Fill in the blank. In the triangle below, y=__________. Round your answer to two
decimal places.
ZD
y
Answer here
42°
35

Fill In The Blank. In The Triangle Below, Y=__________. Round Your Answer To Twodecimal Places.ZDyAnswer

Answers

Answer 1
42 degrees is the right answer

Related Questions

Mary is going for a walk. She takes 3 hours to walk 9.6 miles. What is her speed?

Answers

Answer:

3.2 mph

Step-by-step explanation:

If it takes her 3 hours to walk 9.6 miles, we need to divide 9.6 by 3.

To do so, we can remove the decimal point in 9.6, to give us 96.

Then, we can divide 96 by 3 to get 32.

Add the decimal back to 32.

Doing so would give us 3.2, and our answer.

We can check this answer by multiplying 3.2 by 3, which gives us 9.6, telling us our answer is correct.

Marcy will earn 3 rewards points for each movie she attends. Which equation represents the relationship between y, the total points and x the number of movies?

Answers

Answer:

y=3x

Step-by-step explanation:

Data collected from selected major metropolitan areas in the eastern United States show that 2% of individuals living within the city limits move to the suburbs during a one-year period, while 1% of individuals living in the suburbs move to the city during a one-year period. Assuming that this process is modeled by a Markov process with two states: city and suburbs.
a. Prepare the matrix of transition probabilities.
b. Compute the steady-state probabilities.
c. In a particular metropolitan area, 40% of the population lives in the city, and 60% of the population lives in the suburbs. What population changes do your steady-state probabilities project for this metropolitan area?

Answers

Answer:

a)  City Suburbs city 0.98 0.02 ,  Suburbs  0.01 0.99

b)  0.333 ,  0.667

c )  Using the steady-state probabilities, There will be an increase in the Suburb population and a decrease in City population

Step-by-step explanation:

2% living within the city limits move to suburbs

1% living within the suburbs move to the city

a) Matrix of transition probabilities  

City Suburbs city 0.98 0.02 ,  Suburbs  0.01 0.99

b) Steady -state probabilities

attached below

steady state probabilities = 0.333 ,  0.667

c) Determine the population changes the steady-state probabilities

Using the steady-state probabilities, There will be an increase in the Suburb population and a decrease in City population i.e. a decrease from 40% to 33%

The box plots below compare the number of points two basketball players scored per game over 25 games last season. WHich statement is supported by the information in the box plots above?
it's down there

Answers

Answer:

im not helping you cuz ur pfp

Step-by-step explanation:

Is the enlargement shown below a dilation…. Please I need help ASAP

Answers

I honestly don’t remember what a dilation is, but I can tell you that those triangles are not similar. 3:18 and 8:24 do not share the same ratio. 3 fits into 18 *6* times and 8 only fits into 24 *3*times.

Ms. Lopez goal is to run 25 miles this week.
She runs 3 miles on Tuesday and 4 miles on Wednesday.
What percent of her goal has she accomplished?

Answers

Answer: 28%

Step-by-step explanation: First, we need to find how much she runs in total on Tuesday and Wednesday. So, we add 3 + 4 to get 7. With that, we need to determine how much 7 is from 25. So, it'd look like this:

7 * 100 / 25

700 / 25

=28

Therefore, she's done 28% of her goal (within the 2 days) I hope this helped!

Answer:

I think the other person who answered the question is right

Step-by-step explanation:

-244 is it

rational number
natural number
real number
irrational number
integer

Answers

-244 is an integer, rational and real number

Which point keeps the set of ordered pairs a function {(1,-2).(-2,4), (5,0)}
O (5,2)
O (2,1)
O(-2.3)
O (1,6)​

Answers

B (2,1) is the answer

Write an expression for each of these expressions:
A. Divide 36 by a
B. Subtract b from 55.
C. Add 18 to c.
D. Multiply 49 by d.
E. Divide e by 62
F. Subtract 71 from f.
es

Answers

Answer:

A. 36  ÷ a

B. 55 - b

C. 18 + c

D. 49 · d

E. e ÷ 62

F. f - 71

AMERICA EATS 350 PIZZA SLICES EVERY SECOND HOW MANY DO THEY EAT IN HALF IN HOUR

Answers

630,000

Step-by-step explanation:

350x60=21,000

21,000x30=630,000

The value of a sculpture is $950. The value increases by 15% a year. Find the value in 8 years.

Answers

Answer:

1,140

Step-by-step explanation:

because first you have to cross multiply the 15*950 and then divide it by 100 and you get 1,140

please make me brainist lol

Plz help me well mark brainliest if correct...??

Answers

Answer:

I'm pretty sure the answer is A

Answer:

Answer is A

Step-by-step explanation:

B- The area is LxW meaning it is 3x9= 27 sq cm

C- Area LxW meaning 4x8= 32.

A- I only see 6 but this would mean that the width is 7. 7x6= 42 sq cm.

There you go: Formula is : LxW or multiplying the two numbers.< Hope it helps!

(Linear Relationships LC)

Which of the following tables represents a linear relationship that is also proportional?


x y
0 3
3 6
6 9

x y
0 4
2 6
4 8

x y
0 0
6 3
12 6

x y
0 3
5 5
10 7
PLEASE I NEED HELP ASAP

Answers

All the table show the linear relationship, but none of the table show the proportional relationship.

What is proportional relationship?

A proportional relationship is a relationship between two expressions and where changes in one expression means some constant change in the other expression as well. Generally, it is represented as x/y = k, where x and y are two expressions and k is constant.

Given:

A). x → y

0 → 3

3 → 6

6 → 9

To show the linear relationship:

We have to find the constant first difference.

That means,

6-3 = 3

And 9 - 6 = 3

The values of this table show the linear relationship.

To show the proportional relationship:

Let x/y = k (k is constant)

We have to find the k:

0/3 = 0,

3/6 = 1/2,

6/9 = 2/3.

The values of this table do not show the proportional relationship.

B). x → y

0 → 4

2 → 6

4 → 8

To show the linear relationship:

We have to find the constant first difference.

That means,

6-4 = 2

And 8 - 6 = 2

The values of this table show the linear relationship.

To show the proportional relationship:

Let x/y = k (k is constant)

We have to find the k:

0/4 = 4,

2/6 = 1/3,

4/8 = 1/2.

The values of this table do not show the proportional relationship.

C). x → y

0 → 0

6 → 3

12 → 6

To show the linear relationship:

We have to find the constant first difference.

That means,

3-0 = 3

And 6 - 3 = 3

The values of this table show the linear relationship.

To show the proportional relationship:

Let x/y = k (k is constant)

We have to find the k:

0/0 = undefined,

6/3 = 2,

12/6 = 2.

The values of this table do not show the proportional relationship.

D). x → y

0 → 3

5 → 5

10 → 7

To show the linear relationship:

We have to find the constant first difference.

That means,

5 - 3 = 2

And 7 - 5= 2

The values of this table show the linear relationship.

To show the proportional relationship:

Let x/y = k (k is constant)

We have to find the k:

0/3 = 0,

5/5 = 1,

10/7 = 10/7.

The values of this table do not show the proportional relationship.

Therefore, none of the table show the proportional relationship.

To learn more about the proportional relationship;

brainly.com/question/28777033

#SPJ1

HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

Answers

Answer:

30 and -30 and if that doesn’t work then maybe try -30 first and 30 next

Answer:

the answer would be 30 for positive and -30 for negative

*ANSWER TWO FOR BRAINLIEST*

Question 1 (multiple choice worth 4 points)

(08.05) Which of the following ordered pairs represents the solution to the system given below?

x - 4y = 7
5x + 9 = 6

A) (3, -1)
B) (3, 1)
C) (1, -3)
D) (-1, -3)



Question 2 (multiple choice Worth 4 points)

(08.05) Maria wants to solve the following system using the elimination method:

4x + 9y = 59
x + y = 17

What number should the equation x + y = 17 be multiplied by to eliminate y?

A) 4
B) -4
C) 9
D) -9​

Answers

Answer:

why u delete the answer biro it was being record ...72+ comments

How many triangles can be formed with the angle measures: 20, 100, and 60 degrees?

Answers

There are infinite many triangles that can be formed with the angle measures 20, 100, and 60 degrees

How to determine the number of triangles

From the question, we have the following parameters that can be used in our computation:

Angles = 20, 100, and 60 degrees

The above parameters are angles

When only angles are given, the triangle can have as many side lengths as possible

This means that there are infinite many triangles

Read more about triangles at

https://brainly.com/question/14285697

#SPJ1

F(x)=2 sin (1/2x)+1
What is the midline of the function

Answers

Answer:

Step-by-step explanation:

Its A

Keshawn is organizing textbooks on his bookshelf. He has a Spanish textbook, a biology textbook, a history textbook, and a writing textbook. How many different ways can he line the textbooks up on his bookshelf?

Answers

Answer: four textbooks

Step-by-step explanation:

An average human heart beats 60 times per minute. If an average person lives to the age of 75, how many times does the average heartbeat in a lifetime?
There should be ( ) heartbeats per lifetime.
(Enter your answer as a decimal number. Round to two decimal places.)

Answers

Answer:

The average number of beats in a lifetime would be 2,365,200,000

Step-by-step explanation:

To find the amount we need to take basic steps. The first step is multiplying the number of beats to find out how many are in an hour. Since there are 60 in a minute and 60 minutes in an hour, multiply the two.

60 beats * 60 minutes = 3,600 beats per hour.

Now multiply the amount of beats in an hour by the number of hours in a day.

3,600 * 24 hours = 86,400 beats per day

Now multiply the number of days in a year. Technically there is 365 1/4 in a year, but we'll use the flat rate of 365 since that is generally the accepted answer.

86,400 * 365 days = 31,536,000 beats per year

And now we take that number and multiply by the number of years that he lines

31,536,000 * 75 years = 2,365,200,00 beats in a lifetime

The heart beats 236,520, 000 times in a lifetime.

What is Unitary Method?

The unitary technique involves first determining the value of a single unit, followed by the value of the necessary number of units.

For example, Let's say Ram spends 36 Rs. for a dozen (12) bananas.

12 bananas will set you back 36 Rs. 1 banana costs 36 x 12 = 3 Rupees.

As a result, one banana costs three rupees. Let's say we need to calculate the price of 15 bananas. This may be done as follows: 15 bananas cost 3 rupees each; 15 units cost 45 rupees.

Given:

An average human heart beats 60 times per minute.

Now, the amount of beats in an hour by the number of hours in a day.

= 3,600 x 24 hours

= 86,400 beats per day

Again, the amount of beats per year

= 86,400 x 365 days

= 31,536,000 beats per year

So, the heart beats

= 31,536,000 x 75 years

= 236,520, 000 beats in a lifetime

Learn more about Unitary Method here:

https://brainly.com/question/22056199

#SPJ2

How many whole months will it take for a motorbike valued at £2550 to depreciate to less than £1200 if depreciation is at a rate of 5% per month?

Answers

It will take roughly 15.7 months to drop in value to less than £1200 if the current value of the bike is £2550.

How to find the present value of bike?

You can use the following formula to calculate how many months it will take for a motorbike with a value of £2550 value to drop to under £1200:

n = (1200 - 2550) ln / ln (1 - 0.05)

Where 0.05 denotes the 5% monthly depreciation rate, ln is indeed the natural logarithm function, and n refers to the number of months.

When we enter the values, we will get:

n = (1200 - 2550 - 1 - 0.05) / ln(1 - 0.05) = about 15.7 months

The motorcycle will take approximately 15.7 months to drop in value to less than £1200.

To know more about logarithm function visit:

https://brainly.com/question/30284289?

#SPJ1

The population of a town grows uniformly at the rate of 4% every year. In how many years will the population of the town grow from 15,62,500 to 17,57,600?​

Answers

Therefore , the solution of the given problem of percentage comes out to be time n = 3 years.

What is percentage?

A figure or ratio that is stated as a percentage of 100 is referred to as a percentage in mathematics.  However, the percent symbol ("%) is usually used to denote it." The percent amount is flat. When the numerator is 100, percentages are really just fractions. Put the standard form (%) next to a number to show that it is a percentage. For instance, if you correctly respond to 75 out of questions in total on a test, you receive a 75% (75/100).

Here,

Given: 1757600 more people overall

Population as of now: 1562500

According to the issue,

=> 1562500[tex](1 + 4/100 )^{n}[/tex] = 1757600

=> [tex](26/25)^{n}[/tex] =  1757600/ 1562500

=>  [tex](26/25)^{n}[/tex]=  [tex](26/25)^{3}[/tex]

On comparing,

n=3

Therefore , the solution of the given problem of percentage comes out to be time n = 3 years.

To know more about percentage visit:

brainly.com/question/29306119

#SPJ1

PLEASE HELPPPP select the expression that represents the following statement: Multiply 8 by 1 less than 5. (4 points)

Group of answer choices

(8 x 1) − 5

8 x (5 − 1)

1 − (8 x 5)

8 − (5 x 1)

Answers

It would be (8 x 1) -5

By using PEDMAS rule, (8 x 1) − 5 is the expression represents the given statement.

What is PEDMAS rule?

The order of operations is a rule that tells the correct sequence of steps for evaluating a math expression. We can remember the order using PEDMAS: Parentheses, Exponents, Division and multiplication, Addition and Subtraction.

According to the question

Multiply 8 by 1 less than 5.

Rewriting the mathematical expression using order of operations using PEDMAS rule

= (8 x 1) − 5

(8 x 1) − 5 is the expression represents the given statement.

Find out more information about PEDMAS rule here

https://brainly.com/question/24086845

#SPJ2

Jacinta has 2 blue marbles , 4 red marbles and 5 green marbles in a bag, all the marbles are the same size, she will select one marbles from the marble from the bag without looking what is the possibility that Jacinta will choose the green marble

Answers

Jacinta has 2 blue marbles , 4 red marbles and 5 green marbles in a bag, all the marbles are the same size, she will select one marbles from the marble from the bag without looking what is the possibility that Jacinta will choose the green marble

The possibility that Jacinta will choose the green marble is 45.5%

What is probability?

Probability is a branch of math which deals with finding out the likelihood of the occurrence of an event.

Given that, Jacinta has 2 blue marbles, 4 red marbles and 5 green marbles in a bag, all the marbles are the same size,
We need to find the possibility that Jacinta will choose the green marble,

So, here we will use the concept of probability, probability tell us the chances of happening of an event.

The formula =

Probability = favorable outcomes / total outcomes.

Here, the favorable outcomes = green marble (5)

The total outcomes = total number of marbles = 5+4+2 = 11

So, P(getting the green marble) = 5/11 = 0.454545 = 45.5%

Hence, the possibility that Jacinta will choose the green marble is 45.5%

Learn more about Probability click;

https://brainly.com/question/30034780

#SPJ3

Please answer this question!!!!!

Answers

For y:
Since this is a parallelogram then the values of the angles is 360 degrees
The opposite angles are equal so
360-(74x2) = 212
So y=212/2=106 degrees
Now for z
5z-24 + 74= 180
5z=130
Z= 26 degrees
I gotchu

notice 74. and how its supplementary angle is y, or in other words 106.
the angle (5z - 24) is the same as 106, so u would solve the equation

5z - 24 = 106 (to solve for z.)


z = 26
y= 106

Larry graphs the inequality x less-than negative 5 using the steps below.

Step 1: Draw a number line, and place an open circle at –5.
A number line going from negative 10 to 0. An open circle is at negative 5.

Step 2: Shade to the left of –5 to represent less than –5.
A number line going from negative 10 to 0. An open circle is at negative 5. Everything to the left of the circle is shaded.

Step 3: Check work by substitution.
x = negative 5
Negative 5 less-than negative 5 False

Larry concludes that he must have shaded the number line in the wrong direction. Which best describes the situation?
Larry’s graph is incorrect. He should have used a closed circle at –5.
Larry’s graph is incorrect. He should have shaded to the right of –5 because the numbers less than –5 are to the right of –5.
Larry’s graph is correct. He should have checked his work using a number to the left of –5.
Larry’s graph is correct. He should have checked his work using a number to the right of –5.
Mark this and return Save and Exit Next Submit

Answers

Answer:

D

Step-by-step explanation:

To order tickets online to a hockey game

Answers

Answer:

I'm not quite sure what the question is here but in order to buy tickets to a hockey game, you can type the hockey team or game into the web browser and select their website then select the time and dates you'd like to see the game

Hope this helps!

3 times a number minus 12 is equal to
5 times the number plus 15,
Find the number,

Answers

Answer:

-13.5

Step-by-step explanation:

take number as x

3x-12=5x+15

-2x=27

x=27/-2

x=-13.5

Reciprocal of following expression is *

3/5×(10+35/24)​

Answers

Answer:

8/55

Step-by-step explanation:

The answer to that equation is 55/8, and the reciprocal is that improper fraction flipped.

Can someone solve this please

Answers

Answer:

u=37

Step-by-step explanation:

u+41= u+4 + u (sum of 2 interior angles is equal to exterior angle)

u+41= 2u+4

2u-u= 41-4

u=37

4-56 Determine the magnitude of the moments of the force F about the x. y, and z axes Solve the problem (a) using a Cartesian vector approach and (b) using a scalar approach

Answers

(a) As of the Cartesian vector approach, Moment about axes are [tex]M_x = 13\ Ft-lb[/tex], [tex]M_y = 4\ Ft-lb[/tex] and [tex]M_z = 36\ Ft-lb[/tex].

(b) Using a scalar approach, Moment about axes are [tex]M_x = 13\ Ft-lb[/tex], [tex]M_y = 4\ Ft-lb[/tex] and [tex]M_z = 36\ Ft-lb[/tex].

What is a vector?

Vector is defined as the quantities that have both magnitude and direction is called a vector quantity and the nature of the quantity is called a vector.  

here,
[tex]\vec F = 4 \hat i + 12\hat j -3 \hat k\\ \vec B = 4 \hat i + 3\hat j - 2 \hat k\\[/tex]

Scalar approach,
moment about the x-axis is given by,
[tex]M_x = B_yF_z - ZF_y\\M_x = 3(-3)-(-2)(12)\\M_x = 13\ Ft-lb[/tex]

Similarly,
[tex]M_y = 4\ Ft-lb,[/tex] and [tex]M_z = 36\ Ft-lb[/tex]

Vector approach,
Moment about the x-axis is given by,
[tex]M_x = U_x \times[ {\vec B \times \vec F]}\\M_x = \left[\begin{array}{ccc}1&0&0\\4&3&-2\\4&12&-3\end{array}\right][/tex]

The above expression given is of determinate, when solving the above determinate,
[tex]M_x = 13\ Ft-lb[/tex]

Similarly,
[tex]M_y = 4\ Ft-lb[/tex] and [tex]M_z = 36\ Ft-lb[/tex],

Learn more about vectors here, https://brainly.com/question/13322477
#SPJ1


Other Questions
streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names. (a+b+c)(a-b+c)=a2+b2+c2 prove A nurse is caring for a patient with SIADH. What severe complication should the nurse assess for?a.Strokeb.Diabetes insipidusc.Neurologic damaged.Renal failure