Eric bought a truck in 2015 for $43,500. By 2020, the truck was worth $36,500.
Part A. What function type could model the given situation?
Part B. What is the rate of change in the truck's worth per year?
Part C. Which model describes this situation?

Answers

Answer 1

A function type that could model the given situation is a linear function.

The rate of change in the truck's worth per year is -1400.

A model that describes this situation is y = -1400x + 43500

How to calculate the slope of a line?

In Mathematics, the slope of any straight line can be determined by using this mathematical equation;

Slope (m) = (Change in y-axis, Δy)/(Change in x-axis, Δx)

Slope (m) = rise/run

Slope (m) = (y₂ - y₁)/(x₂ - x₁)

Substituting the given data points into the slope formula, we have the following;

Slope (m) = (36,500 - 43,500)/(2020 - 2015)

Slope (m) = -7,000/5

Slope (m) = 1,400.

Read more on linear function here: https://brainly.com/question/30922055

#SPJ1


Related Questions

Simplify: 27 − 3 exponent 3 + 4 x 2 exponent 2 − 6.

Answers

Answer:

10

Step-by-step explanation:

27-[tex]3x^{3}[/tex]+(4 x [tex]2x^{2}[/tex]) - 6

= 27 - 27 + (4 x 4) - 6

= 0 + 16 - 6

= 10

Answer: 10

Step-by-step explanation:

27 - 3^3 + 4 × 2^2 - 6

= 27 - 27 + 4 × 4 - 6 (since 3^3 = 27 and 2^2 = 4)

= 0 + 16 - 6= 10

Therefore, the simplified value of the expression is 10.

Use synthetic division to perform the division.
−8x^3+6x^2−9x+4 / x−2
Question content area bottom
Part 1
−8x^3+6x^2−9x+4 / x−2=enter your response here
​(Simplify your​ answer.)

Answers

The final response is:
−8x^3+6x^2−9x+4 / x−2 = -8x^2 - 10x - 29 + (62/(x-2))

The synthetic division of −8x^3+6x^2−9x+4 / x−2 can be performed as follows:

Step 1: Write the coefficients of the dividend in a row: -8, 6, -9, 4

Step 2: Write the divisor in the form x-a, in this case x-2, so a=2

Step 3: Bring down the first coefficient, -8, to the bottom row

Step 4: Multiply the first number in the bottom row, -8, by a, 2, and write the result, -16, in the next column

Step 5: Add the numbers in the second column, 6 and -16, to get -10, and write the result in the bottom row

Step 6: Repeat steps 4 and 5 with the new number in the bottom row, -10, until all columns have been completed

Step 7: The last number in the bottom row is the remainder, and the other numbers in the bottom row are the coefficients of the quotient

The synthetic division table looks like this:

| 2 |  |   |   |   |
|---|---|---|---|---|
|-8 | 6 | -9| 4 |   |
|   |-16|-20| 58|   |
|---|---|---|---|---|
|-8 |-10|-29| 62|   |

The quotient is -8x^2 - 10x - 29 with a remainder of 62.

So the final response is:
−8x^3+6x^2−9x+4 / x−2 = -8x^2 - 10x - 29 + (62/(x-2))

I hope this synthetic division explanation was helpful!

Learn more about division

brainly.com/question/21416852

#SPJ11

College enrollment of 41,000 increases by 7% every year.

Answers

The exponential function showing the relationship between y and t is y = 41,000 x (1.07)^t

How to determine the exponential function

From the question, we have the following parameters that can be used in our computation:

Initial value, a = 41,000

Rate = 7% increment

The exponential function for the college enrollment y of the college, in dollars, after t years can be expressed as:

y = a(1 + r)^t

Substitute the known values in the above equation, so, we have the following representation

y = 41,000 x (1 + 7%)^t

Evaluate

y = 41,000 x (1.07)^t

Where 1.07 is the factor by which the college enrolment increases

Hence, the function is y = 41,000 x (1.07)^t

Read more about exponential function at

brainly.com/question/11464095

#SPJ1

pls answer this question only even numbers like 2,4,6....

Answers

Answer:

image is blur dear!!!

Step-by-step explanation:

Given the polynomial 3x^(3) - 4x^(2) + 9x - 12, rewrite the polynomial as a product of binomials.

Answers

The polynomial  3x³ - 4x² + 9x - 12 as a product of binomials is (3x - 4)(x² + 3).

To rewrite the polynomial 3x³ - 4x² + 9x - 12 as a product of binomials, we need to factor the polynomial. One method to do this is by grouping. Here are the steps:

1. Group the first two terms and the last two terms: (3x³ - 4x²) + (9x - 12)
2. Factor out the common factor from each group: x²(3x - 4) + 3(3x - 4)
3. Notice that (3x - 4) is a common factor in both groups, so we can factor it out: (3x - 4)(x² + 3)
4. Now we have the polynomial rewritten as a product of binomials: (3x - 4)(x² + 3)

Therefore, the polynomial 3x³ - 4x² + 9x - 12 can be rewritten as (3x - 4)(x² + 3).

To learn more on Polynomials click:

brainly.com/question/11536910

#SPJ11

y = -4x+6
find the perpendicular line that passes through (-7,5)
find equation of parallel line that passes through (-7,5)

Answers

The equation of the parallel line is y = -4x - 23.

To find the equation of the perpendicular line that passes through (-7, 5), we need to first find the slope of the given line y = -4x + 6. The slope of this line is -4. The slope of a perpendicular line is the negative reciprocal of the original slope, so the slope of the perpendicular line is 1/4.

Next, we can use the point-slope form of an equation to find the equation of the perpendicular line:

y - y1 = m(x - x1)

y - 5 = (1/4)(x - (-7))

y - 5 = (1/4)(x + 7)

y = (1/4)x + 9/4 + 5

y = (1/4)x + 29/4

The equation of the perpendicular line is y = (1/4)x + 29/4.

To find the equation of the parallel line that passes through (-7, 5), we can use the same slope as the original line, -4, and the point-slope form of an equation:

y - y1 = m(x - x1)

y - 5 = -4(x - (-7))

y - 5 = -4(x + 7)

y = -4x - 28 + 5

y = -4x - 23

The equation of the parallel line is y = -4x - 23.

Learn more about perpendicular line

brainly.com/question/18271653

#SPJ11

In January 1993, there were about 1,313,000 internet hosts. During the next five years, the number increased by about 100% per year. Estimate the year when there were 30 million hosts

Answers

The estimate is that there were 30 million internet hosts in the year 1998.

What is exponential growth?

Exponential growth is a function that shows an increase within a population that occurs at the same rate over time.

If the number of internet hosts increased by 100% per year, it means that it doubled every year. Therefore, we can use the formula for exponential growth to estimate the number of internet hosts in future years.

Let x be the number of years after 1993, and let H(x) be the number of internet hosts in year y. Then, we have:

H(x) = 1,313,000 * 2ˣ

To estimate the year when there were 30 million internet hosts, we need to solve the following equation for x:

H(x) = 30,000,000

Substituting the formula for H(y), we get:

1,313,000 * 2ˣ = 30,000,000

Dividing both sides by 1,313,000, we get:

2ˣ = 30,000,000 / 1,313,000

Taking the logarithm of both sides with base 2, we get:

x = log2(30,000,000 / 1,313,000)

Using a calculator, we get:

x ≈ 5.2

Therefore, the estimate for the year when there were 30 million internet hosts is: 1993 + 5.2 ≈ 1998.2

Hence, the estimate is that there were 30 million internet hosts in the year 1998.

To learn more about exponential growth visit:

https://brainly.com/question/10284805

#SPJ1

values of x : -6-(4x)/(x+2)=(8)/(x+2)

Answers

There are no values of x that satisfy the equation -6-(4x)/(x+2)=(8)/(x+2).

To find the values of x for the equation -6-(4x)/(x+2)=(8)/(x+2), we need to follow the following steps:

Multiply both sides of the equation by (x+2) to eliminate the fractions:
(x+2)(-6-(4x)/(x+2))=(x+2)(8)/(x+2)

Simplify the equation:
-6(x+2)-4x=8

Distribute the -6:
-6x-12-4x=8

Combine like terms:
-10x-12=8

Add 12 to both sides:
-10x=20

Divide both sides by -10:
x=-2

However, we need to check our answer to make sure it does not result in a zero denominator in the original equation. If we plug in x=-2 into the original equation, we get a zero denominator, which is not allowed. Therefore, there are no values of x that satisfy the equation.

For more information about equation, visit:

https://brainly.com/question/22688504

#SPJ11

What is the quotient of (−168) ÷ (−14) ÷ (−3)?

please help

Answers

Answer:

= -4

Step-by-step explanation:

To solve this expression, we need to perform the division in the correct order, following the rules of mathematical operations. We can simplify the expression as follows:

(-168) ÷ (-14) ÷ (-3) = (-168) ÷ [(-14) x (-3)] [dividing by a negative number is the same as multiplying by its reciprocal]

= (-168) ÷ 42

= -4

Therefore, the quotient of (-168) ÷ (-14) ÷ (-3) is -4.

Identify and explain any restrictions on the variablex in the expression √6x-2

Answers

The restriction on the variablex is that it must be greater than or equal to 1/3. If x is less than 1/3, the expression √6x-2 will not be a real number.

The restrictions on the variablex in the expression √6x-2 are determined by the fact that the square root of a negative number is not a real number. Therefore, the expression under the square root must be greater than or equal to zero. This gives us the following inequality:

6x-2 ≥ 0

Solving for x, we get:

6x ≥ 2

x ≥ 2/6

x ≥ 1/3

So the restriction on the variablex is that it must be greater than or equal to 1/3. If x is less than 1/3, the expression √6x-2 will not be a real number.

Learn more about Restrictions

brainly.com/question/30175943

#SPJ11

A vector u and a set S are given. If possible, write u as a linear combination of the vectors in S.
U = [1]. S = {[1}, [0}}
[1] {[0] [1]}

Answers

vector u can be written as a linear combination of the vectors in set S with the scalars a = 1 and b = 0.

To write vector u as a linear combination of the vectors in set S, we need to find scalars a and b such that:

u = a[1] + b[0]

Substituting the values of vector u and the vectors in set S into this equation, we get:

[1] = a[1] + b[0]

This equation can be simplified to:

[1] = [a] + [0]

Since the scalar b is being multiplied by the zero vector, it will always equal the zero vector, and can therefore be eliminated from the equation. This leaves us with:

[1] = [a]

We can see that the scalar a must equal 1 in order for this equation to be true. Therefore, vector u can be written as a linear combination of the vectors in set S as follows:

u = 1[1] + 0[0]

In conclusion, vector u can be written as a linear combination of the vectors in set S with the scalars a = 1 and b = 0.

Learn more about linear combination

brainly.com/question/30888143

#SPJ11

Three dices are rolled, what is your random variable x for the number of times "2" is rolled? What are the probabilities for each instance?

Answers

The required probability for the three dices to be rolled for the given condition is equal to ,

probability 0.579 when X=0,

probability 0.347 when X =1

probability 0.069 for X = 2

probability 0.005 when X = 3.

The random variable X represents the number of times the number '2' is rolled when three dices are rolled.

X represents the values from 0 (when no '2' is rolled) to 3 (when all three dices show '2'.

Probabilities for each case, use the binomial probability formula, we, have,

P(X = a) =ⁿCₐ × pᵃ × (1-p)ⁿ⁻ᵃ

n = Number of trials (in this case, n = 3)

a = Number of successes (here, 'a' ranges from 0 to 3).

p = Probability of success (rolling a '2' on a single die)

p = 1/6

Required probabilities for each possibility is,

P(X = 0) = (³C₀) × (1/6)^0 × (5/6)^3

             = 125/216

             ≈ 0.579

P(X = 1) = ((³C₁) × (1/6)¹ × (5/6)²  

            = 75/216

            ≈ 0.347

P(X = 2) = ³C₂× (1/6)²× (5/6)¹  

             = 15/216

             ≈ 0.069

P(X = 3) = (³C₃) × (1/6)³× (5/6)⁰

             = 1/216

             = 0.004629

             ≈ 0.005

Therefore, the random variable X for the number of times 2 is rolled for three dices are rolled represents probability distribution,

X = 0 with probability 0.579

X = 1 with probability 0.347

X = 2 with probability 0.069

X = 3 with probability 0.005

Learn more about probability here

brainly.com/question/29161618

#SPJ4

Evaluate the function f(x)=x²-3x - 8 at the given values of the independent variable and simplify. a. f(8) b. f(x+9) c. f(-x) a. f(8) = (Simplify your answer.) b. f(x + 9) = (Simplify your answer.) c. f(-x) = (Simplify your answer.)

Answers

Answer:

Step-by-step explanation:

Given: [tex]f(x)=x^{2} -3x - 8[/tex]

To find:

a) f(8)

To find f(8), replace x with 8 in f(x)

[tex]f(8) = 8^{2} -3(8) -8 = 32[/tex]

b)  f(x+9)

To find f(x+9), replace x with x +9 in f(x)

[tex]f(x+9) = (x +9)^{2} -3(x +9) -8 = x^{2} +18x+81-3x-27-8=x^{2} +15x+46[/tex]

c) f(-x)

To find f(-x), replace x with -x in f(x)

[tex]f(x)=(-x)^{2} -3(-x) - 8 =x^{2} +3x-8[/tex]

This is how we simplify these expressions.

given trinomial. If the trinomial cannot be factored, indicate "Not Factorable". x^(2)+12x+35 to enter your answer (opens in new window ) 2 Points

Answers

The given trinomial x^(2)+12x+35 is factorable. It's factors would be (x+7)(x+5).

To factor this trinomial, we need to find two numbers that multiply to 35 and add to 12. The two numbers that satisfy this condition are 7 and 5. Therefore, we can factor the trinomial as follows:

x^(2)+12x+35 = (x+7)(x+5)

So, the factored form of the given trinomial is (x+7)(x+5).

Therefore, the answer is (x+7)(x+5).

To know more about trinomial, refer here:

https://brainly.com/question/16347049#
#SPJ11

7.1 Bellwork
1 of 31 of 3 Items
Question
Classify each polygon by the number of sides. Then say whether it is convex or concave, regular or not regular.



shape:
, convex or concave:
, regular or not regular:
.

Answers

The polygons are classified as :-

1.CONVEX

2.CONCAVE

3.CONCAVE

4.REGULAR

5.CONCAVE

6.IRREGULAR

What are polygons?

A polygon is a geometrical figure, with finite sides and angles, they can be regular and irregular.

Regular Polygon

A regular polygon is that which has all its sides and angles equal, for example an equilateral triangle and a square.

Irregular Polygon

A irregular polygon is that which has all its sides and angles unequal,

For example, a scalene triangle, a rectangle, a kite, etc.

Convex Polygon

A Convex polygon is that which has all its angles less than 180 degrees,

Concave Polygon

A Concave polygon is that which has its angles greater than 180 degrees,

Learn more about polygons, click;

https://brainly.com/question/24464711

#SPJ9

The complete question attached

A tractor cost $9250 and depreciates in value by 12% per year. How much will the tractor be worth after 5 years?

Please answer ASAP!

Answers

Answer:

$3,700

Step-by-step explanation:

12% of 9,250 is 1,110

so each year 1,110 is subtracted from the original price of the tractor.

So if you subtract 1,110 five times from 9,250 you get 3,700.

3. What is the relationship between <8 and <4?
7
1 2
3 4
6
8
Ocorresponding angles
Oalternate exterior angles
Osame-side interior angles
Oalternate interior angles
(1 point)

Answers

The relationship between ∠8 and ∠4 include the following: A. corresponding angles.

What are corresponding angles?

In Mathematics, corresponding angles can be defined as a postulate (theorem) which states that corresponding angles are always congruent when the transversal intersects two (2) parallel lines. This ultimately implies that, the corresponding angles will be always equal (congruent) when a transversal intersects two (2) parallel lines.

By applying corresponding angles theorem to lines l and m, we have the following:

8 ≅ ∠4

3 ≅ ∠7

Read more on parallel lines here: brainly.com/question/16959398

#SPJ1

98. A blue whale weighs up to \( 1.8 \times 10^{6} \mathrm{~kg} \). How much will 12 blue whales weigh?

Answers

12 blue whales will weigh [tex]\( 2.16 \times 10^{7} \mathrm{~kg} \)[/tex].

The weight of 12 blue whales will be the product of the weight of a single blue whale and the number of blue whales. To find the product, we simply multiply the weight of a single blue whale by the number of blue whales.

So, the weight of 12 blue whales will be:

[tex]\( 1.8 \times 10^{6} \mathrm{~kg} \) × 12 = \( 2.16 \times 10^{7} \mathrm{~kg} \)[/tex]


Therefore, 12 blue whales will weigh [tex]\( 2.16 \times 10^{7} \mathrm{~kg} \)[/tex]

What is multiplication?

Multiplication refers to binary operations in which different numerical sets are established. In mathematics the process of multiplication is elementary in several operations, it is also accompanied by addition, subtraction and division. Multiplication is the opposite of division.

For more information about multiplication, visit:

https://brainly.com/question/10873737

#SPJ11

last year there were 129 pies baked for the bake sale. this year there were b pies baked. using b write an expression for the total numbers of ingredients and pies baked in the two years

Answers

Answer:

Step-by-step explanation:

Assuming that the number of ingredients per pie is constant, we can write an expression for the total number of ingredients and pies baked in the two years as:

Total number of ingredients = (129 x ingredients per pie) + (b x ingredients per pie)

Total number of pies baked = 129 + b

So, if we let "i" represent the number of ingredients per pie, we can write the expression as:

Total number of ingredients = (129 x i) + (b x i)

Total number of pies baked = 129 + b

Note that without knowing the value of "i," we cannot simplify this expression any further.

Jill's gym class lasted 50 minutes. She walked around the school track for the first 15 minutes. Then, she played kickball for 25 minutes. She got to play on the playground for the rest of class. After kickball, how long did Jill get to play on the playground?

Answers

Jill played for 10 mins. 25+15=40 50-40=10

Kaylin buys a greeting card for 3.79. She then buys 4 postcards that all cost the same amount. The total cost is 5.11. How much is each postcard? Show your work.

Answers

Answer:

0.33

Step-by-step explanation:

5.11-3.79= total for 4 postcards

then answer divided by 4 postcards

Graph f(x) = (x+1) (x-5)

Answers

The graph of the quadratic function is on the image at the end.

How to graph the quadratic function?

Here we have the quadratic function:

f(x) = (x + 1)*(x - 5)

To graph this, we need to find some points of the parabola and then connect them.

So let's evaluate the function.

if x = -1

f(-1) = (-1 + 1)*(-1 - 5) = 0

if x = 0

f(0) =  (0 + 1)*(0 - 5) = -5

if x = 1

f(1) =  (1 + 1)*(1 - 5) = 2*-4 = -8

if x = 5 then:

f(5) =   (5 + 1)*(5 - 5) = 0

So we have the points (-1, 0), (0, -5), (1, -8) and (5, 0).

With these we can graph the parabola (you can try to find more points to get a better graph).

Learn more about quadratic functions at:

https://brainly.com/question/1214333

#SPJ1

RETIREMENT INCOME A retiree deposits S dollars into an account that earns interest at an annual rate r compounded continuously, and annually withdraws W dollars. a. Explain why the account changes at the rate dt/dV=rV−W where V(t) is the value of the account t years after the account is started. Solve this separable differential equation to find V(t). Your answer will involve r,W, and S. b. Frank and Jessie Jones deposit $500,000 in an account that pays 5\% interest compounded continuously. If they withdraw $50,000 annually, what is their account worth at the end of 10 years? c. What annual amount W can the couple in part (b) withdraw if their goal is to keep their account unchanged at $500,000 ?

Answers

V(t)=S ert-W/r

a. The rate at which the account changes (dt/dV) is equal to the interest rate (r) times the value of the account (V) minus the amount withdrawn (W). This can be written mathematically as dt/dV=rV-W. This is a separable differential equation, which can be solved by integrating both sides of the equation with respect to time. The solution is V(t)=S ert-W/r.



b. The value of the Jones' account at the end of 10 years can be found using the solution V(t) from part a: V(10)=500,000 e5%x10-50,000/5% = $387,468.51.



c. To keep their account unchanged at $500,000, the Jones' must withdraw an annual amount W such that V(t)=500,000. From the solution V(t)=S ert-W/r, we can solve for W: W = 500,000e5%x10 - 500,000/5% = $47,613.30.

Learn more about interest

brainly.com/question/30393144

#SPJ11

The difference between the digits of a two -digit number is 1. The number itself is one more than five times the sum of its digits. If the unit digit is greater than the tens digit, find the number.

Answers

The number is 63. The difference between the digits of a two-digit number is 1.

What is number?

Number is a mathematical object used to count, measure, and label. Numbers can be represented in a variety of forms, such as numerals, symbols, or words. Numbers are fundamental to mathematics, and all other areas of science and technology. They are used to represent amounts of money, measurements, dates, and amounts of time. Numbers are also used to identify objects and people, and to create equations and formulas. Number is essential for understanding the world around us.

To solve this, the first thing to do is find the sum of the digits. Since the number is one more than five times the sum of its digits, the sum of the digits is (63/5)-1=12.5-1=11.5. This means that the tens digit is 11 and the unit digit is 11 + 1 = 12. Therefore, the two-digit number is 63.

To know more about number click-
https://brainly.com/question/24644930
#SPJ1

A circle moves through 145 degrees in 25 seconds. If the radius
of the circle is 21 cm, find the linear and angular speeds.

Answers

The linear speed of the circle is 2.125 cm/s and the angular speed of the circle is 0.1012 rad/s.

The linear speed of the circle can be found by calculating the length of the arc traveled in 25 seconds. The length of an arc is given by the formula L = rθ, where r is the radius of the circle and θ is the central angle in radians. Converting the given angle from degrees to radians, we have:

θ = 145 degrees * π/180 = 2.53 radians

Substituting the values into the formula, we get:

L = 21 cm * 2.53 = 53.13 cm

Therefore, the linear speed of the circle is:

v = L/t = 53.13 cm/25 s = 2.125 cm/s

The angular speed of the circle can be found by dividing the central angle by the time taken to travel that angle. Therefore, the angular speed of the circle is:

ω = θ/t = 2.53 radians/25 s = 0.1012 rad/s

Hence, the linear speed of the circle is 2.125 cm/s and the angular speed of the circle is 0.1012 rad/s.

For more questions like Speed visit the link below:

https://brainly.com/question/16609234

#SPJ11

Two fire towers are located 5 miles apart on a straight road. They both spot the same fire on the north side of the road and report its location in terms of angles from the road. From the tower A, the fire is 22 degrees. From the tower B (5 miles east of tower A), the fire is 37 degree. How far from tower B is the point on the road closest to the fire? Please sketch and show the fire location. The point on the road closest to the fire will be on a line to the fire directly perpendicular to the road. Round to two decimal places

Answers

Tower B is 2.34 miles far from the point on the road closest to the fire.

The point on the road closest to the fire can be found by drawing a line perpendicular to the road that passes through the fire location. Let x be the distance from tower B to this point. Then, using trigonometry, we can find that the distance from tower A to the fire location is x/tan(22) and the distance from tower B to the fire location is (5 - x)/tan(37). Since the fire location is the same from both towers, these distances must be equal, so we can set up the equation x/tan(22) = (5 - x)/tan(37) and solve for x, which is approximately 2.34 miles.

To sketch the fire location, draw a straight road with two fire towers located 5 miles apart. From tower A, draw a line at an angle of 22 degrees towards the north side of the road to represent the direction of the fire location. From tower B, draw a line at an angle of 37 degrees towards the same side of the road. The point where these two lines intersect represents the location of the fire. Draw a line perpendicular to the road passing through this point to find the closest point on the road to the fire.

For more questions like Distance visit the link below:

https://brainly.com/question/14929758

#SPJ11

4. Emma is a salesperson who sells computers at an
electronics store. She makes a base pay amount each day
and then is paid a commission for every computer sale she
makes. Let P represent Emma's total pay on a day on
which she sells x computers. The table below has select
values showing the linear relationship between x and P.
Determine how much money Emma would be paid on a
day in which she sold 7 computers.
x
1
3
8
P
105
145
245

Answers

Emma would therefore receive $225 for a day in which she sold 7 laptops.

what is unitary method ?

Mathematicians use a method called the unitary method to handle proportional problems. Finding the value of one unit must be done before using that value to determine the value of a specified quantity of units. When buying or cooking real-world products that are sold by weight or volume and whose prices are determined by those factors, this technique is frequently used. The unitary approach is also used to address issues involving time, space, and speed.

given

We must use the provided values in the table to determine the equation of the linear relationship between x and P in order to determine how much money Emma would be paid on a day when she sold 7 computers.

The first two data values can be used to determine the line's slope:

slope is equal to (145 - 105) / (3 - 1) / (P2 - P1) / (x2 - x1), or 20.

Next, we can determine the equation of the line using the point-slope form of the equation of a line:

P - P1 Equals m(x - x1) (x - x1)

P - 105 = 20(x - 1) (x - 1)

P = 20x + 85

To determine Emma's total pay, we can finally enter x = 7 into the equation:

P = 20(7) + 85\s= 225

Emma would therefore receive $225 for a day in which she sold 7 laptops.

To know more about unitary method  visit:

https://brainly.com/question/28276953

#SPJ1

use this triangle for problems 4 and 5
1. What is the length of AB
2. What is the area of this triangle​

Answers

(1) The length of AB in triangle ABC 24.58 units.

(2) The area of the triangles is 77.94 sq. units.

What is the length of AB for triangle ABC?

The length of AB in triangle ABC given is calculated by applying cosine rule as shown below.

Length AB is opposite angle C, so will denote the length as c.

c² = a² + b² - 2ab cos(C)

where;

a is the length of side CBb is the length of side ACC is the angle C

c² = (18)² + (10)² - 2(18 x 10) cos(120)

c² = 604

c = √ 604

c = 24.58 units

The area of the triangles is calculated as follows;

A = ¹/₂ab sin C

A = ¹/₂ x 18 x 10 x sin (120)

A = 77.94 sq. units

Learn more about area of triangles here: https://brainly.com/question/17335144

#SPJ1

prisim A is similar to prisim B. The volume prisim a is 2080 cm3. what is the volume of prisim B?

Answers

Answer:

2080cm^3

Step-by-step explanation:

Help!! please answer asap
Express as a trigonometric function of one angle.
cos 9 sin(−6) − cos 6 sin 9

Answers

The expression can be explained as the trigonometric function of an angle as follows sin(15).

The given expression can be simplified using the trigonometric identity for the sine of the difference of two angles:

sin(a - b) = sin(a)cos(b) - cos(a)sin(b)

Substituting the given values for a and b, we get:

sin(9 - (-6)) = sin(9)cos(-6) - cos(9)sin(-6)

Simplifying further, we get:

sin(15) = sin(9)cos(6) - cos(9)sin(-6)

Therefore, the given expression can be expressed as a trigonometric function of one angle as follows:

sin(15) = sin(9)cos(6) - cos(9)sin(-6)

-sin(15) = cos(9)sin(-6) - sin(9)cos(6)


So the final answer is -sin(15).

See more about trigonometric function at https://brainly.com/question/25618616.

#SPJ11

Other Questions
Project Option 1-Individually 1 Change the equation to slope intercept form identify the slope and y-intercept of the equation. Be sure to show all your work 2 Describe how you would graph this line using the slope intercept method Be sure to write using complete sentences 4 Graph the function On the graph make sure to label the intercepts. You may graph your equation by hand on a piece of paper and scan 5 Suppose Saf's total profit on lunch specials for the next month is $1.503. The profit amounts are the same $2 for each sandwich and S graphs of the functions for the two months are similar and how they are different 02.03 Key Features of Linear Functions-Option 1 Rubric Requirements Student changes equation to slope-intercept form Student shows all work and identifies the slope and y-intercept of the equation Student writes a description which is clear precise, and correct, of how to graph the line using the slope-intercapt method Student changes equation to function notation Student explains clearly what the graph of the equation represents Student graphs the equation and labels the intercepts correctly Student writes at least three sentences explaining how the graphs of the two equations are the same and how they are different Question 5 (1 point) What best describes the following statements? Statement 1: Smith believed that countries should trust in comparative advantage a decision framework and only restrain trade in a fe the current in a circuit is 0.59 A. The circuit has two resistors connected in series: one is 110 ohms and the other is 130 ohm. What is the voltage in the circuit? Behaviourist theory.meaning of theoryproponentprinciples What compromise created a bicameral legislative branch? What is the exponential function for bacterial growth? PLLEAS HELP SOMEONE I NEED QUICKKSSSS 9. A segment has endpoints at A(-4,2) and B(2,10) . The perpendicular bisector of AB passes through point M, which lies on AB Find the coordinates of 'point M.(pls n ty) what is the negative tu command for dedicar? Assume that the weights of babies at birth are normally distributed with a mean of 7.9 lbs and a standard deviation of 1.1 lbs. What is the z-score of a baby weighing 8.3 lbs? What would be the weight associated with a z-score of 2.2? 3. A nonpathogenic bacterium acquires resistance to antibiotics. Explain in your own words using concepts that you learnt, how this is possible. Directions: Infer the meaning of the unfamiliar words by choosing from the two options. Write your answers on a separate sheet of paper.1. Exercising regularly, eating healthy foods, and lessening stress can have salubrious effects. Salubrious means beneficial or non-beneficial?2. Not exercising regularly, eating fatty foods, and letting stress rule your life can all lead to deleterious health.Deleterious means harmful or harmless?3. Crustaceans, such as lobsters, crabs and shrimps, are delicious but can be expensive. Crustaceans means hard-shelled seafoods or underground vegetables?4. Somnambulists are not even aware of the fact that they walk around while they are asleep. Somnambulist means sleepwalker or sleep talker?5. Nocturnal animals, as opposed to those active at daytime, can see very well at night so they can hunt prey. Nocturnal means active at night or asleep at night? The Nuremberg Laws allowed that a municipal hospital could turn away Jewish patients Aryans could hire Jews as household help Aryan stores could legally be vandalized and destroyed Jews and non-Aryans could vote in German elections INDIVIDUAL ASSIGNMENT (15 MARKS) INSTRUCTIONS TO STUDENTS You are reminded of the University policy on Academic Honesty and Integrity. The work submitted must be the sole work of the individual, and appropriate citations used. Copy- paste from the class slides will not amount to completing the assignment. Any unauthorized assistance in undertaking the assignment will draw serious consequences, including but not limited to failing the assignment. The term paper must be submitted in line with the instructions: Your assignment must be typed in Times New Roman, font 12 and have 1.5 spacing. It should not exceed five pages including appropriate referencing. Class power point slides are NOT a source of reference. Submission of the assignment will be through the blackboard platform. The deadline for submission is 5th March 2022 at 9:00AM. There shall be no extensions. a) Explain the meaning and the nature of the law. Why is law important for the regulation of business conduct? Which statement correctly describes a step in the carbon cycle? photosynthesis adds carbon directly to the lithosphere. Cellular respiration adds carbon directly to the atmosphere.Cellular respiration removes carbon directly from the atmosphere.Burning fossil fuels removes carbon directly from the biosphere. The base sequence of one of the two strands of a DNA fragment from the bacterium Escherichia coli is indicated. The thymine indicated in bold corresponds to the first transcribed base and the underlined triplet corresponds to the messenger translation initiation codon (AUG).TTGATCATATTACGCGGAGGGTAGCTCTGCTTACCGCCCAATATTTGCGGAACTA3.A.- Indicate as much as you can of one of the consensus sequences of the bacterial promoter.B.- Indicate the sequence and polarity of the newly transcribed mRNA and the synthesised protein.C.- Indicate the effect on the protein in the following cases:3.C.1.- Insertion of 3 bases in the consensus sequence of the promoter 3.3.C.2.- Deletion of 3 bases in the consensus sequence of the promoter. 3.3.C.3.- Insertion of 1 base in the consensus sequence of the promoter 3.C.4.- Insertion of 1 base in the region between the transcription start site (+1) and the translation start sequence.C.5.- Genomic rearrangement involving an inversion of codons 3 to 5. 3. Predict the change in electronegativity of the next elements in a row (C, Si), then check those properties. Do they match your predictions? Imagine that you are an employer trying to decide whether to sponsor a "qualified retirement plan or "nonqualified" deferred compensation plan for your employees. What are the tax and nontax consequences of each plan? Based on what you know about the different plans, what would be your justification for selecting the one you choose? PLEASEEEE HELP ASPPPPP Cambodia rice export to EU countries within EBA (research purpose)