Fill in the blank with the Spanish word that best completes the following sentence.

To see what time it is, you can look at ______.



una prueba
una silla
un escritorio
un reloj

Answers

Answer 1
The answer is un reloj
Answer 2
Un reloj, D it’s the answer

Related Questions

Decide if the following sentence is True or False.

"El maestro" quiere decir "the teacher" en inglés.



True
False

Answers

answer: true

step-by-step explanation:
maestro means teacher in spanish
It’s true, and I know that because I know Spanish

A. Write the names of the places from your vocabulary that you associate with the following things or actions.

B. Now, unscramble the circled letters to find a related word

Answers

Answer: A.) El hotel, muchas personas

B.) cerci · ceric · cider · cried · dicer

Explanation: La historia, el arte, estatua

opinión personal sobre el poema impresiones de Salomé Ureña

Answers

Answer:

share your opinion about the poem that you should read but put it in Spanish.

Read the paragraph below and then answer the questions about it.

María es una buena estudiante. Siempre estudia mucho. Cada día escolar ella se levanta a las siete de la mañana. Ella se prepara para la escuela. Siempre come un desayuno sano antes de ir a la escuela. Normalmente ella come un cuenco de cereales con leche. Todos los jueves su madre le prepara unos huevos con pan tostado. María no bebe café nunca. Ella prefiere beber un vaso de jugo. Le gusta el jugo de naranja. Pero no le gusta el jugo de uvas.

1. ¿Quién es una buena estudiante?
2. ¿Qué comes antes para el desayuno?
3. ¿Qué bebe normalmente?
4. ¿Qué jugo no le gusta Maria? Read the paragraph below and then answer the questions about it.

Answers

Answer:

Explanation:

¿Quién es una buena estudiante? Maria es una buena estudiante. ¿Qué comes antes para el desayuno? Cereales con leche. ¿Qué bebe normalmente? Bebe jugo de naranja.¿Qué jugo no le gusta Maria? El jugo de uvas.
Answer :

¿Quién es una buena estudiante?

Maria es una buena estudiante.

¿Qué comes antes para el desayuno?

Cereales con leche.

¿Qué bebe normalmente?

Bebe jugo de naranja.

¿Qué jugo no le gusta Maria?

El jugo de uvas.

Translation:

¿Who is a good student?

Maria is a good student.

¿What do you eat before for breakfast?

Cereal with milk.

¿What do you normally drink?

Drink orange juice.

¿What juice does Maria not like?

The grape juice.

Someone anyone help me with my Spanish 1 homework

Answers

Answer:

Explanation:

El número de teléfono es: 922133435La dirección de correo electrónico es: info(arroba)hotelsanroque.comLa dirección de internet es: www.hotelsanroque.comEl número de fax es: 9221334064

Answer:

1. 922 13 34-35

2.  Where it says Info

3.  Where it says http

4. 922 13 34 06

traducir en inglés por favor!!

Answers

   Answer:

  (It is below)

(Esta debajo)

Explanation:

Soy alèrgico a las nueces - I am allergic to the nutsVomitè - I threw upFui al hospital - I went to the hospitalEl doctor me ayudò - The doctor helped meTomè medicina - I took medicine

For the last question, it is (C) because Peter went to the hospital because he ate the wrong food. The question said that he is allergic to nuts, and he probably ate one, and got sick, and had to go to the hospital. Hope this helps!

Para la última pregunta, es (C) porque Pedro fue al hospital porque se comió la comida equivocada. La pregunta dice que tiene alergia a los nueces, y probablemente se comió uno, y se enfermó, y necesitaba ir al hospital. ¡Espero que esto ayude!

Answer:

 (It is below)

(Esta debajo)

Explanation:

Soy alèrgico a las nueces - I am allergic to the nuts

Vomitè - I threw up

Fui al hospital - I went to the hospital

El doctor me ayudò - The doctor helped me

Tomè medicina - I took medicine

For the last question, it is (C) because Peter went to the hospital because he ate the wrong food. The question said that he is allergic to nuts, and he probably ate one, and got sick, and had to go to the hospital. Hope this helps!

Para la última pregunta, es (C) porque Pedro fue al hospital porque se comió la comida equivocada. La pregunta dice que tiene alergia a los nueces, y probablemente se comió uno, y se enfermó, y necesitaba ir al hospital. ¡Espero que esto ayude!

DEBERES

Completa las oraciones con lo / la / los / las.

- ¿Es este tu libro de español? No, no _________________ es.

- ¿Haz visto a Emine y a Alex? No, no ______________ he visto.

- ¿Busra compró los tiquetes? Sí, sí ____________ compro.

- Vi a Luisa en el parque → ____________ vi en el parque.

- Luisa compró pan, queso y leche en el mercado. → ______________compró antes de ir a la peluquería.

- Compré la medicina y se _____________ di sin que nadie me viera.

- ¿Has recogido a las niñas? Sí, _____________ recogí antes de ir al taller.

Answers

1.lo
2.los
3.los
4. La
5. Los
6.la
7.las
Hope this will help

Answer:

Explanation:

- ¡Es este tu libro de español?

- No, no lo es.

-¿Has visto a Emine y a Alex?

-No, no los he visto.

- ¿Busra compró los tiquets?

- Si, si los compró.

- Vi a Luisa en el parque.

- La vi en el parque.

- Luisa compró pan. queso y leche en el mercado.

- Los compró antes de ir a la peluquería.

- Compré la medicina y se la di sin que nadie me viera.

- ¿Has recogido a las niñas?

- Si, las recogí antes de ir al taller.

I need some help on this

Answers

1) Oyeron
2) leyeron
3) leyó
Escucharon
Leyeron
Leerán

Choose the correct translation of the following expression.
Vamos a tomar una copa.
A. We'll see.
B. See you.
C. Let's go have a drink.
D. Let's meet.​

Answers

C
Lets go have a drink.

Answer:

C. Let's go have a drink

Explanation:

Maribel esta. De vacaciones.forma oraciones en preterite con los siguientes palabras para decir lo que hicieron las personas(write the sentences with the following words)

Answers

Answer:

Explanation:

1. La turista dió una caminata.

2. Francisco y Ángela fueron de compras.

3. Mis amigas y yo vimos las atracciones.

4. Tú le diste el recuerdo a tu tía.

Can somebody skilled with Spanish give me some backup with this work? If you could that'd be much appreciated!

Answers

Explanation:

1. seriamente

2. frecuentemente

3. rápidamente

4. lentamente

Answer:

Explanation:

seriamente

frecuentemente

rápidamente

lentamente

Which word correctly completes this sentence? mi hermano tiene 2 años, todavía es ___________ para participar en la procesión.
a. pequeñita
b. grandecito
c. pequeñito
d. grandecita

Answers

Answer:

C because he is a male and pequenito mean little

Answer in bold and underlined.

Answer: Mi hermano tiene 2 años, todavía es pequeñito para participar en la procesión. ALTERNATIVA C.

Translation: My brother is 2 years old, he is still too young to participate in the procession. ALTERNATIVE C.

To learn at: https://brainly.com/question/11830163To learn at: https://brainly.com/question/3637852

PLEASEEEEEE HELPPPPPP ASAPPPPP

Answers

Tú escuchas

Mi familia come

La mamá busca

Las profesoras escriben

B
B
C
C…………………………zzzzzzz

Match each adjective with its opposite
Brainliest

Answers

Answer
1-A. 2-C. 3-B

I need some help on this. The conversation with the preterite forms of the verbs in parentheses

Answers

Answer:

4. oímos

5. creímos

6. oí

PLEASE HELPPP SPANISHHH

Answers

Answer:

4th option salada hope this helps

The answer for 17 is “Vayan”

translate: i am lucky


A. tengo suerte

B. Soy suerte

C. Soy razon

D. Tengo miedo

Answers

Answer:

Explanation:

Tengo suerte

what type of political system does bolivia have

Answers

Answer:

Presidential Representative Democratic Republic

1. Los abuelos se casaron hace 50 años.
2. La iglesia del pueblo no era antigua.
3. La abuela caminó con su familia alrededor de su casa.
4. La abuela estaba contenta y el abuelo estaba nervioso.
5. En ese tiempo, era la costumbre caminar en una procesión.
6. La abuela compró su vestido de boda.
Please help

Answers

English please ? So I can solve it
What i suppose to do translate then in English?

is this correct?? THANKMSMSKKSKSKSMMSLSKKD

Answers

Answer:it is indeed

Explanation:

You are correct!!
I talk Spanish

Qué fue lo más que te llamó la atención del discurso de Malala

Answers

Answer:

El mensaje central de Malala es que no importa cuáles sean los obstáculos, ya sean económicos, culturales o sociales, todos tienen derecho a una educación de calidad como derecho humano. En palabras de la joven activista: “La educación es educación

Explanation:

pls help will give branliest​

Answers

Answer:

En el Lago Titicaca en Perú voy a pescar, surfear, y pasear en barco. También vamos a nadar en el lago Titicaca.

2 ¿Adónde van? Write sentences with the verb ir using the information provided.
-usted / el partido de fútbol
-Usted va al partido de fútbol.

7) yo / la biblioteca

8) nosotros / la piscina

9) mis primas / el gimnasio

10) tú / de excursión

11) ustedes / el parque municipal

12)
Alejandro el museo de ciencias

Answers

Answer:

Yo voy a la biblioteca.

Nosotros vamos a la piscina.

Mis primas van al gimnasio.

Tú vas de excursión.

Ustedes van al parque municipal.

Alejandro va al museo de ciencias.

Para escribir oraciones con el verbo ir correctamente, es fundamental prestar atención a la concordancia verbal. Así:

Yo voy a la biblioteca.Nosotros vamos a la piscina.Mis primas van al gimnasio.Tú vás de excursión.Ustedes van al parque municipal.Alexandro va al museo de ciencias.¿Qué es la concordancia verbal?

Es una regla gramatical para que exista cohesión textual a través de la concordancia del verbo con el sujeto. El verbo debe declinar para concordar con el sujeto en número y persona.

Entonces las alternativas correctas son:

7) Voy

8) Vamos

9) Van

10) Vas

11) Van

12) Va

Encuentre más sobre concordancia verbal aquí:

https://brainly.com/question/861040

Please help me with Spanish

Answers

Part B: (not totally sure about this part but)
1. Profesores nativos
2. Cursos intensivos
3. A diarios y/o sábados
4. descuentos a grupos

Part C: (you just list the languages given)
- alemán
- francés
- holandés
- japonés
- chino
- español

Hope this helped :)

What does the underlined phrase mean below?

Me di cuenta de la verdad.
I appreciate
I realized
I told
I argued

Answers

Answer:I realized the truth

Explanation:

Answer:

I realized

Explanation:

Have an awesome day! :)

Give the correct conjugation of the irregular verb (tù) ir
( help please)

Answers

it is "You Go"

Explanation:

Tu vas

Hope this will help

Which is not true about the imperfect tense

A. It shows a completed action in the past
B.It sets up a scene in the past
C.It describes a uninterrupted action in the past
D. It tells about Habitual actions in the past

Answers

Answer:

A. It shows a completed action in the past

Explanation:

The preterite tense shows a completed action in the past.

Translate the words in brackets to Spanish:

Answers

Answer:

queston 3. se nos

Explanation:

Question4 se las

Answer:

Te nos

Se las

Explanation:

Given the subject, conjugate the infinitive to the correct present progressive form. Don't forget to include "estar." ¿(Trabajar - Ud.) en el jardín?

Answers

Answer:

¿Está trabajando en el jardín?

Explanation:

In this exercise, you have to complete the sentence using the present progressive tense. The Spanish present progressive tense is also called present continuous tense and it is used to talk about something that is happening now.

In the sentence given, you have to write "está" and not "estás" because "Ud." means "usted" and is the formal "tú". "Está trabajando" is the second person formal singular present progressive form of the infinitive verb "trabajar".

_____ corres en el parque. (review subject pronouns and verb
conjugations)*

Usted

Yo

Ella


Answers

Answer:

Tú.

Explanation:

Usted: Usted corre en el parque.

Yo: Yo corro en el parque.

Ella: Ella corre en el parque.

Tú: Tú corres en el parque.

Other Questions
Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names. (a+b+c)(a-b+c)=a2+b2+c2 prove