find the estimate and the exat case of the the following 23 books at $263. 64 each

Answers

Answer 1

Answer:

Estimate: $5,000.00

Actual: $6,063.72

Step-by-step explanation:

I would estimate by finding 20 x 250

I know that 10 x 250 would be 2500 and if I double that, I would get 5,000.

Helping in the name of Jesus.


Related Questions

5. A deli bought 45kg of tuna salad R1.48 per kg. In warm weather about 5kg usually spoil before they can be sold. What price per kg will give the desired profit of 40% of selling price?​

Answers

The deli needs to sell the tuna salad at a price of R2.33 per kg to achieve a profit of 40% of the selling price after 5kg spoilage.

What price per kg will give the desired profit of 40% of selling price?​

A desired profit also known as target profit means expected amount of profit that the managers of a business expect to achieve by the end of a designated accounting period.

First, let's calculate the cost of the tuna salad the deli purchased:

= 45kg x R1.48/kg

= R66.60

How much tuna salad the deli has left after spoilage:

= 45kg - 5kg

= 40kg

To achieve a profit of 40% of the selling price, the selling price should be 140% of the cost price: which is:

= 140% of cost price

= 1.4 x R66.60

= R93.24

To find the price per kilogram, we divide the selling price by the remaining amount of tuna salad:

= Selling price / Remaining amount of tuna salad

= R93.24 / 40kg

= R2.33/kg

Read more about selling price

brainly.com/question/1445853

#SPJ1

Answer: 6 dolla per kg

Step-by-step explanation:

In 1970, 11% of Americans completed four years of college

Answers

Answer:

Thank you for the statement. Is there a question or additional information you would like me to respond to?

Step-by-step explanation:

solve for x: p(x)=x^3+6x^2+3x-10=0

Answers

Answer:

Step-by-step explanation:

P(x)=x³+6x²+3x-10=0

x³+2x²+4x²+8x-5x-10=0

x²(x+2)+x(x+2)-5(x+2)=0

(x+2)(x²+x-5)=0

either x+2=0,x=-2

or

x²+x-5=0

[tex]x=\frac{-1 \pm \sqrt{1^2-4 \times 1 \times(-5)} }{2 \times 1} \\=\frac{-1 \pm \sqrt{21} }{2} \\Hence ~x=\frac{-1+\sqrt{21} }{2} \\or\\x=\frac{-1 -\sqrt{21} }{2}[/tex]

pls help!!! right answer only!! Find the equation of a line perpendicular to y= −3x − 10 that passes through the point (9,−2).

Answers

Answer:

y = [tex]\frac{1}{3}[/tex] x - 5

Step-by-step explanation:

the equation of a line in slope- intercept form is

y = mx + c ( m is the slope and c the y- intercept )

y = - 3x - 10 ← is in slope- intercept form

with slope m = - 3

given a line with slope m then the slope of a line perpendicular to it is

[tex]m_{perpendicular}[/tex] = - [tex]\frac{1}{m}[/tex] = - [tex]\frac{1}{-3}[/tex] = [tex]\frac{1}{3}[/tex] , then

y = [tex]\frac{1}{3}[/tex] x + c ← is the partial equation

to find c substitute (9, - 2 ) into the partial equation

- 2 = [tex]\frac{1}{3}[/tex] (9) + c = 3 + c ( subtract 3 from both sides )

- 5 = c

y = [tex]\frac{1}{3}[/tex] x - 5 ← equation of perpendicular line

What can be said about the relationship between triangles and circles? Check all that apply

Answers

The correct answer of the folowing question is option B and d in context to the circle and triangle

How to solve the problem?

Triangles and circles have a close relationship in geometry, and several interesting properties and theorems connect them.

One triangle inscribed in circle: This statement is true, and it refers to the property of a circle that can be inscribed in a triangle. In other words, if we draw a circle that passes through all three vertices of a triangle, then the triangle is said to be inscribed in the circle. The center of the circle is called the circumcenter of the triangle, and it is the intersection point of the perpendicular bisectors of the sides.

Many triangles inscribed in circle: This statement is also true, as there are many different triangles that can be inscribed in the same circle. For example, if we draw a circle and pick any three points on its circumference, then we can connect these points to form a triangle that is inscribed in the circle.

One circle inscribed in triangle: This statement is true, and it refers to the property of a triangle that can be inscribed in a circle. In other words, if we draw a circle that is tangent to all three sides of a triangle, then the circle is said to be inscribed in the triangle. The center of the circle is called the incenter of the triangle, and it is the intersection point of the angle bisectors.

Many circles inscribed in triangle: This statement is false, as there can only be one circle that is inscribed in a given triangle. However, there are other circles that can be associated with a triangle, such as the circumcircle and the excircles. The circumcircle is the circle that passes through all three vertices of the triangle, while the excircles are the circles that are tangent to one side of the triangle and the extensions of the other two sides.

In summary, triangles and circles are closely related in geometry, and their properties and theorems are important in various areas of mathematics and science.

To know more about triangles visit :-

https://brainly.com/question/17335144

#SPJ1

Pls help fast! Will get 20+ and brainliest

Answers

Answer:

a) 30 × .5 = 15 days

b) .2 + .1 = .3

Look at this table:
y =
X y
4
6
7
3
5
-24
-29
-34
-39
-44
Write a linear (y = mx + b), quadratic (y = ax2), or exponential (y = a(b)*) function that
models the data. Help plis

Answers

It should be noted that the function that can model the data is a linear function since there's a constant difference or -5.The linear function is y = -5x - 9.

How to explain the function.

In this case, to determine whether the data is best modeled by a linear, quadratic, or exponential function, we can first plot the data points and see what type of curve they form. However, since we are only given five data points, it can be difficult to make a definitive determination.

One way to estimate the type of function is to look at the differences between the y values. For example, if the differences between the y values increase by a constant amount, then the data may be best modeled by a linear function. If the differences increase by a constant squared amount, then the data may be best modeled by a quadratic function.

Here, the constant difference will be:

= -29 - (-24)

= -5

This depicts a linear function.

Learn more about functions on;

https://brainly.com/question/10439235

#SPJ1

Find the measure of X

Answers

Answer:

[tex]c=18.8389[/tex]

Step-by-step explanation:

To find hypotenuse [tex]C[/tex] use formula:

 [tex]\text{sin}(\alpha )=\frac{a}{c}[/tex]

After substituting [tex]\alpha =48^o[/tex] and [tex]a=14[/tex] we have:

[tex]\text{sin}(48^o)=\frac{14}{c}[/tex]

[tex]0.7431=\frac{14}{c}[/tex]

[tex]c=\frac{14}{0.7431}[/tex]

[tex]c=18.8389[/tex]

Answer:31

Step-by-step explanation:

14/2=7 48/2= 24 7+24=31

Help with math problems

Answers

Answer:

The answer is 7d < -6

Step-by-step explanation:

3d-8<4d+2

3d+4d<-8+2

7d<-6

Round the solution up to the nearest whole number, if necessary.

Answers

A sample size that would give the standard deviation of [tex]\bar{x}[/tex] equal to 0.8 years is 1,227.

How to determine the sample size?

In Mathematics and Statistics, a sample size that would result in a standard deviation of 0.8 years can be calculated by using the mathematical equation (formula):

Sample size, n = (zσ/ME)²

Where:

n represents the sample size.z represents the z-score of the desired confidence level. σ represents the standard deviation of the population.ME represents the margin of error.

By assuming a confidence level of 95% with a z-score of 1.96, we would substitute the given parameters into the formula for sample size as follows;

Sample size, n = (zσ/E)²

Sample size, n = (1.96 × 14.3/0.8)²

Sample size, n = (28.028/0.8)²

Sample size, n = (35.035)²

Sample size, n = 1,227.45 ≈ 1,227.

Read more on sample size here: brainly.com/question/30520316

#SPJ1

Complete Question:

Suppose the standard deviation of the ages of all Florida panthers is 14.3 years. Let [tex]\bar{x}[/tex] be the mean age for a sample of a certain number of Florida panthers. What sample size will give the standard deviation of [tex]\bar{x}[/tex] equal to 0.8 years?

Round the solution up to the nearest whole number, if necessary.

Someone please answer this
30 points+Brainliest

Answers

Answer:

122 degrees.

Step-by-step explanation:

To calculate the measure of the sector that represents the probability of a rainy day using a spinner, we need to first determine the angle of the sector that represents the probability of a rainy day.

The probability of a rainy day is given as P(raining) = 0.34, which means that out of 100 days, 34 are rainy. Therefore, we can express the angle of the sector as:

Angle of sector = Probability of rain * Total angle of the spinner = 0.34 * 360 = 122.4 (rounded to the nearest degree)

So the measure of the sector that represents the probability of a rainy day is 122 degrees (rounded to the nearest degree).

Therefore, the answer is 122 degrees.

Answer:122°

Step-by-step explanation:

we have a 34% probability that it will rain and 66% that it won't rain. and full spin is 360 degrees which we can also symbolize as 100%.

so, if  

        360-----------100%

         x---------------34%

x=360*34/100≈122°

What is the length of the hypotenuse of a 45°-45°-90° triangle with leg length 5√3?
D. 10√6
A. 2√6
B. 5√6
C. 10√3

Answers

The response is B) 5√6 in accordance with the provided assertion.

What in mathematics is the hypotenuse?

The hypotenuse of a right triangle is its longest side; its "opposite" side is the side that confronts the angle in issue; and its "adjacent" half is the side that faces it.

In a 45°-45°-90° triangle, the two legs are congruent, and the hypotenuse is equal to the leg multiplied by √2.

In this case, the leg length is given as 5√3.

Thus, the hypotenuse will have the following length:

hypotenuse = leg x √2 = 5√3 x √2 = 5√(3 x 2) = 5√6

Therefore, the answer is B) 5√6.

To know more about Hypotenuse visit:

https://brainly.com/question/29407794

#SPJ1

Sarah spent 5 minutes painting. She spent twice as much time reading
as she spent painting. She spent 35 more minutes hiking than she
spent reading. How many minutes did she spend doing these three
activities?

Answers

After answering the provided question, we can conclude that So the total  equation amount of time Sarah spent on these three activities is determined by how much time she spent reading.

What is equation?

An equation in mathematics is a statement that states the equality of two expressions. An equation is made up of two sides that are separated by an algebraic equation (=). For example, the argument "[tex]2x + 3 = 9[/tex]" asserts that the statement "[tex]2x + 3[/tex]" equals the value "9". The goal of equation solving is to determine the value or values of the variable(s) that will allow the equation to be true. Equations can be simple or complex, regular or nonlinear, and include one or more factors. In the equation "[tex]x^2 + 2x - 3 = 0[/tex]," for example, the variable x is raised to the second power. Lines are used in many different areas of mathematics, such as algebra, calculus, and geometry.

Let's call Sarah's reading time "r" in minutes.

We can deduce from the problem:

Sarah painted for 5 minutes.

Because she spent twice as much time reading as she did painting,[tex]r = 2*5 = 10.[/tex]

She hiked for 35 minutes longer than she read, so [tex]h = r + 35.[/tex]

To calculate Sarah's total time spent on these three activities, simply add the times:

Time spent painting + time spent reading + time spent hiking = total time

Time total =[tex]5 + 10 + (r + 35)[/tex]

Time total = [tex]50 + r[/tex]

So the total amount of time Sarah spent on these three activities is determined by how much time she spent reading.

To know more about equation visit:

brainly.com/question/649785

#SPJ1

Let y be the value​ (in thousands of​ dollars) of a car when it is x years old. Some pairs of values of x and y are listed in the table. Find an equation that describes the relationship between x and y.

Answers

Answer:

X × Y

Step-by-step explanation:

Because you need do the multiplication between the time and the money

Add. Write your answer in the simplest form. 2 5/8 + 3 2/5​

Answers

Answer:

6 1/40

Step-by-step explanation:

21/8 + 17/5

105/40 + 136/40 = 241/40

241/40= 6 1/40

I need help with this please don’t skip

Answers

Therefore, each drink would have approximately 18.67 grams of sugar if the amount of sugar was redistributed evenly.

What is distribution?

In statistics, distribution refers to the pattern of values that a variable can take and how frequently those values occur. It is a mathematical function that describes the probability of occurrence of each possible outcome in a set of events.

There are various types of distributions such as normal distribution, binomial distribution, Poisson distribution, and exponential distribution. Each distribution has a specific shape and characteristics, which can be described by its mean, variance, skewness, and kurtosis.

by the question.

Let's say the amounts of sugar in the six drinks are:

Drink 1: 10 grams

Drink 2: 20 grams

Drink 3: 15 grams

Drink 4: 25 grams

Drink 5: 30 grams

Drink 6: 12 grams

To redistribute the sugar evenly, you would need to add up the total amount of sugar and divide it by the number of drinks. In this case:

Total amount of sugar = 10 + 20 + 15 + 25 + 30 + 12 = 112 grams

Number of drinks = 6

Redistributed amount of sugar = Total amount of sugar / Number of drinks

Redistributed amount of sugar = 112 / 6

To learn more about divide:

https://brainly.com/question/15381501

#SPJ1

Exercise 5.2.7 In each case show that the statement is true or give an example showing that it is false. a. If {x, y} is independent, then {x, y, x+y} is in dependent. b. If {x, y, z} is independent, then {y, z} is indepen- dent. c. If {y, z} is dependent, then {x, y, zj is dependent for any x d. If all of xi, X2, ..., Xx are nonzero, then {xi, x2, ..., x*} is independent e. If one of xi. X1, X2, , Xk İs zero, then {xi, X2, ..., xk^ is dependent.

Answers

The statement which is correct is: If {α, β} is independent, then {w₁, w₂, w₁+ w₂} is in dependent.

In vector space theory, a set of vectors is said to be linearly independent if there is no non-trivial linear combination of vectors equal to vector zero. If such a linear combination exists, the vectors are said to be linearly dependent. These concepts are central to dimension definitions.

The definition of linear dependence and the ability to determine whether a subset of vectors in a vector space are linearly dependent is essential to determining the dimensionality of a vector space.

According to the Question, we know that:

{w₁, w₂, w₃} are linearly independent.

Let, α₁, α₂, α₃ such that

α₁w₁ + α₂w₂+ α₃w₃ = 0

and, α₁ = α₂ = α₃ = 0

Again considering the following, we can say that:

{w₁, w₁+ w₂, w₁+w₂+w₃} such that:

β₁(w₁) + β₂(w₁+ w₂) + β₃(w₁+ w₂+ w₃) = 0

Here, the dependent variable is {α,β} and { w₁+ w₂+ w₃}

To learn more about dependent variable, click here:

brainly.com/question/30094324

#SPJ4

help me

Simplify this expression:

Answers

Answer:

[tex]\frac{x^{7} }{y^{10} }[/tex]

If your answer is correct I will give brainliest

Answers

I think it is A... if the original is Red. It is reflected across the x-axis.

I hope this helps !

A company sells widgets. The amount of profit, y, made by the company, is related to the selling price of each widget, x, by the given equation. Using this equation, find out what price the widgets should be sold for, to the nearest cent, for the company to make the maximum profit.

=

3

2
+
239


2268
y=−3x
2
+239x−2268

Answers

The maximum profit is $2492.08.

What is the selling price?

The cost a consumer pays to purchase a good or a commodity is known as the selling price. It is a price that is higher than the cost price and includes a profit margin. The cost of an item when acquired is referred to as its selling price (S.P.).

Here, we have

Given: A company sells widgets. The amount of profit, y, made by the company, is related to the selling price of each widget, x, by the given equation.

y = -3x² + 239x - 2268

At a maximum profit, dy/dx = 0, hence:

dy/dx = -6x + 239

0 = -6x + 239

x = 239/6

x = 39.8

The maximum profit is gotten when the selling price of each widget is 39.8. Hence:

y = -3(39.8)² + 239(39.8) - 2268

y = 2492.08

Hence,  the maximum profit is $2492.08.

To learn more about the selling price from the given link

https://brainly.com/question/1445853

#SPJ1

An uncapped fibre contract originally cost R990 per month. It has now fallen in price to R765 per month. What is the percentage decrease in the monthly price of the contract?

Answers

Answer:

To find the percentage decrease, we need to find the difference between the original price and the new price, divide that difference by the original price, and then multiply by 100 to express the result as a percentage.

The difference between the original price and the new price is:

990 - 765 = 225

Dividing the difference by the original price gives:

225 ÷ 990 ≈ 0.227

Multiplying by 100 gives:

0.227 x 100 ≈ 22.7

Therefore, the percentage decrease in the monthly price of the contract is approximately 22.7%.

Step-by-step explanation:

Need the area of the parallelogram

Answers

Answer:

28  

Step-by-step explanation:

a = b * h

a = 4 * 7

4 acts as the base

7 acts as the height

there is a right angle to support this.

Pls help step by step (special right triangles)

Answers

Value of base and hypotenuse of triangle are 9√3 and 18 respectively.

Define right triangle

A right triangle is a triangle with one interior angle measuring 90 degrees, known as a right angle. The side opposite to the right angle is called the hypotenuse, and the other two sides are known as the legs of the right triangle. The length of the hypotenuse can be found using the Pythagorean theorem,  that the square of the length of the hypotenuse is equal to the sum of the squares of the lengths of the legs.

Height of triangle=9

Base of triangle=y

Hypotenuse of triangle=x

Using trigonometric ratio

Sin30°=Height/Hypotenuse

½=9/x

x=18

Cos30°=Base/hypotenuse

√3/2=y/18

y=9√3

Hence, value of base and hypotenuse of triangle are 9√3 and 18 respectively.

To know more about angles, visit:

https://brainly.com/question/28451077

#SPJ1

A study of adult Americans conducted by the polling organization Ipsos asked each person in a sample whether he or she self-identified as an entrepreneur. The responses to the question were used to learn about the population of adult Americans who self identify as an entrepreneur.
(a) What is the question type? (i) Estimation (ii) Hypothesis Testing
(b) What is the study type? (i) Experimental data (ii) Sample data 1
(c) Type (Part 1): Is the data categorical or numerical? (i) Categorical (ii) Numerical
(d) Type (Part 2): How many variables? (i) one (ii) two (iii) more than two
(e) How many samples or treatments are there? (i) one (ii) two (iii) more than two
(f) M: What is the appropriate method for analysis of data? (Use Table 7.1 of Section 7.2 and your answer to the previous questions to complete.) (i) One-sample z confidence interval for a proportion (ii) One-sample z test for a proportion (iii) Two-sample z confidence interval for a difference in proportions (iv) Two-sample z test for a difference in proportions (v) One-sample t confidence interval for a mean (vi) One-sample t test for a mean (vii) Two-sample t or Paired t confidence interval for a difference in means (viii) Two-sample t or Paired t test for a difference in means (ix) ANOVA F Test (x) Multiple Comparisons

Answers

Hypothesis Testing ,Sample data  , Categorical  ,one variable ,one sample and sample z test for a proportion are the  responses to the question were used to learn about the population of adult Americans who self identify as an entrepreneur.

(a) The question type in this study is categorical, as the respondents were asked to self-identify as either an entrepreneur or not.

(b) The study type is sample data, as a sample of adult Americans was surveyed to learn about the population of adults who self-identify as entrepreneurs.

(c) The data is categorical, as the respondents were asked to self-identify as either an entrepreneur or not.

(d) There is one variable in this study, as the responses to the question about self-identification as an entrepreneur are the only data collected.

(e) There is one sample in this study, as only one group of adult Americans was surveyed.

(f) The appropriate method for analyzing the data in this study is the one-sample z test for a proportion. This method is used when we have one categorical variable and want to test whether the proportion of a certain response differs significantly from a hypothesized proportion. In this case, the hypothesized proportion would be the proportion of adult Americans who self-identify as entrepreneurs. We would use the z-test to determine if the proportion of respondents who self-identify as entrepreneurs is significantly different from the hypothesized proportion. If the difference is significant, we can conclude that there is a difference between the sample and population proportions, and if the difference is not significant, we cannot reject the null hypothesis that the sample proportion is the same as the population proportion.

Overall, this study is using categorical data to learn about the proportion of adult Americans who self-identify as entrepreneurs. The appropriate method for analyzing this type of data is the one-sample z test for a proportion, which allows us to test whether the sample proportion is significantly different from the hypothesized population proportion.

To know more about  null hypothesis click here:

brainly.com/question/28920252

#SPJ4

HELPPP

A ladder is placed against a building forming an angle of elevation of 52. If it reaches the building 12 feet above the ground, how far is the foot of the ladder from the building?

Answers

We can use trigonometry to solve this problem. Let x be the distance from the foot of the ladder to the building, and let y be the length of the ladder. Then, we have:

tan(52) = y/x (since tangent = opposite/adjacent, and y is opposite to the angle of elevation and x is adjacent)

We also know that the ladder reaches 12 feet above the ground, so we have:

y = 12 + x (since y is the hypotenuse of the right triangle formed by the ladder, the ground, and the building)

We can substitute the second equation into the first to get:

tan(52) = (12 + x)/x

Simplifying this equation, we get:

tan(52)x = 12 + x

Using a calculator to find the tangent of 52, we get:

1.2799x = 12 + x

Solving for x, we get:

0.2799x = 12

x = 42.87 feet (rounded to two decimal places)

Therefore, the foot of the ladder is approximately 42.87 feet away from the building.

John deposits $5025 into a savings account that has an interest rate of 9.5%. The account is compounded monthly for the next 18 years, how much will be in the account? (round your answer to the nearest tenth)
Group of answer choices

a. 30521.52
b. 25602.07
c. 27596.60
d. 29854.20

Answers

John deposits $5025 into a savings account that has an interest rate of 9.5%. The account is compounded monthly for the next 18 years. So in the account the amount will be $27596.60. Option c is correct.

What is compound interest?

Cοmpοund interest, alsο knοwn as interest οn principle and interest, is the practise οf adding interest tο the initial amοunt οf a lοan οr depοsit. It οccurs when interest is reinvested, οr added tο the bοrrοwed capital rather than paid οut, οr when the bοrrοwer is required tο pay it, sο that interest is made the fοllοwing periοd οn the initial amοunt + any accumulated interest. In business and ecοnοmy, cοmpοund interest is cοmmοn.

We can use the Cοmpοund interest below-

[tex]\rm A = P(1 + \frac{r}{n})^{nt}[/tex]

where,

A = final amount

P = initial principal balance

r = interest rate

n = number of times interest applied per time period

t = number of time periods elapsed

Given,

Time periods (t)= 18years

n = 12 months

Interest in a year (r)= 9.5% or 0.095

Principial amount (P)= $5025

Lets solve for final amount :

[tex]\rm A = 5025(1 + \frac{0.095}{12})^{12 \times 18}[/tex]

A ≈ 27596.59

That is nearby $27596.60.

In the account the amount will be $27596.60. Thus, option c is correct.

To learn more about compound interest from the given link

https://brainly.com/question/28020457

#SPJ1

Answer: it is  c. 27596.60

How much do we need to invest each month at a rate of 8% compounded monthly so that we have a total of $600,000 saved in 25 years?
Please help will mark brainliest

Answers

Answer:$163.68

Step-by-step explanation:

We can use the formula for compound interest to solve this problem:

A = P(1 + r/n)^(nt)

where:

A = final amount ($600,000)

P = initial amount (unknown)

r = interest rate (8%)

n = number of times interest is compounded per year (12 for monthly)

t = time in years (25)

Substituting in the values, we get:

$600,000 = P(1 + 0.08/12)^(12*25)

Simplifying:

$600,000 = P(1.00666666666667)^300

Dividing both sides by (1.00666666666667)^300:

P = $600,000 / (1.00666666666667)^300

Using a calculator, we get:

P = $163.68

Therefore, we would need to invest $163.68 each month at a rate of 8% compounded monthly to have a total of $600,000 saved in 25 years.

When ​60% of a number is added to the​ number 160, the result is .

Answers

Any percentage can be written as that number divided by 100. As a decimal, you find that quotient. You can quickly divide any number by 10 by moving the decimal place to the left for every 0 in that multiple of 10. 100 has 2 zeros, so all you need to do to divide by 100 is to move the decimal place 2 places to the left. Therefore, 60% is .6 as a decimal.

Let's say the number we want to find is x. In word problems, "of" indicates multiplication, so 60% of our number would be 6x.

We then add our number to that, giving us .6x + x

We know the result is 160, so

.6x + x = 160

Since any number multiplied by 1 is itself, that x can be written as 1x.

.6x + 1x = 160

Now, we combine our like terms; we add the numbers in front of the x's (aka coefficients).

(.6 + 1)x = 160

1.6x = 160

We want x by itself. 1.6 is multiplied by our number, so to undo multiplication, we do division. This leaves us with

x = 160/1.6

x=100

Un constructor debe decidir entre rentar o comprar una máquina excavadora. Si fuese a rentar la máquina, el costo de la renta sería de $3,000 mensuales (sobre la base de un año) y el costo diario (gas, aceite y operador) sería de $180 por cada día que la máquina se utilice. Si él fuese a comprarla, sus costos fijos anuales serían de $20,000 y los costos diarios de operación y mantenimiento serían de $230 por cada día que la máquina se utilizara. ¿Cuántos días al año por lo menos, tendría que utilizar el constructor la máquina para justificar la renta en lugar de la compra?

Answers

Answer:

Para decidir si es mejor rentar o comprar la máquina excavadora, se debe calcular el costo anual de cada opción y compararlos.

Costo anual de renta = Costo de renta mensual x 12 meses + (Costo diario x Días de uso)

Costo anual de renta = 3000 x 12 + (180 x Días de uso)

Costo anual de renta = 36000 + 180D

Costo anual de compra = Costo fijo anual + (Costo diario x Días de uso)

Costo anual de compra = 20000 + (230 x Días de uso)

Para encontrar el número mínimo de días de uso que justificarían la renta en lugar de la compra, se debe igualar ambos costos anuales:

36000 + 180D = 20000 + 230D

50D = 16000

D = 320

Por lo tanto, el constructor tendría que utilizar la máquina excavadora al menos 320 días al año para justificar la renta en lugar de la compra.

8) Use a proportion to solve this problem: Two towns are 460 km apart. If the scale on the map is 3 cm to 45 km, how far apart are the towns on the map?

Answers

The distance between the two towns on the map was found to be 30.67 centimeters by setting up and solving a proportion between the distances on the map and the actual distances.

The problem provides us with a scale on the map of 3 cm to 45 km, which means that every 3 centimeters on the map represents 45 kilometers in the actual world. Let x be the distance between the two towns on the map in centimeters. Using the proportion, we can set up the relationship between the distances on the map and the actual distances as follows:

3 cm / 45 km = x cm / 460 km

Here, we set up a ratio between the distance on the map and the actual distance, where the distance on the map is x centimeters and the actual distance between the towns is 460 kilometers. We can then cross-multiply to solve for x:

45 km * x cm = 3 cm * 460 km

This gives us:

45x = 1380

x = 1380 / 45

x = 30.67 cm

Therefore, the distance between the two towns on the map is 30.67 centimeters.

To learn more about distance please click on below link        

https://brainly.com/question/15256256

#SPJ1

Other Questions
if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units. Write an essay of 400-450 words (2-2 pages) on ONE of the following topics. Write downthe NUMBER and TITLE/HEADING of your essay.The goals left behind tony is diagnosed with acid reflux. this is a condition in which stomach secretions which contain hydrochloric acid or hcl, regurgitate (reflux) out of the stomach and into the esophagus. stomach secretions are very acidic with a ph around 2.0. the acids damage the esophagus and it is felt as heartburn. this painful condition can be treated with over-the-counter (otc) antacids. what do you think these antacids are? why are some organizations more efficient and effective at what they do than others? A plan of a school compound is drawn to a scale of 1cm represent 5m. 1 find its length and breadth of the drawing. If the football field is 50m by 30m. 2 if the scale drawing of the hall is 7cm by 32cm rectangle, find its length and breadth The breakdown of lipids and the breakdown o carbohydrates are similar because they both blank energy Find the measure of XY.Y74NX