consuls each served a one-year term and were responsible for leading the government, commanding the armies, and presiding over the Senate.

The Senate: The Senate was the most important political body in the Roman Republic. It was composed of 300 members who were elected from the wealthiest families. The Senate had the power to pass laws, approve treaties, and manage the state’s finances.

The Veto: The veto was a power given to the consuls, allowing them to block any bill that was passed by the Senate. This power ensured that the consuls had absolute control over the legislative process and that no bill could pass without their approval.

The Tribunes: The tribunes were elected officials who represented the will of the people in the government. They had the power to veto any law passed by the Senate, and they could also protect citizens from the abuses of the government.

The Law of the Twelve Tables: The Law of the Twelve Tables was the first written code of law in the Roman Republic. It established the rights of citizens and set out the punishments for breaking the law. This code of law was important for establishing a system of justice and it helped to ensure that all Roman citizens were treated equally.

Which power was given solely to the
national government?
A. Ability to coin money.
B. Operation of public schools.
C. Power to hold elections.

Answers

I’m pretty sure it’s A

Answer:

yeah I think the answer is A

Is Achilles tied to a side (Trojan or Greek) during the Trojan War? Why or Why not.

Answers

Answer: No

Explanation: Achilles was considered a hero because he was the most successful soldier in the Greek army during the Trojan War. According to post-Homeric myths, Achilles was physically invulnerable, and it was prophesied that the Greeks could not win the Trojan War without him.

Question
What distinguishes a direct
democracy from a representative democracy?

Answers

In direct democracy, the people decide on policies without any intermediary or representative, whereas in a representative democracy people vote for representatives who then enact policy initiatives.

Answer:

direct democracy is where the citizens are actively involved in affairs of the state whereas indirect democracy is where the citizens elect representatives to run affairs of the state on their behalf

Explanation:

direct = people do it themselves

indirect = elect someone to do it for you

The three causes that resulted in WW II were failure of __________ , failure of ______________ and the ______________.

Answers

Answer:

The major causes of World War II were numerous. They include the impact of the Treaty of Versailles following WWI, the worldwide economic depression, failure of appeasement, the rise of militarism in Germany and Japan, and the failure of the League of Nations.

Which of the listed options is NOT an aspect of a typical feudal
manor?
a. widespread literacy and lots of public education
b. innovative farming practices like the three field system
c. local religious officials, monasteries, priests, etc.
d. self sufficiency and very little reliance on outside resources

Answers

Widespread literacy and lots of public education is not an aspect of a typical feudal manor. Hence, option (a) can be considered as the correct choice of answer.

Give a brief account on manorialism.

Manorialism, often referred to as seigneurialism, the manor system, or the manorial system, was a kind of land ownership (or "tenure") in the Middle Ages in several regions of Europe, most notably in France and later in England. A large, occasionally fortified manor house where the lord of the manor and his dependents resided and managed a rural estate, as well as a populace of laborers, one of its unique features was that they farmed the surrounding land to sustain both the lord and themselves. These labourers later fulfilled their obligations with cash payments rather than labor hours or in-kind goods as commercial activity increased. Manorialism was a widespread practice in medieval western and some of central Europe. It had its roots in the Roman villa system of the Late Roman Empire. Manorialism, a fundamental component of feudal society, was gradually superseded by the emergence of a market economy based on money and novel agrarian contract types.

To know more about, manorialism, visit :

https://brainly.com/question/1268279

#SPJ1

Explain how the naturalization process has impacted our society, government and our political process. Include in your answer the Voting Rights Act of 1965.

Answers

The Civil Rights Act of 1964 was the broadest civil rights law Congress had ever enacted. It contained a comprehensive set of measures to put an end to Jim Crow segregation and racial discrimination.

In June 1964, the Civil Rights Act of 1964 became law as a result of years of activist lobbying for comprehensive civil rights legislation. Prior to the March on Washington, President John F. Kennedy sent the civil rights bill to Congress, but it stalled in the Judiciary Committee because of the slow-moving Southern segregationist senators like Mississippi Democrat James Eastland. superscript 1 at the beginning and end President Lyndon Baines Johnson gave the bill top priority after President Kennedy was assassinated in November 1963. The Civil Rights Act of 1964 made it illegal to discriminate against or segregate people in the workplace, in housing, in schools, and in public places. In order to help local communities with civil rights issues and to assure equitable employment procedures, it formed the Equal Employment Opportunity Commission and the federal Community Relations Service. The statute also empowered the US Office of Education to support towns fighting to desegregate public schools financially.

To know more about Civil Rights Act of 1964 visit

brainly.com/question/1264052

#SPJ4

Read this section The Story Matters. Using that and this chapter as a guide, write a short journal entry as if you are one of Washington's men crossing the Delaware River on the way to attack the British in Trenton, New Jersey. Write at least 5 complete sentences:

The story matters : It is December 25, 1776. General George Washington is preparing to lead 2,400 troops across the Delaware River to launch a surprise attack on the British troops stationed in Trenton. The river is filled with huge chunks of ice. The weather is terrible, and hurricane-force winds pound at Washington's troops. After crossing the Delaware River, General Washington and his troops will have to march 9 miles (14 km) to meet their enemy. The young United States is in desperate need of some battlefield success in its war against the British.

Answers

A Hessian garrison of about 1,400 men was stationed in and around Trenton, New Jersey, and Washington's plan was to launch a surprise attack on them.

Who was on the boat that Washington used to cross the Delaware?

177 seamen who operated the boats that transported Washington's forces over the river made up this group.

What made Washington's crossing of the Delaware successful a surprise attack?

Washington and his soldiers were able to mount a successful attack, even though it took longer than expected, thanks to a series of false warnings and poor weather. The Continental Army executed well after they reached the shore.

To Know more about Washington's

https://brainly.com/question/14432921

#SPJ1

Golden Age of Islamic Civilization

Answers

Answer:

The Islamic Golden Age refers to a period in the history of Islam, traditionally dated from the 8th century to the 13th century, during which much of the historically Islamic world was ruled by various caliphates and science, economic development, and cultural works flourished.

Hope this helps!

how did the federalists and the republicans disagree concerning the power of the central government

Answers

State governments should be more powerful than the federal government, according to Democratic-Republicans, who disagreed with the Federalists' call for a strong federal government.

What does Democratic Party mean?

Of the two main modern political parties in the US, the Democratic Party is one of the largest. The oldest continuously operating political party in the world was established in 1828, mostly thanks to Martin Van Buren, who brought together a large group of lawmakers from every state to support war hero Andrew Jackson. People typically identify the Democratic Party with more liberal policies. It advocates for greater government participation in the economy while supporting social and economic equality. However, it is opposed to government meddling in citizens' private, non-economic matters.

To know more about Democratic visit:

https://brainly.com/question/14320124

#SPJ4

What branch of the service is the Air Force?

Answers

The United States Air Force (USAF) is one of the eight uniformed services that make up the US Armed Forces and is responsible for providing air service also called the air service branch.

What is Air Force?

In its broadest meaning, the air force refers to the component of the national armed forces that primarily engage in aerial combat.

It is the division of a nation's armed forces that is in charge of aerial warfare, as opposed to an army or navy.

Similar to the Navy, there is about the same number of reserves and active duty members in the Air Force.

One of the eight uniformed services of the United States, the United States Air Force (USAF) is the air service branch of the US Armed Forces.

Therefore, the United States Air Force (USAF) is one of the eight uniformed services that make up the US Armed Forces and is responsible for providing air service also called the air service branch.

Know more about Air Force here:

brainly.com/question/16257474

#SPJ4

Herbert Hoover

“I might have _____ _____ the Great Depression”

Answers

Answer:

knowledge of

if you put it in the blanks it makes sense

Three ways the Catholic Church benefited from the trans Atlantic slave trade

Answers

Answer:

Explanation: 1 spices

Where did most people live in the 1790s?

Answers

Most people lived in Virginia in the 1790s.

The number of slaves in America in 1860 was over 4 million, more than tripling from 700,000 in 1790, according to federal census figures. This growth was linked to the astonishing rise in cotton production in the South. Between 1820 and 1860, around 200,000 persons were bought, sold, and moved. The 1800 census counted over a million African Americans, including over 900,000 slaves. 3.95 million of the 4.4 million African Americans that made up the entire population of the nation in 1860 were bondholders. According to a government census, there were far more slaves in America between 1790 and 1860 than there were in 1790 when there were only 700,000 slaves.

To know more about the population here

brainly.com/question/21148283

#SPJ4

The symbol of the republican political tactic of attacking democrats with reminders of the civil war, is called?

Answers

Essentially encouraged politicians to enter into consensual relationships with powerful businessmen. Describe the role that personality played in the 1884 presidential election. Cleveland was chosen.

The Greenback party, sometimes known as the National Greenback party, was founded in 1876 to advocate for the increase of the "greenback" paper currency supply, which was first produced by the federal government in 1862 to help pay for the Civil War. According to the Pendleton Act, positions in the federal government must be granted based on qualifications, and candidates for these positions must pass competitive exams. Additionally, the measure forbade firing or demoting personnel who were subject to the law for political purposes.

Learn more about  politicians  from

https://brainly.com/question/16256239

#SPJ4

How has the physical geography and climate affected the diversity of cultures in Sub Saharan Africa?

Answers

The negative effects of increased extreme rainfall episodes on agricultural output generally outweigh the positive effects of higher precipitation over the rest of sub-Saharan Africa.

The origin of human civilization is in Africa. Between one and two million years ago, homo erectus, sometimes known as the "upright man," made its initial appearance in East Africa. Early humans initially developed tools, language, and fire control in Africa.

The Congo Basin is the largest of the huge, tropical basins found in Sub-Saharan Africa, which also includes the rift valley. Highland and plateau zones are also present in this continent. The Congo River, the greatest river in Africa by discharge and the deepest river in the world, drains into this basin, which starts in the highlands of the rift valley.

Learn more about Sub Saharan Africa

https://brainly.com/question/15661110

Why i the Illinoi Central Railroad Company elling thee acre of prairie farmland? What detail are provided that would lure a pioneer to buy a tract of land? Explain ome of the rik and challenge of buying land and moving to new territory. Decribe the benefit of buying the land. How i thi advertiement an example of manifet detiny? How i thi advertiement an example of "the American dream"?

Answers

The Illinois Central Railroad Company is selling these acres of prairie farmland to lure pioneers to buy a tract of land.

What is lure pioneers?

Lure Pioneers is an online platform for anglers to connect and share their fishing experiences. It provides resources, such as tutorials, guides, and tips, to help anglers improve their fishing skills.

The advertisement details that the land is fertile and well-suited for farming, and the cost of the land is lower than in the East. It also offers potential settlers the chance to own their own land, start a business or farm, and build a new life.

The risks and challenges of buying land and moving to new territory include the possibility of crop failure due to unpredictable weather, the need to develop infrastructure such as roads and schools, and the potential of conflict with Native American tribes. In addition, pioneers would have to adapt to the unfamiliar environment, laws, and culture of the new territory.

The benefits of buying the land include the potential for land appreciation, the ability to start a business or farm, and the opportunity to build a new life in a new territory. The Illinois Central Railroad Company also offers potential settlers the chance to take advantage of the Homestead Act, which grants free land to those who meet certain requirements.

This advertisement is an example of manifest destiny because it demonstrates the belief that the United States was destined to expand westward and that settlers should make the best use of the available land. It also promotes the idea that the land is there for the taking and that individuals have the power to shape their own destiny.

This advertisement is also an example of "the American dream" because it promotes the idea that anyone can achieve success through hard work and dedication. It encourages potential settlers to take advantage of the opportunities available to them, such as the Homestead Act, in order to build a better life for themselves and their families.

To learn more about Central Railroad Company
https://brainly.com/question/11433327
#SPJ1

16 This policy
dealt with
preventing the
spread of
Communism in
Europe and
Asia.

Answers

Answer:

Truman Doctrine.

Explanation:

Was the use of atomic weapons justified ?.. for an essay

Answers

Answer:

The dropping of the atomic bomb on Hiroshima was justified at the time as being moral – in order to bring about a more rapid victory and prevent the deaths of more Americans. However, it was clearly not moral to use this weapon knowing that it would kill civilians and destroy the urban milieu.

Other Questions
briefly describe the goals and scope of social work. she is drinking water change into negative Find the x and y Intercept of x + 2y = -14 What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1