Answer:
D
Explanation:
I did the test
goodluck
The element phosphate can be found in which macromolecule(s):
O Protein
O Lipids
O Carbohydrates
O Nucleic Acids
O All of the above
O Proteins and Nucleic Acids only
O Carbohydrates and lipids only
The element phosphate can be found in nucleic acids.
Nucleic acids are macromolecules that are made up of nucleotides, which are the building blocks of DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). Each nucleotide consists of a sugar (either deoxyribose in DNA or ribose in RNA), a nitrogenous base (adenine, guanine, cytosine, or thymine in DNA; adenine, guanine, cytosine, or uracil in RNA), and a phosphate group. The phosphate group is an important component of the nucleotide and plays a key role in the structure and function of nucleic acids.
Hope This Helps You!
Conventional CPR provides 15% of normal blood flow to the heart and blood flow to the brain is 25% of normal. The Res Q Pod is an impedance device that prevents unnecessary air from entering the chest during the compression phase of CPR. When air is prevented from rushing into the lungs as the chest wall recoils, the vacuum (negative pressure) in the thorax pulls more blood back to the heart, resulting in:
The Res Q POD ITD lowers intrathoracic stress at some point of the draw back segment of CPR with the aid of using selectively limiting pointless airflow into the chest.
This vacuum will increase preload, lowers intracranial stress (ICP), and improves blood go with the drift to the mind and crucial organs. Compress the ResQPUMP towards a clean difficult floor with about 50 kg of pressure, the use of the pressure gauge at the ResQPUMP as a guide. Observe for an growing gauge reading. 3. Pull up at the deal with with about 10 to fifteen kg of pressure, the use of the decompression pressure gauge as a guide. The CPR remarks gadgets permit to screen the best of resuscitation and tell the rescuer approximately the fundamental parameters of the guide chest compressions being performed, consisting of chest compression price and depth, and complete chest recoil.
To learn more about CPR check the link below:
https://brainly.com/question/3725035
#SPJ4
can anyone help me with this? (inserted picture) giving brainliest
Answer:
d. 10
Explanation:
i hope this helps :)
why does breathing become faster during exercise
Explanation:
When you exercise and your muscles work harder, your body uses more oxygen and produces more carbon dioxide. To cope with this extra demand, your breathing has to increase from about 15 times a minute (12 litres of air) when you are resting, up to about 40–60 times a minute (100 litres of air) during exercise.
Your body needs more oxygen and creates more carbon dioxide while you exercise because your muscles are working harder.
How can katey and amanda's amino acid sequence be the same and yet they may have a differences in their DNA?
Answer: Two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.
Explanation:
The genome of an organism is found in a molecule called DNA (deoxyribonucleic acid). The main function of this DNA molecule is the long-term storage of information to build other components of cells, such as proteins and RNA molecules (ribonucleic acid); and the portion of the genome that codes for a protein or RNA is known as a gene. These protein-coding genes are composed of trinucleotide units called codons, each of which codes for an amino acid. For a protein whose sequence is encoded in the nucleotides of DNA to be synthesized, that DNA molecule must first be transcribed into a molecule called messenger RNA, and this molecule is used for a process called translation or protein synthesis. The sequence of the genetic material is composed of four distinct nitrogenous bases, which are represented by letters in the genetic code:
Adenine (A)Thymine (T)Guanine (G) Cytosine (C)Uracil (U) instead of T in RNAThe genetic code is the set of rules that defines how a sequence of nucleotides in RNA is translated into a sequence of amino acids in a protein. This code is common to all living things, which shows that it has had a unique origin and is universal. So, the code defines the relationship between each sequence of three nucleotides (codon) and each amino acid. The number of possible codons is 64, of which 61 code for amino acids (one of them being the start codon, AUG) and the remaining three are stop sites (UAA, UAG, UGA). The codon sequence determines the amino acid sequence in a particular protein, which will have a specific structure and function.
However, the genetic code has redundancy but no ambiguity. For example, two different codon can code for the same amino acid, and the differences between codons encoding the same amino acid have differences in the third position. This is explained by the wobble effect, where the same anticodon (present in the transfer RNA that loads with the amino acid and interacts with the codon in the messenger RNA) can establish interaction with different codons, which differ in their third base. This is why, in general, tolerance to change at this position is greater than at the first and second positions, and therefore tends to be less represented in the case of variations that result in pathologies.
Thus, two people can have different DNA sequences but these sequences can code for the same amino acids due to the redundancy of the genetic code in which two different codons can code for the same amino acid.
What happens after point A in regard to the population and resources available at that point in time?
At Point A, population and resources are consistent with each other. This meant at the time, that populace had access to sufficient resources.
Natural resources are anything that can be obtained from the environment for human needs. The more the population increases, the more natural resources are used to meet needs.
For example, food, clean water, clean air, and other needs. If the population increases, various problems will arise, for example, traffic flow density which causes air pollution, many agricultural lands being used as residential areas resulting in slums, and finally clean water becomes a problem. The more the population, the fewer natural resources will be eaten.
The complete question is seen in the picture
Learn more about the population and resources at https://brainly.com/question/24067944
#SPJ4
In community ecology we discussed the four main types of Interspecific Interactions. Select the correct answer(s): Group of answer choices Two possible outcomes of competition are resource partitioning and extinction Some bacteria use specialized metabolites (e.g., antibiotics, siderophores) to compete more effectively. Predation has a small impact on microbial community composition in oceans The production/release of antagonistic factors (e.g., lytic compound) to impede competitors is an example of exploitation competition
Answer:
Two possible outcomes of competition are resource partitioning and extinction.
Explanation:
Community ecology is the association of two or more population of different species that occupy the same geographical area within the same time and thus the term studies the interaction that takes place between the species in temporal and spatial scale.Which of the following is an example of one stage in ecological succession?
A. A tree falls over in a forest.
B. Weeds grow in a garden.
C. Fish swim in a pond.
D. A bird lays eggs in a nest.
Substance Y is not present in the urine; however, it was originally filtered through the glomerulus. How is this possible
Substance Y is not present in the urine; however, it was originally filtered through the glomerulus it was reabsorbed in the proximal tubule.
As blood flows into every nephron, it enters a cluster of tiny blood vessel, the glomerulus. The skinny partitions of the glomerulus permit smaller molecules, wastes, and fluid—often water, into the tubule. Larger molecules, together with proteins and blood cells, live withinside the blood vessel. Under ordinary conditions, excessive molecular weight proteins withinside the plasma (e.g., albumin and globulin) can't skip via the filtration membrane because of the results of the scale barrier and rate barrier of the glomerular capillary filtration membrane. Proteins are not normal constituents of the glomerular filtrate.
To learn more glomerulus check the link below:
https://brainly.com/question/7175191
#SPJ4
Can soneone please explain enzymes in a clear and in an understandable way?
Enzymes are biological catalysts* and enzymes are also a protein
Catalysts* are a substance that can speed up reactions
landslides are an example of
weathering
erosion
deposition
chemical change
I hope Answer is erosion
Need help ASAP! Will give brainliest;) NO LINKS please, WILL REPORT.
Answer: your answer is C
Explanation: brainliest?
8. In a deletion mutation a base my be
C. Moved
A. Left out
B. added in
Answer:
LEFT OUT
hope it help
Which structures differentiate plant cells from animal cells?
Answer:
2,4,8
Explanation:
Hope it helps :)
Which of the following statements best explains differences between the finches?
A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.
B. The beaks of the finches changed so all of the finches could eat the same types of food.
C. The beaks of the finches changed as the species of finches migrated to the same island.
D. The beaks of the finches changed as the finches' body sizes changed.
Answer:
i think it's D I hope this helps :)
Answer:
D is the answer
Explanation:
What is the best example of a Mendelian trait in humans?
The best example of a Mendelian trait in humans is phenylketonuria. This illness is an illustration of a Mendelian trait since it is passed down from parents to children when both parents have heterozygous (Aa) and homozygous (Aa) circumstances.
Mendelian qualities are determined by all of Mendel's postulated Laws of Inheritance and are traits that are transferred from parents to children through dominant and recessive alleles of a gene. The lack of an enzyme that turns the amino acid phenylalanine into tyrosine is the root cause of the autosomal recessive inherited disorder. As a result, the amino acid builds up and is converted into the toxic form of phenyl pyruvic acid, which builds up in the brain of the person and causes r-e-t-a-r-d-a-t-i-o-n.
To know more about Mendelian traits please visit
https://brainly.com/question/29754443
#SPJ4
heyy! i’ll give brainliest help asap pls
Answer:
I think the answer is A
hope this helps
have a good day :)
Explanation:
The appropriate response I accept would be dumping industrial sediment into the oceans.
A molecule that can be used as a molecular clock has a neutral mutation rate of one mutation per 40 million years. How many years ago did two species share a common ancestor if the molecules found in these two species differ by a total of eight mutations
The two species must have shared a common ancestor 320 million years ago, since the neutral mutation rate of the molecular clock is one mutation per 40 million years and the two species differ by a total of eight mutations.
A molecular clock is a tool used by scientists to estimate the time since two species have shared a common ancestor. This is done by measuring the number of genetic differences, or mutations, between the two species. The molecular clock is based on the assumption that the mutation rate is constant.
In this case, we know that the neutral mutation rate of the molecule being used as a molecular clock is one mutation per 40 million years. This means that for two species to have a difference of eight mutations, it must have been at least 320 million years ago that they shared a common ancestor.
To arrive at this conclusion, we can use the following formula:
Number of mutations × Neutral mutation rate = Time since common ancestor
In this case, 8 mutations × 40 million years = 320 million years. This means that two species must have shared a common ancestor at least 320 million years ago for them to have a difference of eight mutations.
The molecular clock can be a powerful tool for scientists to estimate the time since two species have shared a common ancestor. In this case, the neutral mutation rate of the molecule was known and used to calculate that two species must have shared a common ancestor at least 320 million years ago.
Learn more about molecular clock at : https://brainly.com/question/14352403
#SPJ4
Ue evidence from model to contruct an explanation about how carbon can form chain and ring tructure in biomolecule and how boimolecule are ued in cell procee
Biomolecules are used in cells to build cells and provide energy to cells.
Living organisms are built from the element carbon which has a mass of more than half the dry mass of their cells. Elemental carbon can form single bonds with hydrogen atoms, and double bonds with oxygen atoms or nitrogen atoms. The carbon atom is special because of its ability to form very stable bonds with other carbon atoms so that it can form very large molecules. Two carbon atoms can also be bonded together to form a double or triple bond.
Most biomolecules can be viewed as derivatives of carbonates, a group of compounds consisting only of the elements carbon and hydrogen, by replacing one or several hydrogen atoms with certain functional groups, resulting in various groups of carbon compounds with distinctive properties.
Learn more about biomolecule at https://brainly.com/question/10904629
#SPJ4
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.
What is DNA?Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.
The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.
Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.
Learn more about DNA, here:
https://brainly.com/question/21992450
#SPJ1
In the muscles of the limbs, the origin usually lies proximal to the insertion.
True
False
The statement "In the muscles of the limbs, the origin usually lies proximal to the insertion" is true.
In anatomy, the origin of a muscle is the attachment point that is closer to the center of the body, while the insertion is the attachment point that is farther away from the center of the body.For example, in the upper limb, the biceps brachii muscle originates from the scapula and inserts on the radius bone.
The deltoid muscle originates from the clavicle and scapula and inserts on the humerus. Similarly, in the lower limb, the quadriceps femoris muscle originates from the pelvic bone and inserts on the tibia. The hamstring muscle group originates from the ischium and inserts on the tibia and fibula.
This general rule holds true for the majority of muscles in the limbs, with the origin being proximal to the insertion. This is because the muscles are responsible for movement, and in order to generate force, the muscle fibers need to contract, and this contraction is more effective when the muscle fibers are shorter, which happens when the origin is proximal to the insertion.
Learn more about muscles at : https://brainly.com/question/9883108
#SPJ4
While both the endocrine and nervous systems are involved with communication, they differ in their mechanisms. What is one difference between hormones of the endocrine system and neurotransmitters of the nervous system
Answer:
Hormones are released by the glands in the endocrine system and are transmitted into the bloodstream..while neurotransmitters are released by the presynaptic terminal in the synapse and are transmitted across the synaptic cleft....
I hope this helps
What component allows semen to temporarily coagulate, preventing it from leaking back out of the female reproductive tract, once ejaculated
The protein-based compound called semenogelin is the main component that allows semen to temporarily coagulate and remain in the female reproductive tract after ejaculation.
This compound is produced primarily in the seminal vesicles, which are located in the male reproductive system. Semenogelin is composed of two major proteins, semenogelin I and semenogelin II. These two proteins combine to create a gel-like substance that helps semen to form a cohesive mass.
This mass helps to keep semen from leaking back out of the reproductive tract and helps to ensure that sperm are able to reach the egg for fertilization. The gel-like substance also helps to protect the sperm from the acidic environment of the female reproductive system. This coagulation process typically lasts for around 30 minutes before the semen begins to break down and is reabsorbed into the female reproductive tract.
To learn more about coagulate visit:
https://brainly.com/question/12077625
#SPJ4
What is the probability that a baby born to a man and woman both carriers for the recessive albino gene will be an albino?
If both parents have the gene, their child has a 1 in 4 chance of having inheritance albinism and a 1 in 2 chance of having the gene. Although they do not have albinism, carriers can pass the gene on.
One type of inheritance pattern for a trait, sickness, or problem that is passed down through families is autosomal recessive characteristics. There must be two copies of a recessive trait or disease for it to manifest. The gene or characteristic will reside on a non-sex chromosome. As a trait requires two copies to develop, many people may unintentionally carry a disease. A recessive illness or characteristic may go unnoticed for a few of generations before manifesting as the phenotypic, according to evolutionary theory. Diseases that are autosomal recessive include albinism and cystic fibrosis.
To learn more about inheritance click on the given link: https://brainly.com/question/14930526
#SPJ4
How does folding dough help it to rise
folding dough increases the air trapped between the layers which cause it to rise
How did Lucy get a black eye?
Ricky recalls giving Lucy a black eye by mistake, as do the Mertzes. Ricky recalls giving Lucy a black eye by mistake, as do the Mertzes.
Executives recommended Lucy sit behind chairs or tables to conceal her pregnancy. Not Lucy," was his reply. When Ricky throws a book Lucy catches the first shiner, but Fred and Ethel hear Lucy and Ricky reading the obscene book aloud and don't believe Lucy's story. In "The Crying Dame," Lucy's eyes are hidden by her hair because her parents were bothered by her habit of mindlessly staring at them and let her to grow it out in the hope that she would stop.
Learn more about pregnancy here-
https://brainly.com/question/30080574
#SPJ4
Explain how the structure and function of the smooth muscle, skeletal muscle and cardiac muscle is required for its function in the body.
Answer:
Cardiac and skeletal muscle are both striated in appearance, while smooth muscle is not. Both cardiac and smooth muscle are involuntary while skeletal muscle is voluntary. ... Cardiac muscle is also an involuntary muscle but is more akin in structure to skeletal muscle, and is found only in the heart.
Pls help full explination best answer gets brainliest
Answer:
Volume of large cube: 64 mm square
Small: 0.001 mm square
Explanation:
Multiply the 3 side lengths of both cubes
Now answer the 2 questions
List all the possible genotypes of the offspring from your Punnett
square in question 4. Next to each genotype write the corresponding
phenotype---short stems or tall stems.
we see that there are three possible genotypes that could result from this crossing: AA, Aa, aa. The genotypes AA and Aa will result in the yellow pea phenotype because A is dominant. Only aa will produce the green pea phenotype.
A Punnett square is a graph that makes it simple to ascertain the anticipated proportion of various genotypes in children of two parents. Figure below illustrates a Punnett square for pea plants. In this instance, flowercolor is heterozygous for both parents (Bb). The top of the graph represents the gametes produced by the male parent, while the sides represent the gametes produced by the female parent. By correctly filling in the Punnett square's cells, we may identify the various possible allele combinations in their progeny (alleles).
To learn more about Punnett square please visit here:
https://brainly.com/question/27984422
#SPJ4
need help asap
question 6
- 20 points