explain the efforts or programs that are being initiated for the conservation of natural resources in Nepal​

Answers

Answer 1

Answer:

following the 4th amendment of National Parks and Wildlife Conservation Act (1993), the Government of Nepal has been providing 30-50% of the annual revenue generated from the protected area to the local communities for the sake of biodiversity conservation, community development, livelihood improvement and conservation ...Natural resources are Earth materials used to support life and meet the needs of people. Any organic material used by humans can be considered as a natural resource. Natural resources include oil, coal, natural gas, metals, stone, and sand. Air, sunlight, soil, and water are other natural resources.


Related Questions

TEST IS TIMED HELP


3. What principle states that you must increase the amount of regular exercise or activity that you normally do to challenge your body?

progressive principle

interval principle

specificity principle

the overload principle​

Answers

ima go with the overload principle I could be wrong do

Answer:

D. Overload principle

Explanation:

"The overload principle is one of the seven big laws of fitness and training. Simply put, it says that you have to increase the intensity, duration, type, or time of a workout progressively in order to see adaptations."

Like many sophomores, Miguel initially struggled with organic chemistry when he tried to learn everything on his own. On the advice of a friend, he joined a study group that met three days a week to work on homework problems and study for exams together. It took a lot of effort, but Miguel never missed a study group, and all the hard work paid off when he got an A- in the class. To reward himself, Miguel went to a concert after the semester was over. This is an example of: _______

Answers

Answer: Determination

Explanation: It took a lot of work and effort for Miguel to meet up and learn the material. Because of how much he tried, his hard work ended up paying off.

Match each hair component with its function.


lubricate hairs and skin

contract to make hairs stand up

provide strength and maintain shape of hair

produce new hair cells


a. arrector pili muscle

b. follicle

c. cuticle

d. sebaceous gland

Answers

To lubricate hair and skin is d
To contract to make hairs stand up is a
To provide strength and maintain shape of hair is is c
To produce new hair cells is b

Which best describes the strategy of "prioritizing your needs" as a way to manage negative emotions related to stress?
O Learning to move past disappointments or frustrations and work with the situation at hand
O Making the time to indulge in the things you enjoy, whether it's a sport, music, movie, or activity
Reaching out to a trusted adult, counselor or health professional if you need help
Thinking of experiences and activities you enjoy and embracing a feeling of gratitude

Answers

Answer:a

Explanation: stress is a part of life and we have to learn to manage it

Learning to move past disappointments or frustrations and work with the situation at hand is best strategy of "prioritizing your needs" as a way to manage negative emotions related to stress. Thus the correct option is A.

What is disappointment?

Disappointment is a complex emotion which stems from sadness. It is what person feel when his/her expectations for the desired outcome are dashed.

With the right mindset, person can grow through disappointments. As long as he commit to getting back up and trying again. No matter what individual think what he deserved, what happened is what he truly deserved.

Communication with friends and family about person disappointment can bring some much-needed clarity.

For more information regarding negative emotions, visit:

https://brainly.com/question/12429762

#SPJ2

a person who burns more calories than he or she consumes will

Answers

Answer:

end up loosing more weight

Explanation:

i dont know if its correct because theres no answer options but yeah, hope it helped

lyme disease can be spread through which mode of transmission?

Answers

Answer: the bite of infected blacklegged ticks.

Explanation: “Lyme disease is caused by the bacterium Borrelia burgdorferi and rarely, Borrelia mayonii. It is transmitted to humans through the bite of infected blacklegged ticks.”

what are some mental health risks associated with a sedentary lifestyle?

Answers

Answer:A sedentary lifestyle has been linked to mental health concerns like depression, anxiety, and chronic stress, so Peterson explains how sitting for more than eight hours a day can, over time, decrease motivation, contribute to fatigue, make it difficult to manage anxiety and stress, etc.

Explanation:

Brainliest pls

Stress and Stress Management
Project: Stress Management

Answers

Answer:

What is the question that you need me to answer?

Explanation:

fitness that improves your ability to learn skills is called

Answers

Answer:

Sports related fitness

The answer is skill.

CAN SOMEONE HELP WITH QUESTION 1 AND 2

Answers

Answer:

vincent should think from his parents shoes they are trying to protect him after slamming the door vincent should calm down and think and apologize to his parents the parents should let him go and set a curfew and tell him to have his cellphone on and respond when he needs to also i think a reliable person should be there and vincent if he really wants to go he should make a agreement he gets in touble there should be reasonable consequenses

in my opinon vincent should go and if he gets in trouble he should bear all consequnces there is a saying you either learn the easy way or the hard way also i am not a parent

if the relationship is worth it they should set schedules and try to manage their time will should try to understand the girl and the girl with the boy

this is just my opinon the activites is important for my future and education i will choose it over the boy education fist then him

which ever is more beneficial  

Explanation:

that's my answer to you and i hope you understan what i'm saying here ok

I’m timed please helppp


What are the major responsibilities of the FDA related to medicine?

Answers

Answer: "The FDA is responsible for protecting the public health by ensuring the safety, efficacy, and security of human and veterinary drugs, biological products, and medical devices; and by ensuring the safety of our nation's food supply, cosmetics, and products that emit radiation"

Explanation: Hope it helps!

What makes you think that a TV commercial is telling the truth?

Answers

Answer:

some tv commercial are not telling the truth, besides promoting a product requires different tactics that either true or not. we as a person should figure it out before buying products.

I think that a TV commercial is telling the truth and some TV commercial are not telling the truth, besides promoting a product requires different tactics that either true or not we as a person should figure it out before buying products. The game karate is also very good for the purpose of the entertainment.

What is karate?

Karate has been practiced as a type of the sport at very high level and karate has the activity in which hands as well as feets were delivered unarmed combat. The origin or the country from where karate has been originated is Japan. Karate has been also known as the martial arts which includes kicking, defensive blocking, as well as striking.

Sports are used to be considered as the very important part of ones life. Sports are very essential for a healthy and happy life as sports are the source of entertainment for the people. Sports are generally of two types indoor as well as  outdoor, the sports that played outside like in open field and ground are are known as outdoor games and the games that are use to be played inside the house are known as indoor games.

Therefore, I think that a TV commercial is telling the truth and some TV commercial are not telling the truth, besides promoting a product requires different tactics that either true or not we as a person should figure it out before buying products. The game karate is also very good for the purpose of the entertainment.

Learn more about karate on:

https://brainly.com/question/13245946

#SPJ2

Explain how sports or media figures might influence a teenager to use or not use tobacco?

Answers

Answer:

Explanation:

A 2018 study in Pediatrics found that teenagers who watched videos about tobacco products online, for example, were more likely to try and use tobacco products more frequently. They were also less likely to stop using the products. Make a family media use plan to help limit the influence of these ads on your children

how to stop a child from grinding their teeth at night?

Answers

Answer: take them out

Explanation:

Decrease your child's stress, especially just before bed.
Try massage and stretching exercises to relax the muscles.
Make sure your child's diet includes plenty of water

plssss answer plssss​

Answers

Answer:

erm, well, the answer to those questions are completely opinional base. So I can’t really help, I'm sorry.

questions:
1. Which vein carries deoxygenated blood from:
a. upper part of the body to the heart?
b. lower part of the body to the heart?
2. Which chamber of the heart first receives deoxygenated blood from
the upper and lower body part?
Which chamber of the heart pumps deoxygenated blood going to
pulmonary artery?

Answers

Answer:

1) Is a the blood travels through the upper half of the body

to the right atrium.

Answer:

1

a) superior vena cava

b) inferior vena cava

c)the right atrium

d)the right ventricle

arrange these elements of the intrinsic conduction system in the order that a depolarizing impulse travels during a normal heartbeat.

Answers

Answer:Electrical link(s) between atria and ventricles

Explanation:

Kim got fired from her job; therefore, it is possible she will go through the stages of grief.
A.
True
B.
False

Answers

Answer:

A. True

Explanation:

If I was Kim and I got fired from my job I would definitely be grief-stricken. It was all I had. Most of my friends are from work and there is no way I will be able to keep affording Mr. Mittens' cat food on l the emergency funds I have saved up for a time I might get laid off. I have lost so much and what did it cost? Everything.... and a bag of chips. I don't have access to break room vending machine anymore so say goodbye to my favorite snacks.

Wow... I actually feel a lot sadder than I thought I would...

Answer:

True

Explanation:

Her serotonin levels would drop. Serotonin is the neurotransmitter that makes you feel happy. If you don´t have enough serotonin you will feel depressed.

In a foodservice operation, the greatest risk to safe food is: Group of answer choices the facility the equipment the people the food

Answers

Answer: The answer is the equipment

Explanation:

The reason why the answer is the equipment is because if the equipment is not clean it is a huge health risk for the consumer because the equipment was not cleaned properly

In a foodservice operation, the greatest risk to safe food is contamination that can happen in the improper handling of the food, storage, and preparation, etc., and that leads to the spreading of bacteria and foodborne illness.

What is the significance of the cross-contamination of the food?

Cross-contamination is significantly harmful when it comes to ready-to-eat foods, raw foods, etc., where poor hygiene of food handlers, improper cooking of food, poor sanitation, etc. destroy the nutrition and quality of the foods. Cross-contamination should thus be avoided to prevent the spread of food-borne illnesses caused by the growth of bacteria, fungi, and other microorganisms.

Hence, in a foodservice operation, the greatest risk to safe food is contamination that can happen in the improper handling of the food, storage, and preparation, etc., and that leads to the spreading of bacteria and foodborne illness.

Learn more about the cross-contamination of the food here.

https://brainly.com/question/29633787

#SPJ2

Joel had knee surgery and his doctor prescribed opiate painkillers for the pain. Which scenario would most likely lead to prescription drug abuse?

Answers

Answer:

Joel takes other painkillers in addition to the prescribed pain killers.

Explanation:

hope this helps

The most common type of chronic disease is
a. Cardiovascular
b. Cancer
c. Arthritis
d. Chronic obstructive pulmonary disorder

Answers

your answer would be A. “cardiovascular”

this is because heart disease is one of the most common types of chronic diseases and is also one of the leading causes of death in the US, with over 600k people dying of cardiovascular related illnesses a year

hope this helps :)

Identify the skull bone

Answers

Answer:

Its the maxila

Explanation:

I dont know what an ethmoid bone is but I know the mandible is the jaw.

Which kind of fitness includes the ability to develop and use fine motor skills?
A.
health-related fitness
B.
skill-related fitness
C.
physiological fitness
D.
cardiorespiratory fitness

Answers

Answer:

B.) Skill-related fitness is the answer to this question. I hope this helped you.

B - Skill-related fitness.

Fermentation is using a refining process to make alcohol stronger? True or False​

Answers

Answer:

false

Explanation:

Fermentation is the process in which alcohol is made.

what is any action that influences others to address a health-related concern or support a health-related belief.

Answers

Answer: Any action that influences others to address a health-related concern or support a health-related belief is Advocate which is taking action to influence others to address a health-related concern or to support health-related belief.

Hepatitis is a bacteria infection that causes inflammation of the liver.

Answers

Answer:

Hepatitis is a condition of the liver where the cells of the liver organ are inflamed. Most often it is caused by a viral infection, hepatitis A, B and C are all viral forms of the disease. Bacteria (and Fungi) can cause hepatitis of the liver, and two examples would be the Staphylococcal and Streptococcal bacteria.

Explanation:

What is the first step of performing CPR on infants after you have checked for consciousness and breathing?

shake, stroke, or tap the baby

Answers

Answer: gently shake the baby

Explanation:

Answer:

give deep, strong compressions

Explanation:

It is difficult to draw clear conclusions from observational studies of diet and health because there are many confounding variables.

a. True
b. False

Answers

Answer:

i think  it is a

Explanation:

it's probably a i think...

why is society so crule?

i'm just curious on your opinion

Answers

Society is so cruel cause people are always judging people before even meet. People always act like there aren’t good people in the world

PLEASE HELP.

Which of the following factors are important in the prevention of food-borne illnesses? (i) Storage of food (ii) Food preparation method (iii ) Waste disposal (iv) Personal hygiene

Answers

Answer:

Food preperation Method

Explanation:

Other Questions
please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56 1. Three fluids are poured from a beaker onto a lab table. Fluid A hits the table in 10 seconds, fluid B in 12 seconds, fluid C in 4 seconds, and fluid Din 15 seconds. Which fluid has the highest viscosity?O a fluid AO b. fluid BO c. fluid cO d. fluid D