Drag the dot to plot (-5, -9), and then select its location on the coordinate plane.

Answers

Answer 1
Hope this helps!!!!!!!!
Drag The Dot To Plot (-5, -9), And Then Select Its Location On The Coordinate Plane.

Related Questions

In circle O, the length of radius OL is 6 cm and the length of arc LM is 6.3 cm. The measure of angle MON is 75°

Answers

Answer:

14.2cm

Step-by-step explanation:

Complete question:

In circle O, the length of radius OL is 6 cm and the length of arc LM is 6.3 cm. The measure of angle MON is 75°.  

Rounded to the nearest tenth of a centimeter, what is the length of arc LMN?  

Find the diagram attached

arc LN= arc  LM + arc MN

First we need to get the arc MN

length of an arc = theta/360 * 2πr

length of arc MN = 75/360 * 2(3.14)(6)

length of arc MN = 0.20833*37.68

length of arc MN = 7.85

Hence;

arc LN = 6.3 + 7.85

arc LN = 14.15cm

Hence the length of arc LN is 14.2cm

Andrew's bus pass has $35 on it. Each time he rides the bus $1.50 is deducted from his card.
How many times can he ride the bus before he ends up with only $5 left

Answers

Answer:

He can ride the bus 20 times

Step-by-step explanation:

35-5=30

3=2x1.5

mental gymnastics helped me lol

What is the area 38cm 16cm 20cm 18cm​

Answers

Just need to sub numbers into the formula

I need help fast!!!!!!​

Answers

Answer:

Z= 180 X = 95   y= 147

Step-by-step explanation:

Z=180 because it is a line and when it is a line it = 180 degrees

for X you want to first find the angle of the other triangle and when you do you subtract that # from 180 because those 2 angles make a line

to find that angle next to X is...

180- (the other 2 angles in the triangle)

180- 45- 50

180-95

85 degrees

now do

180-85

95 degrees   -- this is what X =

now you want to find the angle that is left in one triangle

so do

180- 95- 52

180- 147

33 degrees -- the angle that was missing

to find Y do...

180- 33

147 degrees -- this is what Y =

Please help me
If you give me a good answer I will award brainiest

Answers

Answer:

integer

Step-by-step explanation:

it is an integer

It’s an Integer




Because it’s an integer

Hal put $3000 into a savings account that earns 6% interest. After 6 years, what will be the total amount of money in his savings account?

Explain for BRAINLIST.

Answers

108,000 is the answer

Please help I'll mark brainliest

Answers

Answer:

y= 3x +2

Step-by-step explanation:

-10x-30y = 6

-30y = 10x +6

y = -1/3x - 1/5

m = -1/3 perpendicular slope would be 3

2x+9y = 18

2(0) +9y = 18

y = 2 = y intercept

y = 3x +2

The perimeter of an equilateral triangle is 60 centimeters. The length of the altitude of the triangle is XV3 centimeters. What is the value of x? ​

Answers

9514 1404 393

Answer:

  x = 10

Step-by-step explanation:

Half of the triangle makes a 30°-60°-90° "special" triangle. We know the side ratios of that are 1 : √3 : 2. The long side is 1/3 of the perimeter, so is 60/3 = 20 = 10×2. Then the altitude is 10 times the middle ratio value: 10√3 ≈ 17.32.

Comparing this with x√3, we find x = 10.

Answer:

X = 25

Step-by-step explanation:

To solve this question, we'll first of all find determine the side length of the triangle from the perimeter.

Perimeter of an equilaterial triangle = 3 * s

S = side length

Perimeter = 150cm

150 = 3s

S = 150 / 3

S = 50cm

The side lengths are 50cm each since they are all equal.

To find x,

We have to divide the triangle equally into two different part.

Check the first attachment for better illustration on how the equilaterial triangle is.

Check the second attachment for better illustration on the triangle when its divided into a right angle triangle.

From the right angle triangle, we can use pythagorean theorem to solve for x

a² = b² + c²

a = 50cm

b = 25cm

c = x√(3)

50² = [x√(3)]² + 25²

2500 = x² * 3 + 625

2500 - 625 = 3x²

1875 = 3x²

X² = 1875 / 3

X² = 625

X = √(625)

X = 25

HOPE THIS HELPS

if so please give me a brainlist

Graph the linear equation
y=-5

Answers

Answer:

Answer in the picture: x = 1 | y = -5

Step-by-step explanation:

Not sure if that's the answer you're looking for but I think that's it

Your newer is in the image



What is the Mean , Median , Mode , Range for
9,6,7,5,3​

Answers

Answer:

the mean is 6

the median is 6

the mode there is none

the range is 6.

Answer:

There is no mode. (they all appear once)

The lowest number is 3 and the highest is 9, so the range is 6.

The mean is the average, add them all up (30) and divide by the number of data sets (5). The average is 6.

I have to go to dinner so maybe let someone else help with the median? The median is the middle, so you have to order them and find the middle. Hope it helped!

[tex]48 - 3x¨2[/tex]

Answers

Answer

= -78

Step-by-step explanation:

Not sure if i got this but i least i tried to help

please help i’m kinda stressed right now.

Answers

Answer:

17) G

18) J

19) F

20) A

hope this helps :)

HELP
At school, the maximum number of students that can be in a classroom is 26. If there are 16
students signed up for the spanish class, how many more students can join the class?
What are the solutions? Select the correct choice below and fill in the answer box to complete your
choice.
O A. The number of students that can join the class is at least
• B. The number of students that can join the class is at most
10
1.
(0,0)
More
Click to select and enter your answer(s) and then click Check Answer
Clear All
Check Answer
All parts showing
Question
Review progress
Back
5
of 9
Next →

Answers

Answer:

at school in my country the maximum number can be from 200 to 45 that can be in one class room

How do I solve?

5sin^2x-4sinx-1=0

Answers

Answer:

Step-by-step explanation:

5sin^2x-4sinx-1=0

Please help me? I am confused.​

Answers

Answer:

It's a photo of the problem. It's not a spam. Just so you could be sure. ;-)

Have a good day

Answer:

x=4

Step-by-step explanation:

7-2x=2(x-4)-1

7-2x=2x-8-1

7-2x=2x-9

-2x on both sides which makes

7-4x=-9

-7 on both sides which makes

-4x=-16

divide both sides by -4 and

x=4

pls help me I have no idea what I'm doing​

Answers

Answer:

3.2mm ^3

Step-by-step explanation:

First find the scale factor to get the height of the smaller figure

SF= 1/5 or 0.2

Then use the Volume equation for triangular pyramid 1/3*(base area)*(height)

Your equation should look like this:

1/3 (4)(2.4)

9.6/3

Volume= 3.2 mm ^3

Please help! If you do you will get 'Brainliest'

Answers

Answer:

B

Step-by-step explanation:

This is because 1/2 down from 1 1/2 is 1 then go 2 down on the number lone and you get 1 (B)

Answer:

your answer is D.

Step-by-step explanation:

if you go 2 numbers to the right you get 3 and now the half would go in between 3 which would make your answer 3 and one half.

A triangle has angle measuring 40 and a right angle. what is the measurement of the triangle's third angle?

Answers

Answer:

50 degrees

Step-by-step explanation:

Three of the flowers in the bouquet are lilies. There are a dozen flowers total. What percent of the flowers were lilies?

Answers

Answer:

25%

Step-by-step explanation:

who here dose not like edg

Answers

Answer:

Step-by-step explanation:

i dont have edg but i use ap'ex and i hate it so much

Answer:

MEE I am so behind. Latterly why do they give us so many lessons a day. I am just doing well I am online. I can't what until I go back to my normal school

Step-by-step explanation:

Please! Need help on this question

Answers

Answer: D and E

the answers is between 1 and 2 so A is out

the dot is a little more than halfway so B and C are out

D and E are left :)

Answer:

D E

Step-by-step explanation:

Help help help help help

Answers

Answer:

The answer is 4

Step-by-step explanation:

What is the relationship between ratios and rates?

Answers

Answer:

The relation ship between ration and rates is they compare numbers

Step-by-step explanation:

Please give brainliest

Answer:

Ratio is comparing 2 things like apples to oranges and rates is how much is it like a percentage for example there is 4% oranges.

Step-by-step explanation:

Need help with number 6 please.

Answers

Answer: D

Step-by-step explanation:

36.20/10= 3.62

3.62x7= 25.34

$25.34

please help and no files please

Answers

B hope this helps :)

NO LINKS PLEASE! 3-6

Answers

Answer:

3. 52(1).93 + (7).1

4. (0).31 + (5)

5. (8).01 + 2(3).8

6. (3) + (9).62

In the figure to the right, if AC = 21 and BC = 18, what is the
radius?

Answers

Triangle is missing, so i have attached it.

Answer:

Radius = 10.82

Step-by-step explanation:

From the image attached, the triangle is obviously a right angle triangle and therefore, the missing side (AB) which is the radius can be found via pythagoras theorem.

We are given;

AC = 21

BC = 18

Thus;

|AC|² = |AB|² + |BC|²

21² = |AB|² + 18²

|AB|² = 441 - 324

AB = √117

AB = 10.82

Answer: The answer is 10.8    mathxl/pearson2022

Hurry Please!!!!!
When a rectangle is cut diagonally, two congruent right triangles are formed. Which expression shows how to use the area of the rectangle to find the area of one of the right triangles?

Answers

Don’t use his link! It’s a fake website to get you a virus

In a survey taken 6/10 of students chose to attend in person learning on Mondays. 3/10 of students chose Tuesdays. How many students chose Monday or Tuesday?

Answers

Answer:

9/10 students chose Monday or Tuesday.

or

90% of students chose Monday or Tuesday

Explanation:

We add both fractions 6/10 + 3/10 which equals 9/10

A skateboard ramp at a park has an inclination of 54º and its base is 12 feet long. What is the length of the ramp?​

Answers

The length of the skateboard ramp at the park is 20.4 feet.

Trigonometric ratio

Trigonometric ratio is used to show the relationship between the sides and angles of a right angled triangle.

Let x represent the length of the ramp, hence using trigonometric ratio:

cos(54) = 12/x

x = 12/cos(54)

x = 20.4 feet

The length of the skateboard ramp at the park is 20.4 feet.

Find out more on trigonometric ratio at: https://brainly.com/question/4326804

Other Questions
7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.