\frac{x-5}{x^4-2x^3}\cdot \frac{x^2-4}{x^2-3x-10} x 4 −2x 3 x−5 ​ ⋅ x 2 −3x−10 x 2 −4 ​

Answers

Answer 1

Answer:

[tex]\frac{x-5}{x^4-2x^3}\cdot \frac{x^2-4}{x^2-3x-10} = \frac{1}{x^3}[/tex]

Step-by-step explanation:

Given

[tex]\frac{x-5}{x^4-2x^3}\cdot \frac{x^2-4}{x^2-3x-10}[/tex]

Required

Solve

Express [tex]x^2-4[/tex] as difference of two squares

[tex]\frac{x-5}{x^4-2x^3}\cdot \frac{(x-2)(x+2)}{x^2-3x-10}[/tex]

Factorize [tex]x^4 - 2x^3[/tex]

[tex]\frac{x-5}{x^3(x-2)}\cdot \frac{(x-2)(x+2)}{x^2-3x-10}[/tex]

Cancel out x - 2

[tex]\frac{x-5}{x^3}\cdot \frac{x+2}{x^2-3x-10}[/tex]

Expand [tex]x^2 - 3x - 10[/tex]

[tex]\frac{x-5}{x^3}\cdot \frac{x+2}{x^2+2x-5x-10}[/tex]

Factorize:

[tex]\frac{x-5}{x^3}\cdot \frac{x+2}{x(x+2)-5(x+2)}[/tex]

Factor out x + 2

[tex]\frac{x-5}{x^3}\cdot \frac{x+2}{(x-5)(x+2)}[/tex]

Cancel out x - 5 and x + 2

[tex]\frac{1}{x^3}\cdot \frac{1}{1}[/tex]

[tex]\frac{1}{x^3}\cdot 1[/tex]

[tex]\frac{1}{x^3}[/tex]

Hence:

[tex]\frac{x-5}{x^4-2x^3}\cdot \frac{x^2-4}{x^2-3x-10} = \frac{1}{x^3}[/tex]


Related Questions

Which of the following represents a translation if the figure?
A.
B.
C.
D. ​

Answers

Answer:

b

Step-by-step explanation:

a translation is when it looks exactly the same but is on the other side of the line

How does the mean compare to the median? How do the values of 7 and 9 affect these measures of center?



Sorry I suck at taking pictures, and math apparently.

Answers

Answer:Bueno, normalmente en los artículos semanales intento transmitir dudas o cuestiones que están en el campo, los trending topics del sector porcino, y está claro que la estadística no es uno de ellos, pero precisamente ayer se dio una situación que me llevó a escribir ésta entrada.

Todos los que trabajamos en el sector porcino estamos acostumbrados a manejar y calcular un montón de datos que nos proporciona el programa de gestión, y en muchas ocasiones realizamos pequeñas (o grandes) pruebas, donde manejamos infinidad de números (pesos, GMD, IC etc…)

Lo que sí es cierto, es que la mayoría de nosotros usamos siempre la media como herramienta fundamental. Media de Nacidos vivos, Media de destetados, Media de peso al nacer, media de peso al destete…..media, media, media…y ¿qué tal si usáramos la Mediana?

Éste fue el debate que tuve ayer con un ingeniero agrónomo (si, si, y yo Veterinaria, diversión asegurada), y el que me ha inspirados para hoy.

Para el que, en estos momentos, esté rebuscando en los archivos de su cerebro, “yo esto lo sabía”, un pequeño recordatorio:

La media o promedio, Se interpreta como “punto de equilibrio” o “centro de masas  del conjunto de datos. Es un cálculo muy sencillo en el que intervienen todos los datos. Consiste en el sumatorio de todos los datos dividido por el número de valoresLa mediana, en cambio, es un valor de la variable que deja por debajo de sí a la mitad de los datos, y por encima, la otra mitad.( una vez que estos están ordenados de menor a mayor). Se sitúa, por lo tanto, en la mitad real de los datos.

Es mucho más difícil de calcular:

Con un ejemplo se entiende muchísimo mejor.

Imaginaos una empresa en la que la mayoría de los trabajadores tienen un sueldo de 1000 euros, excepto 2 encargados que cobran 2000 y el jefe que cobra 6000 euros mensuales.

¿Cuál es el salario medio de la empresa?

Si vemos la media sale casi 2000 euros, si miramos la mediana, nos da 1000.

¿Cuál se aproxima más a la realidad?

Cuando los datos son muy homogéneos la media nos da un valor representativo de la realidad, pero cuando los datos son muy heterogéneos no.

Un ejemplo más cercano a nosotros

Queremos saber el peso de los lechones a destete. Imaginemos que la camada A tiene los siguientes pesos:  (4-3-5-4.5-6.1-5-3-5.1-6.4-6-6.5-5.5-4.9).

Step-by-step explanatio

find rational numbers between -3/2 and 5/3

Answers

Answer:

Five rational numbers between -5/3 and -8/7 are- Read more on Sarthaks.com - https://www.sarthaks.com/830151/find-five-rational-numbers-between-5-3and-8-7

Step-by-step explanation:

what expression is equivalent to 3(7x-z+5)

Answers

21x-15

explanation
3x7x=21x

3x5=15

dont forget the - sign!
Therefore 3(7x - 5)= 21x - 15

Solve cos(theta)>sqrt3/2 for 0

Answers

Step-by-step explanation:

If you put some quantities for theta, you reach to B option

Find the area of each sector. Round your answer to nearest tenth

Answers

Answer:

area of 150° segment = 188.5 km²

Step-by-step explanation:

area of full circle = πr² = (3.14)(12²) = 452.16 km²

area of segment = (150°/360°)(452.16) = 188.5 km²

the area of each sector is C

Can someone pleaseeee help and if you’re correct i’ll give brainliest

Answers

Answer:i think is the fourth one or the fifth one.

Step-by-step explanation:

Answer:

california

Step-by-step explanation:

HELPP ME PLLSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS

Answers

Answer:

d

Step-by-step explanation:

thats just the anwser

The answer is D

We know multiplication simplified is just addition so 2b and b+b will always equal the same thing. And since 3c stays the same, b+b+3c is equal to 2b+3c

What is the volume, in cubic centimeters, of a rectangular prism with a height of 7 centimeters, a width of 6 centimeters, and a length of 14 centimeters?

Answers

Answer:

588

Step-by-step explanation:

multiply length x width x height 7×6×14

Step-by-step explanation:

multiply 7,6,14

=588

therefore the answer in cubic centimeters is= 588

Expand.
Your answer should be a polynomial in standard form.
(7g+2)(5g+4)=

Answers

Answer:

35g^2 +38g +8

Step-by-step explanation:

PLEASE HELP ASAP!!! 10 points!!!!

Answers

Answer: y=-1/2x+2/3

Hope this helps! attached the image

90 which is the corcumince of 20

What is the sum of an 8 term geometric series if the first term is -11 and the last term is 859,375 and the common ratio is -5

Answers

Answer:716,144

Step-by-step explanation:

Given

No of the terms in GP [tex]n=8[/tex]

First-term [tex]a=-11[/tex]

last term [tex]a_n=859,375\quad (ar^{n-1})[/tex]

Common ratio [tex]r=-5[/tex]

The Sum of a GP is given by

[tex]S_n=\dfrac{a(1-r^n)}{1-r}\quad \quad [r<1][/tex]

Put the values

[tex]\Rightarrow S_n=\dfrac{-11(1-(-5)^8)}{1-(-5)}\\\\\Rightarrow S_n=\dfrac{-11\times -390624}{6}\\\\\Rightarrow S_n=\dfrac{42,96,864}{6}=716,144[/tex]

Answer this and i will thank you

Answers

Answer:

Answer what? a question needs to be posted.

Step-by-step explanation:

*answer will be updated*

Answer:

24 si efil rewsna eht

Step-by-step explanation:

The number 42 is, in The Hitchhiker's Guide to the Galaxy by Douglas Adams, the "Answer to the Ultimate Question of Life, the Universe, and Everything", calculated by an enormous supercomputer named Deep Thought over a period of 7.5 million years. Unfortunately, no one knows what the question is.

Divisors: 1, 2, 3, 6, 7, 14, 21, 42

Ordinal: 42nd; (forty-second)

Cardinal: forty-two

Binary: 1010102

I need help with this i don’t understand this

Answers

Answer:

13.<CAF = 145

14.<ABC = 50

15.<KCJ = 95

16.<ABG = 130

17.<BCJ = 85

18.<CAB = 35

19.<x =60

20.<y =120

21.<z = 133

22.<w = 47

23.<m = 128

24.<p = 52

Step-by-step explanation:

It just looking at the vertically opposite angle to find the exact angle.

Ex. <CAF = <BAD

Write the number in 2 equivalent forms as a fraction, decimal, or percent.
5/8
What is the equivalent decimal?

Answers

Answer:

0.625 62.5%

Step-by-step explanation:

Answer:

Step-by-step explanation:

Dividing 5 by 8 on a calculator results in the "equivalent decimal:"

5/8 = 0.625

0.625 converts to 62.5%:  a percent

5/8 is a proper fraction

Length times width is the formula for what quadrilateral?
O rhombus
trapezoid
O rectangle
square
Previous

Answers

Answer:

area of rectangle and square

simplify the expression below using the distributive property:

4x - 2(x + 5)

Answers

Answer:

It is 2x-10

Step-by-step explanation:

It is 2x-10 because when you are doing this you want to try to get the x alone but in this case it is not dertinable

At a school picnic, 80 students ordered hot dogs and 63 hamburgers. Of those, 14 students ordered both a hot dog and hamburger. If there were 180 students at the picnic, how many students did not offer a hot dog or hamburger

Answers

Answer:

The answer should be 37

Step-by-step explanation:

Rectangle ABCD is translated to form the image A'B'C'D'.
What are the new coordinates of point D?

Answers

Answer:

i think its (6,4)

Step-by-step explanation:

What does civic participation include? Check all that apply. cleaning up street litter helping neighbors in trouble paying all taxes on time helping communities in trouble testifying as a witness in court

Answers

Answer:

i think it is 1,2,3

Step-by-step explanation:

sorry if im wrong :(

Answer:

ABC

Step-by-step explanation:

edge 2021

please correct me if wrong

The temperature on the moon can vary from -172 to -126 degrees celsius. Find the difference between the maximum and minimum temperatures. Write with explanation PLEASE!!!

Answers

Given:

The temperature on the moon can vary from -172 to -126 degrees Celsius.

To find:

The difference between the maximum and minimum temperatures.

Solution:

It is given that the temperature on the moon can vary from -172 to -126 degrees Celsius.

Since [tex]-172 <-126[/tex], therefore the minimum temperature is -172 and the maximum temperature is -126.

The difference between the maximum and minimum temperatures is:

Difference = Maximum temperature - Minimum temperature

[tex]\text{Difference}=-126-(-172)[/tex]

[tex]\text{Difference}=-126+172[/tex]

[tex]\text{Difference}=46[/tex]

Therefore, the difference between the maximum and minimum temperatures is 46 degrees Celsius.

Hannah is making biscuits. The recipe calls for 2/3 cup of flour to make 4 biscuits. What is the unit rate for cups of flour per biscuit.​

Answers

Answer:

2.6

Step-by-step explanation:

2/3 x 4 = 2.6

A brick wall is to form one side of a rectangular garden and three other sides me to be done by 40
feet of fencing Find the largest area the garden can have.

Answers

Answer:

80 probaly

Step-by-step explanation:

how many solutions does each system of equation have?? explain how you know without solving the system ​

Answers

Answer:

no solution

Step-by-step explanation:

the x value in a linear equation in slope intercept form represents the slope of the line, since both equations int the system have the same slope there is no solution.

Of 570 people, 365 were male and 368 had brown hair. Of those with brown hair, 108 were female. What is the probability that a person was male or had brown hair? Write your answer as a reduced fraction.

Answers

Answer:

473/570

Step-by-step explanation:

No. of male = 365

No. of female = 570-365 = 205

No. of male with brown hair = 260

No. of female with brown hair = 108

the probability that a person was male or had brown hair = 365/570+108/570 = 473/570 [ for or case we add probabilities]

Answer:

Around 83%        473/ 570

Step-by-step explanation:

365 males  + 108 females with brown hair = 473

Divide the number of outcomes desired by the total  number of outcomes 473/570   = 0.829824....... = 82.98.....%

everyone do me a favor and nominate "thebecks" as the educator of th.e year!

Answers

Answer:

will do

Step-by-step explanation:

and hello friend lol :)

Answer:

imma bout to answer my own question

Step-by-step explanation:

PLEASE HELP VERY IMPORTANT​

Answers

i thinks it’s the second choice, not sure if i’m correct.

Janea bought a motorcycle for dollars. It depreciates by a factor of each year. Which expression best predicts the value of the car after 10 years?

Answers

Answer:

m·n¹⁰

Step-by-step explanation:

Required equation is in the form of:

V(t) = P*r^t, V- future value, P- present value, r- rate, t- time

In terms of this question:

m·n¹⁰ is the correct choice

Javed downloaded from the Internet two files that had a combined size of 696 megabytes. The size of the first file was 290 megabytes, and it took 5 minutes to download. Assuming that the files downloaded at a constant speed, how long did it take for the second file to download?

Answers

Answer:

7 minutes

Step-by-step explanation:

The computation of the time taken for downloading the second file is given below:

Given that

The combined size for both files is 696 megabyres

And, the size of the first file is 290 megabytes

So, the size of the second file is

= 696 - 290

= 406

Now for the first file it took 5 minutes to download

So for the second file, it would took

= 406 × 5 minutes ÷ 290

= 7 minutes

Answer:

7 minutes

Step-by-step explanation:

The computation of the time taken for downloading the second file is given below:

Given that

The combined size for both files is 696 megabyres

And, the size of the first file is 290 megabytes

So, the size of the second file is

= 696 - 290

= 406

Now for the first file it took 5 minutes to download

So for the second file, it would took

= 406 × 5 minutes ÷ 290

= 7 minutes

WILL GIVE BRAINLIEST

5. Find the length of arc in red. Leave answer in terms of pi.

A) 25 pi m
B) 27 pi m
C) 29 pi m
D) 31 pi m

Answers

C is the best answer choice for you
Other Questions
Which structures are least likely to appear in the same eukaryotic cell?A. mitochondria and chloroplastsB. ribosomes and mitochondriaC. a cell wall and chloroplastsD. small vacuoles and a cell wall HELPPPPPP: Simplify - {- [- (-8) ] } Write a research-based argumentative essay for or against free education for children worldwide.Don't answer with a question just ask in the comment please. what is the x-intercept? Micheal home is 12 feet below and his mother's home is 12 above sea levelMicheal says their homes are elevations because they are in opposite directions Is he correct? Explain. When did the agency say something would be stolenBy evening In the afternoonIn the eveningAt 5:30pmThe answer is by evening Do you believe athletes need to be involved in social change? Why? Help me with this problem please please:):) Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours.