Does anybody else have an answer for the digestive system and urinary and excretory system working together to maintain homeostasis.

Answers

Answer 1

Answer:

Nono

Explanation:

No I don’t know why but mine answer is no


Related Questions

What would happen if cooked potatoes were used in osmosis experiment?

Answers

The potatoes would fill up with water. Osmosis is diffusion but with water. It always moves from the hypotonic (less solute) region to hypertonic (more solute). Good luck!

Which property of metals allows them to be used to make coins that have the same thickness

Answers

Answer:

malleability

Explanation:

ce caps

What property of metals allows it to make coins the same thickness?2 malleability

A chemical reaction produces two new substances, and each product has a mass of 25 grams. What was the total mass of the reactants?3 50 gram

the answer is malleability

Choose the correct statements 1.Self-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant. 2.Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species. 3cross-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant. 4.Self-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species.

Answers

Answer: The correct statements are 1 and 2:

1.Self-pollination occurs when the pollen from the anther is deposited on the stigma of the same flower, or another flower on the same plant.

2.Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different individual of the same species.

Explanation:

Pollination is the transfer of pollen grains from an anthers to a receptive stigma. In most species of flowering plants, external agents bring about pollination. Also, flowers have evolved special structures and mechanisms to ensure successful pollination.

There are two types of pollination

--> Self pollination: This takes place when mature pollen grains from the anther of a flower fall on the stigma of the same flower or that of another flower on the same plant. This type of pollination brings the male gametes and egg cells of the same plant together. The resultant offspring show very little genetic variation.

--> Cross pollination: This occurs when mature pollen grains of a flower are transferred to the stigma of a flower of another plant of the same or closely related species. This brings the male gametes and egg cells of two different parent plants together. Therefore, there is greater genetic variation among the offspring.

A cactus plant, a snake, and a hawk can be members of the same

A- community
B- kingdom
C- population
D- species

Answers

i think it would be a-community

A cactus plant, a snake, and a hawk can be members of the same called community.

What is community ecology?

Community ecology is an expanding and wealthy subfield of ecology. Ecologists examine the factors that impact biodiversity, community system, and the disbandment and surplus of species.

These characteristics include relations with the abiotic world and the diverse array of interactions that occur between species.

Thus, a cactus plant, a snake, and a hawk can be members of the same called community.

To learn more about the community click here:

https://brainly.com/question/18100115


Why didn't people know about germs or microbes before the mid-1800s?

Answers

Answer:

Explanation:

the germ theory explains why they might not have known

A(n) ______________________ is another name for a living thing.

Answers

Answer:

Animalia

Explanation:

Nitrates are converted into (which is simply released into the atmosphere) during a process known as

Answers

Answer:

nitrogen gas, dentrification

Explanation:

APES class

Nitrates are the compounds that are converted back into the atmospheric nitrogen and the process is called as denitrification. The atmospheric nitrogen is given back to atmosphere and the composition of nitrogen is the most highest in the atmosphere.

What is the composition of atmospheric nitrogen in atmosphere ?

The atmospheric nitrogen is the highest amount in the atmosphere that  is 78% where the nitrogen is present in different forms.

The process where the ammonia and the nitrates along with the nitrites are given back to the atmosphere via nitrification, ammonification and denitrification. There are certain bacteria in the atmosphere as well that fix the nitrogen.

Rhizobium and Nitrobacter are the bacteria that help to fix the nitrogen present in soil as well. Nitrogen fixing bacteria is present in the root nodules of gram plant.

Learn more about denitrification at :

https://brainly.com/question/13624886

#SPJ2

uhm i have 5 questions due in an hour so please help. It's 45 points and they're all abt biology btw~

Answers

Answer:

the point of science is to disprove hypothesis so having a hypothesis that doesn't allow that to happen is not good science

2. they don't fit in our mouths so are a trait from when we had larger jaws

3. bones of your lower jaw, middle ear and voice box (they aren't actually gills fyi, they just look like them)

4. likely yes as their bones were hollow but likely only able to fly short distances, the thought was that they couldn't do their size and weight but with hollow bones they were able to like a quail would

5. no because they could be sister taxa, you would have a hard time proving exactly that this new fossil is the common ancestor that birds came from to replace the old hypothesis (guess) of which one did.

Explanation:

Answer:

A: It is wrong to form a theory that cannot be disproven because the whole point of a theory is to test the theory and prove it.

B: Wisdom Teeth are considered to be a vestigial trait because it is passed along in genetics of humans and is a almost a 100% chance of occurrence.

C: This bird could fly because fossils and research has shown that this creature had similar bone structure to a common day bird.

D: This does not invalidate evolution because many geographic events can happen that may alter the positioning of these fossils like: Any type of corrosion or weathering, or maybe ancient civilization have dug up these fossils and then they were reburied.

Explanation:

For C you can look up archaeopteryx and find an article for evidence

How does the development of a bluebird compare to that of a frog?

Answers

Answer:

Explanation:

Frogs:

Frog's evolutionary pathway resembles the water cycle. This is quite fitting, because all frogs statistically enjoy bodies of water. Seafrogs absorb salt-water through holes, which emit inside the snout. First, they grow two limbs, or legs, to swim. These turn into fins, which, eventually, allow for hopping and balancing-capacity. Capabilities, include: tongue-roll, sticky toes, bubbly neck, multi-eggs, and more

Frogs are incredibl(y) mammalian(s)!

Which of the following molecules are produced during transcription? (3 points)

Messenger RNA
Ribozymes
Ribosomal proteins

I only
I and II only
II only
I, II, and III

Answers

Answer:

1. and 2. only

Explanation:

rRNA is sometimes called a ribozyme or catalytic RNA.

Molecules of rRNA are synthesized in a specialized region of the cell nucleus called the nucleolus, which appears as a dense area within the nucleus and contains the genes that encode rRNA.

mRNA is Messenger RNA which are synthesized during DNA transcription as templates for the production of a specific proteins.

The molecules are produced during transcription are - Messenger RNA and Ribozymes that is - I and II only.

Transcription is the first step in decoding a cell's genetic information. During transcription, enzymes called RNA polymerases build RNA molecules that are complementary to a portion of one strand of the DNA double helix

the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA)carried out by an enzyme called RNA polymeraseproduces a number of accessory proteins called transcription factors.Ribozymes are catalytic RNA molecules. They have the intrinsic ability to break and form covalent bonds in RNA molecules

thus, The molecules are produced during transcription are - Messenger RNA and Ribozymes that is - I and II only.

Learn more about transcription:

https://brainly.com/question/11430054

transcribe the following DNA sequence to RNA use no spaces in your answer and use all caps. DNA:TACGCTTTACGAGACCCAATC

Answers

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

During transcription, a specific DNA sequence is used as template to synthesize a specific RNA sequence, usually a messenger RNA (mRNA). During this process (transcription), Uracil (U) bases replace Thymine (T) bases. Transcription has three stages: initiation, elongation and termination. Subsequently, the resulting mRNA is used to synthesize a protein, in a process known as translation.

Answer:

RNA: UACGCUUUACGAGACCCAAUC

Explanation:

Write the name of the nitrogenous base that joins to each of the bases

Answers

Answer:

Hydrogen bond

Explanation: Pretty much just a type chemical bond

Name the 4 phase of the Mitosis phase:

Answers

Answer:

prophase, metaphase, anaphase and telophase

Explanation:

The cell membrane pinches in and eventually divides into two daughter cells.

What is starch?
type of polysaccharide
a complex carbohydrate
both a & b
c
none of the above

Answers

A complex carbohydrate
A type of polysaccharide carbohydrate

The molecules of life are all carbon-based.
True
False

Answers

Answer:

All life we know of on Earth is mostly based on molecules containing the element carbon.

True.

Explanation:

Which explains why it is important to eat a full healthy meal before an aftemoon of playing sports? Food provides the carbon dioxide that is a product of cellular respiration? Food provides the oxygen that is a product of cellular respiration? Food provides the glucose that is a reactant in cellular respiration. Food provides the energy that is a reactant in cellular respiration?​

Answers

Answer:

Food provides the glucose that is a reactant in cellular respiration.

What is a characteristic of Antarctic Bottom Water?

a. Extremely high density
b. Southward movement toward Antarctica along the seafloor
c. Formation near the Mediterranean north of Africa
d. Extremely low density
e. Fast movement

Answers

A. Extremely high density

What system sends signals through the whole body?

Answers

The nervous system
Ghcyjfkcgbrhjh

Answer:

Nervous System

Explanation:

The nervous system works to send signals throughout the body. The Nervous System: Doctors estimate that every person has about 100 billion neurons in their brain, which are responsible for sending and receiving messages.

Billions of molecules of Oxygen is attributed to Photosynthetic reactions.
True
False
PLEASE HELP

Answers

Answer:

False

Explanation:

you only need like 6 lol

How did Franklin's X-ray photograph affect the work of watson
and crick?

Answers

Answer:

Franklin took Photo 51 after scientists confirmed that DNA contained genes. Maurice Wilkins, Franklin´s colleague showed James Watson and Francis Crick Photo 51 without Franklin´s knowledge. Watson and Crick used that image to develop their structural model of DNA.

Explanation:I took that but if ya read it you will know what it is trust me.


The mechanical advantage of a steering wheel is 15. If the radius of the steering column (axle) is 5 cm, what is the radius of the
steering wheel?

Answers

Answer:

This is a math question not a biology question

HELP i need to create a story about cells and their functions the organelles are Cell membrane

Cell wall

Nucleus

Chloroplasts

Mitochondria

Vacuoles
im in 7th grade

Answers

Answer:

More than 8.7 million species are living on the planet. Every single species is composed of a cell and it includes both single-celled and multicellular organisms.

The cells provide shape, structure and carries out different types of functions to keep the entire system active. The cell contains different functional structures which are collectively called Organelles, and they are involved in various cellular functions.

Also Read: Difference between organ and organelle

Let us learn more in detail about the different types and functions of Cell Organelles.

Table of Contents

What are Cell Organelles?

List of Cell Organelles and their Functions

Plasma Membrane

Cytoplasm

Nucleus

Endoplasmic Reticulum

Mitochondria

Plastids

Ribosomes

Golgi Apparatus

Microbodies

Cytoskeleton

Cilia and Flagella

Centrosome and Centrioles

Vacuoles

A Brief Summary on Cell Organelles

The number of chromosomes is DOUBLED after mitosis. True or False, AND explain.

PLEASE HELP IT'S DUE TODAY!!!!

Answers

Answer:

False

Explanation:

The number of chromosomes is doubled during mitosis, but each daughter cell (new cell) has the same number as the mother (original cell)

Mitosis is a cell division cycle in which the parent cell divides to produce equivalent daughter cells. It can occur in the body for growth, replacing dead cells etc.

The statement is False.

The sentence can be explained as:

Mitosis is a function of division in cells in which the two exact daughter cells are produced from the parent cell division of the nucleus and cytoplasm.

The parent cells undergo the doubling of the hereditary content by the process of central dogma during the synthesis stage.

The parent and daughter cell is diploid during this sort of cycle and does not get halved or duplicated at the end of the cycle.

Therefore, chromosomes do not get doubled at the end of the division.

To learn more about mitosis follow the link:

https://brainly.com/question/17364997

What is limiting the rate of photosynthesis at point A?

please help me out

Answers

Answer:

The factor which is working at the lowest level will usually be the limiting factor of the process. There are several limiting factors which can reduce the rate of photosynthesis , eg temperature, light intensity and carbon dioxide concentration.

Photosynthesis uses all of the following except
to make food.
carbon dioxide
O light energy
O chemical energy
water


is it’s A?

Answers

Answer:

No I think its C

Explanation:

Photosynthesis is a process that takes place due to water, sunlight, carbon dioxide and creates oxygen.

All the green plants carry out the process of photosynthesis in the presence of sunlight, the carbon dioxide, and water.  

Thereby releasing oxygen and energy. The first organism that evolved to make photosynthesis was the blue-green algae and later on, cyanobacteria evolved which lead to the origin of oxygen on the earth.Thus the photosynthesis is a process that results when all three are processes by the plants.  

Giving out the chemical energy in the form of sugar and air to breathe. Hence the correct option is C.

Learn more about the Photosynthesis uses all of the following except.

brainly.com/question/21413948.

What would be the end result if an
experiment supports a hypothesis and
has been repeated?
A. developing a theory
B. redoing the hypothesis
C. graphing the data a different way
D. setting up another experiment based on the same
hypothesis

Answers

Answer:

A

Explanation:

The end result of repeated experiments supporting a hypothesis is for the hypothesis to become a theory.

In science, a hypothesis is a general statement that needs to be validated or invalidated by experiments. Once a hypothesis is found to be valid by several independent but similar experiments, such a hypothesis becomes a theory.

Formulation and testing of hypotheses (via experiments) represent two of the key steps in the scientific method.

The correct option is A.

Which example is the best description of an adaptation?

a heritable characteristic that evolves

a heritable characteristic that helps an organism find food

a heritable characteristic that helps an organism survive and reproduce

a heritable characteristic that helps an organism avoid predators

Answers

Answer:

a heritable characteristic that evolves

Explanation:

The best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.

What is an adaptation?

An adaptation is a feature or characteristic of an organism that helps it to be able to survive in its environment.

Adaptations are important to an organism in order for it to grow and reproduce in its environment.

For example, polar bears have thick furs to enable rhem survive the cold environment of the polar regions.

Therefore, the best description of an adaptation is that it is a heritable characteristic that helps an organism survive and reproduce.

Learn more about adaptation at: https://brainly.com/question/29594

Loss of voluntary control over urination is called
O dialysis
O incontinence
O neurogenic bladder
O urgency
Previous

Answers

The answer would be B...incontinence!
Incontinence is the answer

4. a) Name one-way lactic acid fermentation and alcohol fermentation are similar.

Answers

One way there both similar is that they both happen under a anaerobic conditions and produce a little amount of ATP

What is an evolution in general?

Answers

Answer: A evolution is a process in which someone/something upgrades over the course of time. It usually leads to improvement in lifestyle of that species/thing.

Explanation:

The change in organisms over time:)
Other Questions
what is verbal and non verbal communication with examples plz help i will mark brilliant Catherine inherited a lot of money and decided to start a business. She has purchased a building, bought tools and machinery, and hired employees. Her main problem is that she has no business experience, no ideas, and no experience creating products. Which category of economic resource does she require?A. laborB. entrepreneurial abilityC. landD. capital Create a question by reordering the elements Which group was persecuted during the Holocaust for religious and political reasons? RomaIntelligensiaJehovah's WitnessesCommunists john is my brother. Simon is my brother join sentences using both How do I solve it? Please help............... help due in 15 mins:( If f(1) = 9 and f(n) = 4f(n 1) then find the value of f(4). Can someone explain how to solve and find x on the triangle Plsssssssss Help!!!Look at the map. How might the Gupta empire have been able to flourish through trade? Identify geographic features to support your answer. need help on this one please Use properties of operations to determine whether 4r + 4t and 4(r+t) are equivalent. Explain your answer. How could this document help you argue for abolishing the Electoral College? The number of chromosomes is DOUBLED after mitosis. True or False, AND explain.PLEASE HELP IT'S DUE TODAY!!!! 4x -2y = 16 solve for y=mx+b 50 POINTS AND BRAINLIESTI need to know the steps for solving this. I know the answer is no solution but i don't understand the steps. Please help!!! Thee are 6 classes of students going to the school picnic. Each class has 26 students Rosies mother is buying paper plates for the picnic paper plates are sold in packs of 8 what is the least number of packs that Rosies mother should buy so that each student has 1 paper plate For my friend or anyone else The diagram below shows the different phase transitions that occur in matter.Solid3Liquid16GasWhich arrow represents the transition in which dew is formed?1O246 Which group of officials is responsible for all appointed positions within county government?A.the city clerksB.the advisory boardC.board of supervisorsD.town mayors, state governor, and state representativesPlease select the best answer from the choices providedABCD