Explanation:
your answer is zygote hope that helps I had to put that because it said I had to put in more words but your answer is zygote
Which explains why it is important to eat a full healthy meal before an aftemoon of playing sports? Food provides the carbon dioxide that is a product of cellular respiration? Food provides the oxygen that is a product of cellular respiration? Food provides the glucose that is a reactant in cellular respiration. Food provides the energy that is a reactant in cellular respiration?
Answer:
Food provides the glucose that is a reactant in cellular respiration.
Which of the following molecules are produced during transcription? (3 points)
Messenger RNA
Ribozymes
Ribosomal proteins
I only
I and II only
II only
I, II, and III
Answer:
1. and 2. only
Explanation:
rRNA is sometimes called a ribozyme or catalytic RNA.
Molecules of rRNA are synthesized in a specialized region of the cell nucleus called the nucleolus, which appears as a dense area within the nucleus and contains the genes that encode rRNA.
mRNA is Messenger RNA which are synthesized during DNA transcription as templates for the production of a specific proteins.
The molecules are produced during transcription are - Messenger RNA and Ribozymes that is - I and II only.
Transcription is the first step in decoding a cell's genetic information. During transcription, enzymes called RNA polymerases build RNA molecules that are complementary to a portion of one strand of the DNA double helix
the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA)carried out by an enzyme called RNA polymeraseproduces a number of accessory proteins called transcription factors.Ribozymes are catalytic RNA molecules. They have the intrinsic ability to break and form covalent bonds in RNA moleculesthus, The molecules are produced during transcription are - Messenger RNA and Ribozymes that is - I and II only.
Learn more about transcription:
https://brainly.com/question/11430054
HELP i need to create a story about cells and their functions the organelles are Cell membrane
Cell wall
Nucleus
Chloroplasts
Mitochondria
Vacuoles
im in 7th grade
Answer:
More than 8.7 million species are living on the planet. Every single species is composed of a cell and it includes both single-celled and multicellular organisms.
The cells provide shape, structure and carries out different types of functions to keep the entire system active. The cell contains different functional structures which are collectively called Organelles, and they are involved in various cellular functions.
Also Read: Difference between organ and organelle
Let us learn more in detail about the different types and functions of Cell Organelles.
Table of Contents
What are Cell Organelles?
List of Cell Organelles and their Functions
Plasma Membrane
Cytoplasm
Nucleus
Endoplasmic Reticulum
Mitochondria
Plastids
Ribosomes
Golgi Apparatus
Microbodies
Cytoskeleton
Cilia and Flagella
Centrosome and Centrioles
Vacuoles
A Brief Summary on Cell Organelles
The number of chromosomes is DOUBLED after mitosis. True or False, AND explain.
PLEASE HELP IT'S DUE TODAY!!!!
Answer:
False
Explanation:
The number of chromosomes is doubled during mitosis, but each daughter cell (new cell) has the same number as the mother (original cell)
Mitosis is a cell division cycle in which the parent cell divides to produce equivalent daughter cells. It can occur in the body for growth, replacing dead cells etc.
The statement is False.
The sentence can be explained as:
Mitosis is a function of division in cells in which the two exact daughter cells are produced from the parent cell division of the nucleus and cytoplasm.The parent cells undergo the doubling of the hereditary content by the process of central dogma during the synthesis stage. The parent and daughter cell is diploid during this sort of cycle and does not get halved or duplicated at the end of the cycle.Therefore, chromosomes do not get doubled at the end of the division.
To learn more about mitosis follow the link:
https://brainly.com/question/17364997
4. a) Name one-way lactic acid fermentation and alcohol fermentation are similar.
What is a characteristic of Antarctic Bottom Water?
a. Extremely high density
b. Southward movement toward Antarctica along the seafloor
c. Formation near the Mediterranean north of Africa
d. Extremely low density
e. Fast movement
Write the name of the nitrogenous base that joins to each of the bases
Answer:
Hydrogen bond
Explanation: Pretty much just a type chemical bond
Why didn't people know about germs or microbes before the mid-1800s?
Answer:
Explanation:
the germ theory explains why they might not have known
How does the development of a bluebird compare to that of a frog?
Answer:
Explanation:
Frogs:
Frog's evolutionary pathway resembles the water cycle. This is quite fitting, because all frogs statistically enjoy bodies of water. Seafrogs absorb salt-water through holes, which emit inside the snout. First, they grow two limbs, or legs, to swim. These turn into fins, which, eventually, allow for hopping and balancing-capacity. Capabilities, include: tongue-roll, sticky toes, bubbly neck, multi-eggs, and more
Frogs are incredibl(y) mammalian(s)!
The molecules of life are all carbon-based.
True
False
Answer:
All life we know of on Earth is mostly based on molecules containing the element carbon.
True.
Explanation:
Which example is the best description of an adaptation?
a heritable characteristic that evolves
a heritable characteristic that helps an organism find food
a heritable characteristic that helps an organism survive and reproduce
a heritable characteristic that helps an organism avoid predators
Answer:
a heritable characteristic that evolves
Explanation:
The best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.
What is an adaptation?An adaptation is a feature or characteristic of an organism that helps it to be able to survive in its environment.
Adaptations are important to an organism in order for it to grow and reproduce in its environment.
For example, polar bears have thick furs to enable rhem survive the cold environment of the polar regions.
Therefore, the best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.
Learn more about adaptation at: https://brainly.com/question/29594
Which property of metals allows them to be used to make coins that have the same thickness
Answer:
malleability
Explanation:
ce caps
What property of metals allows it to make coins the same thickness?2 malleability
A chemical reaction produces two new substances, and each product has a mass of 25 grams. What was the total mass of the reactants?3 50 gram
What is an evolution in general?
Answer: A evolution is a process in which someone/something upgrades over the course of time. It usually leads to improvement in lifestyle of that species/thing.
Explanation:
What would be the end result if an
experiment supports a hypothesis and
has been repeated?
A. developing a theory
B. redoing the hypothesis
C. graphing the data a different way
D. setting up another experiment based on the same
hypothesis
Answer:
A
Explanation:
The end result of repeated experiments supporting a hypothesis is for the hypothesis to become a theory.
In science, a hypothesis is a general statement that needs to be validated or invalidated by experiments. Once a hypothesis is found to be valid by several independent but similar experiments, such a hypothesis becomes a theory.
Formulation and testing of hypotheses (via experiments) represent two of the key steps in the scientific method.
The correct option is A.
Nitrates are converted into (which is simply released into the atmosphere) during a process known as
Answer:
nitrogen gas, dentrification
Explanation:
APES class
Nitrates are the compounds that are converted back into the atmospheric nitrogen and the process is called as denitrification. The atmospheric nitrogen is given back to atmosphere and the composition of nitrogen is the most highest in the atmosphere.
What is the composition of atmospheric nitrogen in atmosphere ?The atmospheric nitrogen is the highest amount in the atmosphere that is 78% where the nitrogen is present in different forms.
The process where the ammonia and the nitrates along with the nitrites are given back to the atmosphere via nitrification, ammonification and denitrification. There are certain bacteria in the atmosphere as well that fix the nitrogen.
Rhizobium and Nitrobacter are the bacteria that help to fix the nitrogen present in soil as well. Nitrogen fixing bacteria is present in the root nodules of gram plant.
Learn more about denitrification at :
https://brainly.com/question/13624886
#SPJ2
A(n) ______________________ is another name for a living thing.
Answer:
Animalia
Explanation:
What would happen if cooked potatoes were used in osmosis experiment?
The mechanical advantage of a steering wheel is 15. If the radius of the steering column (axle) is 5 cm, what is the radius of the
steering wheel?
Answer:
This is a math question not a biology question
Name the 4 phase of the Mitosis phase:
Answer:
prophase, metaphase, anaphase and telophase
Explanation:
The cell membrane pinches in and eventually divides into two daughter cells.
What system sends signals through the whole body?
Answer:
Nervous System
Explanation:
The nervous system works to send signals throughout the body. The Nervous System: Doctors estimate that every person has about 100 billion neurons in their brain, which are responsible for sending and receiving messages.
A cactus plant, a snake, and a hawk can be members of the same
A- community
B- kingdom
C- population
D- species
A cactus plant, a snake, and a hawk can be members of the same called community.
What is community ecology?Community ecology is an expanding and wealthy subfield of ecology. Ecologists examine the factors that impact biodiversity, community system, and the disbandment and surplus of species.
These characteristics include relations with the abiotic world and the diverse array of interactions that occur between species.
Thus, a cactus plant, a snake, and a hawk can be members of the same called community.
To learn more about the community click here:
https://brainly.com/question/18100115
How did Franklin's X-ray photograph affect the work of watson
and crick?
Answer:
Franklin took Photo 51 after scientists confirmed that DNA contained genes. Maurice Wilkins, Franklin´s colleague showed James Watson and Francis Crick Photo 51 without Franklin´s knowledge. Watson and Crick used that image to develop their structural model of DNA.
Explanation:I took that but if ya read it you will know what it is trust me.
uhm i have 5 questions due in an hour so please help. It's 45 points and they're all abt biology btw~
Answer:
the point of science is to disprove hypothesis so having a hypothesis that doesn't allow that to happen is not good science
2. they don't fit in our mouths so are a trait from when we had larger jaws
3. bones of your lower jaw, middle ear and voice box (they aren't actually gills fyi, they just look like them)
4. likely yes as their bones were hollow but likely only able to fly short distances, the thought was that they couldn't do their size and weight but with hollow bones they were able to like a quail would
5. no because they could be sister taxa, you would have a hard time proving exactly that this new fossil is the common ancestor that birds came from to replace the old hypothesis (guess) of which one did.
Explanation:
Answer:
A: It is wrong to form a theory that cannot be disproven because the whole point of a theory is to test the theory and prove it.
B: Wisdom Teeth are considered to be a vestigial trait because it is passed along in genetics of humans and is a almost a 100% chance of occurrence.
C: This bird could fly because fossils and research has shown that this creature had similar bone structure to a common day bird.
D: This does not invalidate evolution because many geographic events can happen that may alter the positioning of these fossils like: Any type of corrosion or weathering, or maybe ancient civilization have dug up these fossils and then they were reburied.
Explanation:
For C you can look up archaeopteryx and find an article for evidence
Choose the correct statements 1.Self-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant. 2.Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species. 3cross-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant. 4.Self-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species.
Answer: The correct statements are 1 and 2:
1.Self-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant.
2.Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species.
Explanation:
Pollination is the transfer of pollen grains from an anthers to a receptive stigma. In most species of flowering plants, external agents bring about pollination. Also, flowers have evolved special structures and mechanisms to ensure successful pollination.
There are two types of pollination
--> Self pollination: This takes place when mature pollen grains from the anther of a flower fall on the stigma of the same flower or that of another flower on the same plant. This type of pollination brings the male gametes and egg cells of the same plant together. The resultant offspring show very little genetic variation.
--> Cross pollination: This occurs when mature pollen grains of a flower are transferred to the stigma of a flower of another plant of the same or closely related species. This brings the male gametes and egg cells of two different parent plants together. Therefore, there is greater genetic variation among the offspring.
What is starch?
type of polysaccharide
a complex carbohydrate
both a & b
c
none of the above
Billions of molecules of Oxygen is attributed to Photosynthetic reactions.
True
False
PLEASE HELP
Answer:
False
Explanation:
you only need like 6 lol
Photosynthesis uses all of the following except
to make food.
carbon dioxide
O light energy
O chemical energy
water
is it’s A?
Answer:
No I think its C
Explanation:
Photosynthesis is a process that takes place due to water, sunlight, carbon dioxide and creates oxygen.
All the green plants carry out the process of photosynthesis in the presence of sunlight, the carbon dioxide, and water.
Thereby releasing oxygen and energy. The first organism that evolved to make photosynthesis was the blue-green algae and later on, cyanobacteria evolved which lead to the origin of oxygen on the earth.Thus the photosynthesis is a process that results when all three are processes by the plants.Giving out the chemical energy in the form of sugar and air to breathe. Hence the correct option is C.
Learn more about the Photosynthesis uses all of the following except.
brainly.com/question/21413948.
Loss of voluntary control over urination is called
O dialysis
O incontinence
O neurogenic bladder
O urgency
Previous
What is limiting the rate of photosynthesis at point A?
please help me out
Answer:
The factor which is working at the lowest level will usually be the limiting factor of the process. There are several limiting factors which can reduce the rate of photosynthesis , eg temperature, light intensity and carbon dioxide concentration.transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC
Answer:
RNA: UACGCUUUACGAGACCCAAUC
Explanation:
During transcription, a specific DNA sequence is used as template to synthesize a specific RNA sequence, usually a messenger RNA (mRNA). During this process (transcription), Uracil (U) bases replace Thymine (T) bases. Transcription has three stages: initiation, elongation and termination. Subsequently, the resulting mRNA is used to synthesize a protein, in a process known as translation.
Answer:
RNA: UACGCUUUACGAGACCCAAUC
Explanation: