To investigate the lowest possible effective dose to use against a particular strain of bacteria, the following steps could be taken:
Collect bacterial strainsAntibiotic sensitivity testingTest different dosesObserve bacterial growthDetermine minimum effective doseAnalyze dataDraw conclusionsHow to carryout dose samples?Collect bacterial strains: Obtain bacterial strains that are known to be resistant to antibiotics and test them in a laboratory setting.
Antibiotic sensitivity testing: Perform an antibiotic sensitivity test to determine the susceptibility of the bacterial strains to different antibiotics.
Test different doses: Test different doses of the antibiotics that showed activity against the bacterial strains in step 2. Use a range of doses, from the minimum to the maximum recommended dose, to determine the lowest dose that is effective against the bacterial strains.
Observe bacterial growth: Observe bacterial growth over time to determine whether the bacteria are being killed or inhibited at each dose level.
Determine minimum effective dose: Determine the minimum effective dose that inhibits bacterial growth for each bacterial strain tested.
Analyze data: Analyze the data collected from the tests to determine the lowest possible effective dose of the antibiotic for each bacterial strain.
Draw conclusions: Draw conclusions about the lowest possible effective dose of the antibiotic that could be used to treat the particular strain of bacteria.
Learn more on antibiotics here: https://brainly.com/question/11849121
#SPJ1
How does horizontal gene transfer differ from vertical gene transfer?
Answer:
the acquisition of genetic material from an ancestor.
Explanation:
hope this helps
Identify 3 imaging technologies that are used to determine the structure of plants. For
one of these technologies, briefly outline its use.
Answer:
Abstract
Given the rapid development of plant genomic technologies, a lack of access to plant phenotyping capabilities limits our ability to dissect the genetics of quantitative traits. Effective, high-throughput phenotyping platforms have recently been developed to solve this problem. In high-throughput phenotyping platforms, a variety of imaging methodologies are being used to collect data for quantitative studies of complex traits related to the growth, yield and adaptation to biotic or abiotic stress (disease, insects, drought and salinity). These imaging techniques include visible imaging (machine vision), imaging spectroscopy (multispectral and hyperspectral remote sensing), thermal infrared imaging, fluorescence imaging, 3D imaging and tomographic imaging (MRT, PET and CT). This paper presents a brief review on these imaging techniques and their applications in plant phenotyping. The features used to apply these imaging techniques to plant phenotyping are described and discussed in this review.
Keywords: phenotyping phenotype, fluorescence imaging, thermal infrared imaging, visible light imaging, imaging spectroscopy, three dimensional imaging
1. Introduction
To ensure that crop production is sufficient to satisfy the needs of a human population that is expected to grow to more than 9 billion by 2050 is a tremendous challenge for plant science and crop improvement [1]. This goal is challenging primarily because the average rate of crop production increase is only 1.3% per year, and it cannot keep pace with population growth. By connecting the genotype to the phenotype, high yielding, stress-tolerant plants can be selected far more rapidly and efficiently than is currently possible. Advances in techniques such as next generation DNA sequencing can be made available to breeders to provide potential increases in the rate of genetic improvement by molecular breeding [2]. However, the lack of access to phenotyping capabilities limits our ability to dissect the genetics of quantitative traits related to growth, yield and adaptation to stress. Plant breeders and farmers were making selections based on phenotypes long before the discovery of DNA and molecular markers. To identify the best genetic variation, the more crosses and environments that are used for selection, the greater the probability of identifying a superior variation. To meet future requirements, there is a need to increase breeding efficiency. Advances in high throughput genotyping have offered fast and inexpensive genomic information and paved the way for the development of large mapping populations and diversity panels of thousands of recombinant inbred lines for phenotyping [3]. Although molecular breeding strategies have placed greater focus on selections based on genotypic information, they still require the following phenotypic data [4]: (1) phenotypes are used for selection and to train a prediction model in genomic selection; (2) a single phenotyping cycle is used to identify markers for subsequent selection through generations within the maker-assisted recurrent selection [5]; and (3) phenotyping is necessary to identify promising events in transgenic studies [6]. Phenotyping advances are essential for capitalizing on developments in conventional, molecular, and transgenic breeding.
Explanation:
COMMUNITY
Define:
Describe interactions:
Examples of interactions:
Answer:
a group of people living in the same place or having a particular characteristic in common.
"the scientific community"
Explanation:
a forest of trees and undergrowth plants, inhabited by animals and rooted in soil containing bacteria and fungi
What did Malala's dad mean when he said, "It's a good thing to come in second." (Ch. 5)
A: Winning all the time can make kids not want
to play with you.
B: No one is perfect.
C: You should learn to be a good loser, not just
a good winner.
D: It is good to sometimes let others win.
Answer:
Based on the context provided, Malala's dad likely meant that "It's a good thing to come in second" because "You should learn to be a good loser, not just a good winner."
Unit 9 Study Guide - The Restless Earth Science. I NEED ANSWERS ASAP!!!!!!! PLEASE ANSWER!!! PLEASE HURRY!!!! PLEASE ANSWER ALL 21!!!! THERE ARE 21 QUESTIONS PLEASE ANSWER THEM ALL AS SOON AS YOU CAN!!!!!!!!!!!!!!!!!
The image is a graph showing the trend of global temperatures over the past century, based on data collected from various sources. The graph indicates that global temperatures have been steadily rising since the 1900s, with the past few decades showing a particularly sharp increase.
What is the graph's primary trend?The main trend shown in the graph is the steady increase in global temperatures over the past century, with a particularly sharp increase in the past few decades. This trend is a cause for concern as it indicates that the Earth's climate is changing at an unprecedented rate.
What factors contribute to the increase in global temperatures?The increase in global temperatures is primarily caused by human activities that release greenhouse gases, such as carbon dioxide, into the atmosphere.
These gases trap heat from the sun, leading to a warming effect on the Earth's surface. Other factors that contribute to the increase in global temperatures include deforestation, industrial activities, and transportation.
To know more about global temperatures,visit:
https://brainly.com/question/9089155
#SPJ1
Describe four different types of drugs and their impact on sports performance
Evaluate the impact of four different performance-enhancing drugs on performance in four different types of sport
Discuss, using relevant examples, why some individuals may resort to using performance-enhancing drugs in sport
Finish the statement. Differences in temperature cause movement of air. This sinking of cold air and rising of warm air is the way heat moves in Solids Convection Evaporation Radiation
In dragons, blue horns
(B) are dominant to
yellow horns (b).
What percent of these
offspring would have
yellow horns?
50%
75%
0%
25%
The answer is 25 percent
What is speciation? Describe the three things required.
Speciation is the evolutionary process by which new species arise from existing ones.
What is speciation?Speciation occurs when a group of organisms becomes reproductively isolated from the rest of their population, preventing gene flow between the two groups.
There are three key requirements for speciation to occur:
Genetic isolation: This occurs when a group of individuals becomes separated from the rest of their population, either geographically or ecologically, and is prevented from interbreeding with them. This can lead to the accumulation of genetic differences between the two groups.
Genetic divergence: Once genetic isolation occurs, the two populations can begin to evolve separately. This can happen as a result of genetic drift, natural selection, or other evolutionary mechanisms, leading to the accumulation of genetic differences between the two groups.
Reproductive isolation: Over time, the genetic differences between the two groups may become so pronounced that members of the two populations are no longer able to interbreed successfully, even if they are brought back into contact with one another.
Learn more about speciation at: https://brainly.com/question/2113835
#SPJ1
Why did Darwin compare his theory of natural selection to Copernicus's theory that Earth orbited the Sun?
The heliocentric theory of the cosmos, developed by Copernicus's theory, moved humans away from the actual centre of the universe. A theory of evolution was created by Charles Darwin.
What parallels exist between the Copernican and Darwinian revolutions?It is possible to think of the Copernican and Darwinian Revolutions as the two phases of a single Scientific Revolution. Together, they marked the beginning of science in the contemporary sense: the study of natural laws as explanations.
What distinguishes Darwin's theory of evolution from the concept of natural selection?According to the Darwinian Theory of Evolution, natural selection, which drives evolution, is skewed by the traits that organisms inherit from their ancestors. The capacity for adaptation is what aids organisms in natural selection-based evolution.
To know more about Copernicus's theory visit :-
https://brainly.com/question/22477117
#SPJ1
Circle the correct words to complete the sentences.
• Human insulin is now made with a biotechnology called [genetic
engineering/selective breeding].
• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell.
•After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin.
Answer:
Human insulin is now made with a biotechnology called [genetic engineering/selective breeding]. (Genetic engineering)
• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell. (Copy, a bacterial)
• After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin. (bacterial, bioreactor)
-. Two genes-pointy-ness of chin and pointy-ness of nose-have the following
alleles: P = pointy chin, p = round chin, N = round nose, n = pointy nose. A man
with a pointy chin and pointy nose mates with a woman with a round chin and
ound nose and produces a child with a pointy chin and round nose. What are all
he possible genotypes for this child?
2. Inhumans, short fingers (F) and widow's peak (W) are dominant over long
ingers (f) and straight hairline (w). A heterozygote for both genes reproduces
with a similar heterozygote. What is the chance of any one child having the same
phenotype as the parents?
The possible genotypes for the child are: Pn and pn from the descriptions in the question.
What are the possible genes?To determine this, we can use a Punnett square. The man has the genotype PPnn (pointy chin and pointy nose), and the woman has the genotype ppNN (round chin and round nose).
The offspring genotype possibilities are PNn, PnN, Pnn, and pnn. However, we are told that the child has a pointy chin and a round nose, so the only possible genotypes for this phenotype are Pn and pn.
Therefore, the child could have the genotype Pn (pointy chin, round nose) or pn (round chin, pointy nose).
Learn more about genes:https://brainly.com/question/8832859
#SPJ1
What is the purpose of the digestive enzymes found in the synaptic cleft?
The synaptic cleft does not contain any digesting enzymes. Neurotransmitters are released into the synaptic cleft, a tiny space between neurons, to carry messages from one neuron to the next.
What function do enzymes serve in the synaptic cleft?Certain neurotransmitters are broken down by synaptic enzymes, which are found in the synaptic cleft. A synapse is the junction of two neurons where neurotransmitters carry information.
In the synaptic cleft, what enzyme is present?A type-B carboxylesterase enzyme called acetylcholinesterase is largely found in the synaptic cleft, with a minor amount being present in the extrajunctional region. The muscle secretes acetylcholinesterase, which is kept bound to it by collagen linked to the basal lamina.
To know more about synaptic cleft visit:-
https://brainly.com/question/6346282
#SPJ1
4. If one parent of a couple has Huntington's disease (assume that this parent is
heterozygous), calculate the fraction of their children that would be expected to
develop the disease. What if both parents were heterozygous?
If one parent of a couple has Huntington's disease , 50 percent of their children that would be expected to develop the disease if both parents were heterozygous.
What is Huntington's disease ?Huntington's disease is a brain condition in which brain cells, or neurons, in specific areas of the brain begin to degrade. As the neurons degenerate, the illness can cause hormonal disturbances, cognitive decline, and uncontrolled movements. Huntington's disease is a hereditary condition. It is handed down from generation to generation. If one of the parents has Huntington's disease, the child has a 50% risk of developing it as well. If the child does not contract the disease, he or she will not pass it on to their offspring. There is no family history of Huntington disease in 1% to 3% of individuals who have the disease.
What is heterozygous condition ?In genetics, heterozygous means having received different versions (alleles) of a genomic marker from each biological parent. As a result, a person who is heterozygous for a genomic marker has two distinct forms of that marker.
To know more about Huntington's disease , visit ;
brainly.com/question/12572808
#SPJ1
Which of the following is not a common reason why individuals or groups use the ocean to dump our garbage?
Companies opt to save money by using ocean dumping.
Governments have limited funds for proper garbage disposal.
Ocean waters increase the rate of decomposition of garbage.
Landfills or incineration are not possible for a town or city.
Answer: Ocean waters increase the rate of decomposition of garbage.
Explanation: I took the quiz
. Explain the reciprocal relationship the dolphins have with the fishermen in Laguna.
Answer:
Parasitism
Explanation:
One is benefit on the other hand the other is harmed
Dolphins are friendly animals to humans on the other hand humans can harm or torture dolphins by training them on force or kill them
Suggest why it is very difficult to eradicate an introduced species,
once it has settled into a new place.
Answer: This is because they might not have any predators or there NATURAL ENVIROMENT IS DIFFICULT to find or destroy
Explanation:
The basic unit of life is a cell. A student is studying for an exam comparing structure and functions of a plant cell and an animal cell. The student has to be able to identify the different organelles and the most likely location. Which type of proposed model would be best for the student to utilize in their studies and why?
A) The student should utilize a mathematical model comparing the percent of types of organelles in each so that they understand
the amount in each type of cell.
B) The student should utilize a hand-held size physical model of each type of cell so that they are able to see and compare the types
and locations of the organelles and how the organelle’s functions relate.
C) The student should utilize microscopic slides with real animal and plant cells so that they are able to identify the organelles and
location in a real cell and not a pretend one.
D) The student should utilize a model of the human body and plant so that they can understand how the cells of each type work with
the rest of the structure.
E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.
Answer: E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.
Explanation:
Structurally, plant and animal cells are very similar because they are both eukaryotic cells. They both contain membrane-bound organelles such as the nucleus, mitochondria, endoplasmic reticulum, golgi apparatus, lysosomes, and peroxisomes. Both also contain similar membranes, cytosol, and cytoskeletal elements.
Both animal and plant cells have mitochondria, but only plant cells have chloroplasts.
Animal cells have centrioles, centrosomes (discussed under the cytoskeleton), and lysosomes, whereas plant cells do not. Plant cells have a cell wall, chloroplasts, plasmodesmata, and plastids used for storage, and a large central vacuole, whereas animal cells do not.
The different types of plant cells include- collenchyma, sclerenchyma, parenchyma, xylem, and phloem.
The graphs represent the growth of two populations of
American bullfrogs in neighboring habitats.
Population
Habitat A
Time
Population
Habitat B
Time
Which statement is supported by the information provided?
A. Habitat A has more living space that is suitable for bullfrogs.
O B. Habitat B has more predators of bullfrogs.
O C. Habitat B contains more resources for bullfrogs.
O D. Habitat A can support a larger population of bullfrogs.
Eat natural food. By reducing pesticide and fertilizer use, you at once assist in reducing the quantity of chemical contamination that affects many amphibian species. Avoid releasing environmental estrogens into the water.
What is the habitat choice of the American bullfrog?A. Habitat A has greater living area that is suitable for bullfrogs. O B. Habitat B has extra predators of bullfrogs. O C. Habitat B consists of more sources for bullfrogs. O D. Habitat A can aid a larger population of bullfrogs.
American bullfrogs occupy a extensive vary of each herbal and manmade habitats, inclusive of lakes, ponds, swamps, marshes, brackish waters, streams, rivers, ditches, and canals. They pick warm, sluggish or stagnant waters with abundant vegetation, however are additionally observed along the shores of lakes and banks of streams.
Learn more about neighboring here;
https://brainly.com/question/15668415
#SPJ1
3. Circle the words that correctly complete the sentences.
•The individuals selected for breeding have certain traits, which are determined
by [alleles/engineering].
• The alleles for selected traits become [less/more] common in a population as
its genetic diversity [decreases/increases].
The individuals selected for breeding have certain traits, which are determined by alleles.
• The alleles for selected traits become [more] common in a population as its genetic diversity decreases
What are alleles?Alleles are different versions of a gene that exist at the same location (locus) on a chromosome. Each individual inherits two copies of each gene (one from each parent), and therefore two alleles at each locus.
Alleles may differ in their DNA sequence, resulting in differences in the physical or functional characteristics of the trait they control. For example, the gene for eye color has different alleles that produce brown, blue, or green eyes.
The combination of an individual's alleles at a particular locus is known as its genotype, and the physical expression of the genotype is called its phenotype.
learn about Alleles here https://brainly.com/question/23516288
#SPJ1
Which statement best describes the law of conservation of energy?
A. Energy can be destroyed but not created.
B. The total energy in an open system can only decrease.
C. Energy can change forms but cannot be created or destroyed.
D. Energy can be created but not destroyed.
The are 5 different types of white blood cells. Looking at their names, how would you categorize them into two groups?
Answer:
The five types of white blood cells are neutrophils, lymphocytes, monocytes, eosinophils, and basophils. They can be categorized into two groups based on their staining properties: granulocytes (neutrophils, eosinophils, and basophils) and agranulocytes (lymphocytes and monocytes).
Explanation:
What observation proves that a cell is a eukayote?
Transcribe and translate the following strands of DNA. Then answer the questions about protein synthesis.
1. DNA: TACCATCGATTGGAAGACCTTAACGAGCTAACT
mRNA:
amino acids:
2. DNA: CTGTTACTTTCAATCGTACACCAACACTGCTTTC
mRNA:
amino acids:
Answer:
so I don't know this one but will tell you how to solve it.
Explanation:
During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript (pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule (polypeptide) encoded by the original gene.
Humans belong to order___________ and family _________
Answer:
primate order and homo sapiens
Explanation:
30. What is the potential where a cell membrane must be more positive than negative to initiate an impulse?
A.action potential
B.stimulus
C.threshold potential
D.membrane potential
The threshold potential is the value at which a cell membrane must be more positively charged than negatively charged in order to produce an impulse.
Threshold potentialThe threshold potential is a crucial depolarization level that must be attained in order for a neuron to initiate an action potential or nerve impulse.
Voltage-gated ion channels in the membrane of a neuron open when the membrane potential reaches the threshold potential, enabling an influx of positively charged ions into the cell.
The result is a fast depolarization of the cell membrane, which generates an action potential that travels the entire length of the neuron.
It's crucial to understand that the threshold potential varies depending on the kind and location of the neuron, in addition to other elements like temperature and the presence of toxins or medications.
learn more about impulse here
https://brainly.com/question/477839
#SPJ1
What causes a mountain breeze?
• A. The sides of the valley cooling off more quickly than the air around
it.
B. The albedo of clouds.
C. The difference in heating between freshwater and seawater
D. The difference in specific heat between altitudes.
SUBMIT
Answer:
D. The difference in specific heat between altitude
Explanation:
Hop it helps
Please mark brainliest
What is the term for the process by which mRNA is used to make a protein?
The term for the process by which mRNA is used to make a protein is "translation".
Translation is a key process in gene expression, whereby the sequence of nucleotides in mRNA is read and used to synthesize a protein. During translation, the mRNA is read by ribosomes, which use the sequence of nucleotides to assemble a specific sequence of amino acids into a protein. The sequence of amino acids determines the structure and function of the protein, and ultimately its role in the cell or organism.
The process of translation involves a complex series of steps, including the recognition and binding of mRNA by ribosomes, the selection and assembly of amino acids, and the folding and modification of the protein. Understanding the process of translation is essential for understanding the fundamental workings of cells and organisms, and has important implications for fields such as biotechnology and medicine.
You are running a peach farm on the western slopes of Colorado. You know that the allele for fuzzy peaches is recessive and that this allele (f) has frequency of 0.7. You count 250 fuzzy peaches and 250 bald peaches. Determine whether or not this population is still in Hardy Weinberg equilibrium
This population is not in Hardy-Weinberg equilibrium, and there is some evolutionary force at work (such as mutation, selection, or genetic drift) causing the observed deviation from expected genotype frequencies.
To determine whether or not the population is in Hardy-Weinberg equilibrium, we can use the Hardy-Weinberg equation:
p²2 + 2pq + q² = 1
where p is the frequency of the dominant allele (in this case, the allele for bald peaches), q is the frequency of the recessive allele (the allele for fuzzy peaches), p² is the frequency of homozygous dominant individuals (bald-bald), 2pq is the frequency of heterozygous individuals (bald-fuzzy), and q² is the frequency of homozygous recessive individuals (fuzzy-fuzzy).
In this case, we are given that q (the frequency of the fuzzy allele) is 0.7. We can calculate p as:
p = 1 - q
p = 1 - 0.7
p = 0.3
We can then use the equation to calculate the expected frequencies of each genotype:
p² = (0.3)² = 0.09
2pq = 2(0.3)(0.7) = 0.42
q² = (0.7)² = 0.49
We can convert these expected frequencies to expected counts by multiplying by the total number of individuals:
Expected count of bald-bald (p²): 0.09 x 500 = 45
Expected count of bald-fuzzy (2pq): 0.42 x 500 = 210
Expected count of fuzzy-fuzzy (q²): 0.49 x 500 = 245
We can then compare these expected counts to the observed counts (250 fuzzy peaches and 250 bald peaches) to see if they are significantly different. We can use a chi-square goodness-of-fit test to make this comparison:
chi-square = ∑((observed - expected)² / expected)
chi-square = ((250 - 245)² / 245) + ((250 - 210)² / 210) + ((0 - 45)² / 45)
chi-square = 1.96 + 24.4 + 45
chi-square = 71.36
To determine if this chi-square value is significant, we need to compare it to the critical value from a chi-square distribution with 2 degrees of freedom (3 genotypes - 1). The critical value is 5.99 when the significance level is set to 0.05. We can rule out the null hypothesis that the population is in Hardy-Weinberg equilibrium since our computed chi-square value (71.36) is higher than the crucial value (5.99).
Learn more about Hardy-Weinberg equilibrium here:
https://brainly.com/question/30972392
#SPJ1
One way to discourage food sovereignty would be to:
Please choose the correct answer from the following choices, and then select the submit answer button.
Answer choices
promote local control of land, seeds, and other needed agricultural resources.
encourage food growth for export.
value food providers' right to live and work with dignity.
recognize that solutions must be place-based.
Answer:
Encouraging food growth for export would be one way to discourage food sovereignty
Explanation:
.This is because if the focus is on exporting food, it may lead to a situation where the domestic market is neglected, and food production is not geared towards meeting local needs. This could result in food shortages and make the local population dependent on imported food. In such a scenario, the control over food production and distribution would lie with external forces rather than local communities, which goes against the idea of food sovereignty.