Gary Radio Corporation is a subsidiary of Salem Companies. Gary makes car radios that it sells to retail outlets. It purchases speakers for the radios from outside suppliers for $56 each. Recently, Salem acquired the Hyden Speaker Corporation, which makes car radio speakers that it sells to manufacturers. Hyden produces and sells approximately 200,000 speakers per year, which represents 70 percent of its operating capacity. At the present volume of activity, each speaker costs $48 to produce. This cost consists of a $32 variable cost component and an $16 fixed cost component. Hyden sells the speakers for $60 each. The managers of Gary and Hyden have been asked to consider using Hyden's excess capacity to supply Gary with some of the speakers that it currently purchases from unrelated companies. Both managers are evaluated based on return on investment. Hyden's manager suggests that the speakers be supplied at a transfer price of $60 each (the current selling price). On the other hand, Gary's manager suggests a $56 transfer price, noting that this amount covers total cost and provides Hyden a healthy contribution margin.
a. What transfer price would you recommend?
b. Discuss the effect of the intercompany sales on each manager's return on investment.
c. Should Hyden be required to use more than excess capacity to provide speakers to Gary? In other words, should it sell to Gary some of the 200,000 units that it is currently selling to unrelated companies? Why or why not?

Answers

Answer 1

Answer:

Salem Companies

a. I recommend a transfer price of $56 per unit (in view of the excess capacity).

b. The intercompany sales at $56 per unit will increase Hyden's return on investment because it will use excess capacity to produce the required units while still selling to outside customers at $60 per unit.  With regard to Gary's return on investment, there will be no change as this is the same price it buys from outside suppliers.  However, if the price were to be $60 per unit, the return on investment will reduce while skyrocketing Hyden's.

c.  Hyden can still sell some of the 200,000 units that it currently sells to unrelated companies at $56 if the outside demand is less than 200,000 units or if Gary will buy at $60 per unit.

Explanation:

a) Data and Calculations:

Purchase price from outside suppliers = $56 each

Production units of Hyden = 200,000

Capacity of Hyden = 285,714

Unit cost at present volume of activity = $48

Variable cost = $32

Fixed cost = $16

Transfer price by Hyden at $60:

Profit per unit = $12 ($60 - $48)

Return on investment = 25% ($12/$48 * 100)

Transfer price at $56 using excess capacity:

Incremental profit per unit = $24 ($56 - $32)

Incremental return on investment = 75% ($24/$32 * 100)

Transfer price at $56 producing below capacity:

Profit per unit = $8 ($56 - $48)

Return on investment = 16.7% ($8/$48 * 100)


Related Questions

Exercise 9-18 (Algorithmic) (LO. 5) In 2020, the CEO of Crimson, Inc., entertains 9 clients at a skybox in Memorial Stadium for a single athletic event during the year. Substantive business discussions occurred at various times during the event. The box cost $6,750 per event and seats 11 people. (The cost of a regular, nonluxury box seat at Memorial ranges from $50 to $100.) Refreshments served during the event cost $1,720 (and were separately itemized on the bill Crimson received). How much of these costs may Crimson deduct

Answers

Answer: $860

Explanation:

As substantive business discussions took place in box at various times, there can be certain deductions for business purposes.

The box cost is not deductible because the cost is substantially higher than the cost of nonluxury box seats at the same stadium.

As per normal taxation convention, 50% of the refreshments can be deducted as business expenses:

= 50% * 1,720

= $860

Calistoga Produce estimates bad debt expense at 0.20% of credit sales. The company reported accounts receivable and allowance for uncollectible accounts of $475,000 and $1,470, respectively, at December 31, 2020. During 2021, Calistoga's credit sales and collections were $333,000 and $304,000, respectively, and $1,870 in accounts receivable were written off. Calistoga's accounts receivable at December 31, 2021, are:

Answers

Answer:

the ending account receivable balance is $502,130

Explanation:

The computation of the ending account receivable balance is given below:

= Account receivable at Dec’31 2020 + Credit sales on 2021 - collections on 2021 - write off the account receivable

= $475,000 + $333,000 - $304,000 - $1,870

= $502,130

Hence, the ending account receivable balance is $502,130

The same would be considered and relevant too

Lara uses the standard mileage method for determining auto expenses. During 2020, she used her car as follows: 21,800 miles for business, 4,360 miles for personal use, 6,540 miles for a move to a new job, 2,180 miles for charitable purposes, and 1,090 miles for medical visits. Presuming that all the mileage expenses are allowable (i.e., not subject to percentage limitations), what is Lara's deduction for:

Answers

Answer:

A. Business $11,881

B. Charitable $305.2

C. Medical $196.2

Explanation:

Calculation to determine Lara's deduction for:

a. Deduction for Business= (21,800 miles x .545)

Deduction for Business= $11,881

b. Deduction for Charitable= (2,180 miles x .14)

Deduction for Charitable= $305.2

c. Deduction for Medical=(1,090 miles x .18)

Deduction for Medical=$196.2

Therefore Lara's deduction are:

A. Business $11,881

B. Charitable $305.2

C. Medical $196.2

On August 2, Jun Co. receives a $6,300, 90-day, 12% note from customer Ryan Albany as payment on his $6,300 account receivable. 1. Compute the maturity date for the above note. multiple choice October 29 October 30 October 31 November 1 November 2

Answers

Answer: October 31

Explanation:

It is a 90 day Note so the maturity date will be:

= August 2 + the remaining 29 days in August + 30 days in September + 31 days in October

= October 31

The expiry date will be October 31 as this would be 90 days from August 2, when the note was received.

Using a spreadsheet computer software program, construct a supply chain finance model to determine the redelivery/rehandling cost, lost sales, invoice deduction cost, and net income for the following two cases: a. On-time delivery increases from 90 percent to 96 percent with a 10 percent increase in transportation cost. b. Order fill rate decreases from 95 percent to 90 percent with inventory reduced by 10 percent.

Answers

Those links are scams you should try using the app Socratic it’s just as good as Brainly:)

Nancy Fur Supply has been selling fur coats to Patricia's Fur Shop pursuant to an existing contract. The price of fur pelts goes up sharply and Nancy concludes that she can no longer continue to supply the coats to Patricia's at the agreed price. Nancy asks Patricia to agree to a 10 percent increase in the price of the coats and Patricia agrees but then later changes her mind and refuses to pay the additional 10%. In that case, Patricia:

Answers

Answer:

In that case, Patricia:

is still liable to pay the additional 10%.

Explanation:

The 10% price increase was preceded by an agreement between the two parties.  Patricia is bound to honor her agreements with her business partner to sustain the business relationship.  Refusing to pay a debt just by a change of mind does not repudiate the contract.  Nancy can enforce the agreement in the court for specific performance of the contract because this additional agreement simply modifies the earlier contract and remains enforceable.

Hawkins Inc. had pre-tax accounting income of $1,800,000 and a tax rate of 35% in 2017, its first year of operations. During 2017 the company had the following transactions: Received rent from Barrett Co. for 2018 $64,000 Municipal bond income $80,000 Depreciation for tax purposes in excess of book depreciation $40,000 Installment sales revenue to be collected in 2018 $108,000 For 2017, what is the amount of income taxes payable for Hawkins Inc.

Answers

Answer:

Hawkins Inc.

For 2017, the amount of income taxes payable for Hawkins Inc. is:

= $572,600.

Explanation:

a) Data and Calculations:

2017 tax rate = 35%

Pre-tax accounting income =   $1,800,000

2018 Rent from Barrett Co.            64,000

Less:

Exempt Municipal bond income  (80,000)

Tax Depreciation (in excess of

 book depreciation)                     (40,000)

2018 Installment sales revenue (108,000)

Adjusted taxable income       $1,636,000

Income tax (35%)                        572,600 (35% of $1,636,000)

Tax expense (provision)             630,000 (35% of $1,800,000)

b) The difference between the income tax payable of $572,600 and the provision for income tax expense for the year of $630,000 is due to temporary differences and exempt Municipal bond income.  The temporary differences are caused by the different timings of the recognition of revenue and expenses under the tax jurisdiction and the GAAP accounting.

Which of the following statements about cash versus accrual accounting is most correct? A. In cash accounting, an event is recognized when a cash transaction occurs. B. In accrual accounting, an event is recognized when a cash transaction occurs. C. Most large healthcare organizations use cash accounting because it presents a better picture of the economic status of the organization. D. Most small healthcare organizations use accrual accounting because it closely matches statements required for income tax purposes. E. In cash accounting, an event is recognized when the obligation for a cash transaction is created.

Answers

Answer:

In cash accounting, an event is recognized when a cash transaction occurs

Explanation:

Account

This is simply a place to summarize all of the transactions that influence or affect one particular asset, liability, equity, revenue, expense, gain, or loss item.Cash are said to be asset.

Cash Accounting (COST)

This usually show (recognize) revenues and expenses when cash is physically paid or received even if or when transaction do happens. That is it will record only those transactions that affect cash ( only when someone gives or receives cash). It is very common in smaller business and can be a little inaccurate.

Accrual Accounting on the other hand, record revenue when sale is made and not when cash received. It also records expense when they arise and not when they are paid. It links revenues to when they were earned, while expenses when they are incurred. It is very common in bigger business and said to be more accurate indication of performance.

Your company, a small start-up corporation, buys raw materials from Regina Fabrics on credit. Because her company has had several problems over the recent months, Regina demands either full payment in advance or a guaranty from someone with proof of assets to cover the debt. Your company does not have the cash on hand but you have sufficient assets to cover the debt and so you sign a guaranty on a six-month loan for the fabric. After two months, your company has the cash to pay off the loan and your financial officer offers to pay Regina. Because of some issues with her company, she refuses to accept payment and requests that you continue to pay the monthly payments. A month later your company is now short on cash and Regina comes to you as the guaranty and requests that you make the payment. You are unhappy that she didn't accept the payment when you had the cash. Evaluate whether or not you should have to pay as the guaranty.

Answers

Answer: See explanation

Explanation:

I believe that the main thing here that can favor my company is if there's documentation for every process involved with my dealings with Regina Fabrics.

This could have been solved if she didn't reject the cash that was offered to her company after two months, so there should be a formal documents that shows that she rejected the cash which should be acknowledged and signed by her. Also, the monthly payments received by her should be documented as well.

With regards to the above, if there is a formal documentation in place, then I won't have to pay as the guaranty but if this isn't in place, then I may have to pay since there won't be evidences against her.

1. Using a plantwide overhead rate based on cases, compute the overhead cost that is assigned to each case of Extra Fine Salsa and each case of Family Style Salsa. 2. Using the plantwide overhead rate, determine the total cost per case for the two products if the direct materials and direct labor cost is $9 per case of Extra Fine and $8 per case of Family Style. 3.a. If the market price of Extra Fine Salsa is $17 per case and the market price of Family Style Salsa is $12 per case, determine the gross profit per case for each product. 3.b. What might management conclude about the Family Style Salsa product line

Answers

The answer is 13 u add them

A company wants to set up operations in a country with the following corporate tax rate structure: Taxable Income Tax Rate <$50,000 15% $50,000 - $75,000 25% $75,000 - $100,000 34% >$100,000 39% Therefore, a taxable income of $60,000 would result in taxes due of $50,000*0.15 + ($60,000-$50,000)*0.25 = $50,000*0.15 + $10,000*0.25 = $10,000 If the compay expects gross revenues of $300,000, $150,000 in total costs, $20,000 in allowable tax deductions and $6,000 in a one-time business start-up credit, how much should the company expect to pay in taxes?

Answers

Answer:

$183,950

Explanation:

The computation is shown below:

Total taxable income is

= $300,000 - $150,000 - $20,000

= $130,000

Now tax is

= 15% of  $50,000 + 25% of ($75,000 - $50,000) + 34% of ($100,000 - $75,000) + 39% of ($530,000 - $100,000)

= 0.15 of $50,000 + 0.25 of $25,000 + 0.34 of $25,000 + 0.39 of $430,000

= $189,950

Now Tax owed is

= $189,950 - $6,000

= $183,950

What are the answers to the management quiz 13,14,15, and 16

Answers

Answer:

The question is not quiet clear? Would you explain a bit more please?

Bank reconciliations

Answers

Answer:

When you reconcile your business bank account, you compare your internal financial records against the records provided to you by your bank. A monthly reconciliation helps you identify any unusual transactions that might be caused by fraud or accounting errors, and the practice can also help you spot inefficiencies.

Meaning:

A bank statement is a list of all transactions for a bank account over a set period, usually monthly. The statement includes deposits, charges, withdrawals, as well as the beginning and ending balance for the period.

Bruce Tulgan, a consultant on generational workplace issues, estimates that 3.5 million people between the ages of 40 and 58 vanished from the American workforce from 2001 to 2004. That's about 5 percent of all baby-boomers. Tulgan writes, "Older white-collar workers are quickly becoming disenfranchised through no fault of their own. They have difficulty getting back into the job market, and when they do, their compensation is often significantly reduced." The disenfranchisement of baby boomers is an example of

Answers

Answer:

unequal treatment and hostile impact

Explanation:

The baby boomers are defined as the demographic cohort of people who were born between the year 1946 to year 1964. This generation of people are known a the baby boomers.

In the context, according to a consultant of generational workplace issues, Bruce Tulgan nearly 5% of all the baby boomers  got vanished from the American workforce between the year 2001 to 2004. These white collar workers are becoming disenfranchised from their job through no fault of their own. The disenfranchisement of these baby boomers is an example of :

-- hostile impact

-- bona fide discrimination

-- quid pro quo selectivity

-- gender selectivity

-- unequal treatment

In order to sell a product at a profit, the product must be priced higher than the total cost to build the unit, plus period expenses and overhead. At the end of last year, Chester had their product Cake aimed at the Low End segment. Cake's production cost (labor + materials) last year was $14.07 ($5.89 unit labor cost and $8.18 unit material cost). Exclude possible inventory carrying costs. Assume period expenses and overhead total 50% of their production cost. What is the minimum price the product could have been sold for in the American region to cover the unit cost, period expenses, and overhead?

Answers

Answer:

Chester Cakes

The minimum price the product could have been sold for in the American region to cover the unit cost, period expenses, and overhead is:

= $21.11.

Explanation:

a) Data and Calculations:

Production cost:

Labor per unit =            $5.89

Materials per unit            8.18

Total production cost $14.07

50% Overhead               7.04

Minimum price =          $21.11

b) The minimum price for a unit of the cake includes the total variable production cost and the determined 50% overhead on the production cost to cover period expenses and other overhead costs.

The net income reported on the income statement is $97,309. However, adjusting entries have not been made at the end of the period for the
supplies expense of $2,135 and accrued salaries of $1,163. Net income, as corrected, is
a. $96,146
b. $97,309
c. $94,011
d. $95,174

Answers

The answer to your question is D

When the money market is drawn with the value of money on the vertical axis, an increase in the money supply causes the equilibrium value of money Group of answer choices to decrease, while the equilibrium quantity of money increases. and equilibrium quantity of money to decrease. and equilibrium quantity of money to increase. to increase, while the equilibrium quantity of money decreases.

Answers

Answer:

to decrease, while the equilibrium quantity of money increases.

Explanation:

an increase in money supply, leads to a rightward shift of the money supply curve. As a result, interest rate falls. money supply increases. There is an increase in equilibrium money supply but equilibrium value falls

QUESTION 16
You are a school photographer taking individual and class pictures for 2 classes of 21 students each. On average, each individual picture
takes 3 minutes and a class picture takes 10 minutes. About how long should it take you to get all of the pictures?
O A 1 hour 3 minutes
OB. 1 hour 13 minutes
OC. 2 hours 6 minutes
OD. 2 hours 16 minutes
OE 2 hours 26 minutes

Answers

i would say, D. 2 hours & 16 minutes

Nie choice
Remedies available to a patent owner whose patent rights have been infringed include all of the following except
- an injunction
- attorney fees
- maximum monetary damages
- minimum monetary damages

Answers

Answer: maximum monetary damages

Explanation:

Answer: attorney fees

Explanation:

edge 2021

Question 2: DuPont method In year 2016, Apple Inc. had profit margin of 27.8% (i.e., it generated 27.8 cents of profit per dollar of sales) and asset turnover of 0.670 (i.e., it generated 67.0 cents of annual sales per dollar of assets). a) The profit margin indicates that Apple has low pricing power -- it cannot charge high prices relative to costs high production efficiency -- it has very low costs high pricing power -- it can charge high prices relative to costs The asset turnover indicates that Apple is extremely efficient in generating assets per dollar of sales extremely efficient in generating sales per dollar of assets relatively inefficient in generating sales per dollar of assets b) Compute Apple's return on investment (ROI) ROI

Answers

Answer and Explanation:

a. The profit margin represent  that it could charge high prices that should be relative to the cost while on the other hand the asset turnover represent that it is relatively non-efficient for producing sales per asset dollar

b. Now the return on investment is

= Profit margin × asset turnover

= 27.8% × 0.670

= 18.6

The same would be relevant

explain the following definition of marketing ethics

Answers

Answer:

Explanation:

The concept of ethical marketing refers to the way in which companies and / or enterprises market their goods and services: the focus does not only revolve around the benefits of their offer for customers, but also on how they impact on causes and / or responsible actions with society and / or the environment ..

he management of Green Energy Manufacturing is analyzing variable overhead variances for the fiscal period just ended. The flexible budget called for $176,000 in variable overhead but actual variable overhead was $100,000. In computing the overhead variances, Green's management discovered that it had used 40,000 pounds of direct material, rather than the budgeted amount of 44,000 pounds. (Pounds of direct material is the single overhead driver of variable overhead). The standard variable overhead rate per pound of direct material is $2.00. What is Green's variable overhead spending variance

Answers

Answer:

See below

Explanation:

With regards to the above, Green's variable overhead spending variance is computed as

= Flexible budget - Actual variable overhead.

Given that

Flexible budget in variable overhead = $176,000

Actual variable overhead = $100,000

Therefore,

Variable overhead spending variance

= $176,000 - $100,000

= $76,000 F

8. What is an example of a situation in which a shortage is caused by a change in
supply?

Answers

Answer:

Temporary supply constraints, e.g. supply disruption due to weather or accident at a factory.

Fixed prices – and unexpected surge in demand, e.g. demand for fuel in cold winter.

Government price controls, such as maximum prices.

Monopoly which restricts supply to maximise profits.

Sara works at a printing company. She and her colleagues have to stagger
their tasks carefully because each of their projects require not only the
printers, but other equipment as well. Sara is currently working to fulfill an
order for 5,000 flyers, which are due tomorrow. Her customer just called to
say that they need additional 5,000 flyers.
What will be least important to Sara as she determines whether her company
can accommodate the request?
A. Whether her company has enough paper on hand
B. Whether her company can print the additional flyers without
negatively affecting the other projects
C. Whether there is enough time to print the additional flyers by
tomorrow
D. Why the customer needs 5,000 extra flyers

Answers

Answer: D. Why the customer needs 5,000 extra flyers

Explanation:

The important factors that Sara will consider to know whether her company can accommodate the request are:

• Whether her company has enough paper on hand

• Whether her company can print the additional flyers without negatively affecting the other projects

• Whether there is enough time to print the additional flyers by tomorrow.

These factors above are important as they'll determine if she can accept the request or not. For example, in a situation where there's no enough paper, then the request should not be accepted.

The least important factor for Sara to consider will be "Why the customer needs 5,000 extra flyers". This is not of concern to Sara and shouldn't bother her.

Answer:

D. why the customer needs 5,000 extra flyers

A customer places an order on January 1, 2019. Fifteen days later, that order is received by the manufacturing department. Twenty days later, the order is put into production. Processing (manufacturing) time is 25 days for this order. The completed order is then shipped 15 days later. For this order, what was the total customer-response time (CRT), in days

Answers

Answer: 75 days

Explanation:

The total customer-response time (CRT), will be calculated as:

Order received by the manufacturing department = 15 days

Add: Order put into production = 20 days

Add: Processing time = 25 days

Add: Shipping Time = 15 days

Total customer response time = 75 days

Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month

Answers

Answer:

$28,800

Explanation:

Follow the given collection policy :

Cash Collection = 60 % in month of the sale + 40 %  in the following month

therefore,

During the first month :

Cash Collection = 60 % in month of the sale only

                            = $48,000 x 60 %

                            = $28,800

The expected cash collections from credit sales during the first month is $28,800

For an open economy under a floating exchange rate regime, _________________________.

a.) Monetary policy is highly effective.

b.) Fiscal policy is highly effective.

c.) Monetary policy is ineffective.

d.) B and C.

Answers

The answer is either B or D

Abbott, Inc., plans to issue $500,000 of ten percent bonds that will pay interest semiannually and mature in five years. Assume that the effective interest rate is 12 percent per year compounded semiannually. Calculate the selling price of the bonds. Round answers to the nearest whole number.

Answers

Answer:

$463,202.25

Explanation:

The calculation of the selling price of the bond is given below:

The selling price of the bonds is

= Present value of interest + Present value of maturity

where,

In semi-annually basis , the rate of interest would be divided by 2 and the time period would be double

So, The Present value of interest equals to

= $500,000 × 5% × 7.36009

= $184,002.25

The 7.36009 represent PVIFA factor. Refer to the PVIFA table for the same  

And, the Present value of maturity is  

= $500,000 × 0.5584

= $279,200

So, the selling price of the bond is  

=  $184,002.25 +  $279,200

= $463,202.25

The type of listing agreement that provides for the payment of a commission to the broker even if the owner himself makes the sale without the aid of the broker is called a(n)

a.
open listing

b.
option listing

c.
exclusive-agency listing

d.
exclusive-right-to-sell listing

Answers

C) exclusive agency listing

Barbella purchased a wedding ring for $15 at a yard sale in May. She thought the ring was costume jewelry, but it turned out to be a real diamond ring. She is not in the business of buying and selling anything. She researched the ring on the internet and discovered that it was worth at least $1,000. She sold it on an internet auction site for $1,100 in July. Was the ring a capital asset

Answers

Answer:

a. Yes, the ring is a capital asset.

b-1. The amount the gain from its sale by Barbella is $1,085.

b-2. Since the ring was held by Barbella for less than a year, the nature of the gain is therefore a short term capital gain.

Explanation:

Note: This question is not complete. The complete question is therefore provided before answering the question as follows:

Barbella purchased a wedding ring for $15 at a yard sale in May. She thought the ring was costume jewelry, but it turned out to be a real diamond ring. She is not in the business of buying and selling anything. She researched the ring on the Internet and discovered that it was worth at least $1,000. She sold it on an Internet auction site for $1,100 in July.

a. Was the ring a capital asset?

b. What were the amount and nature of the gain or loss from its sale by Barbella?

Explanation of the answers is now given as follows:

a. Was the ring a capital asset?

Yes, the ring is a capital asset.

Despite that Barbella purchased the wedding ring for personal use, the ring still has to be treated as a capital that it is actually is.

b. What were the amount and nature of the gain or loss from its sale by Barbella?

b-1. The amount of the capital gain can be calculated as follows:

Capital gain = Sales proceed - Cost of purchase = $1,100 - $15 = $1,085

Therefore, the amount the gain from its sale by Barbella is $1,085.

b-2. Since the ring was held by Barbella for less than a year, the nature of the gain is therefore a short term capital gain.

Other Questions
Do you believe athletes need to be involved in social change? Why? Help me with this problem please please:):) Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1