Describe the differences between the confederacy and the union in two of the following fields view of slavery types of economies constitutional standing cultural appearance

Answers

Answer 1

The divergent views on slavery and economic systems between the Confederate and the Union.

About slavery: State's rights, which included the ability to possess slaves, served as the foundational tenet of the Confederate. Slavery, according to the Confederacy's founders, should be safeguarded as a property right since it was fundamental to the Southern way of life. They asserted that the federal government had no power to intervene with the practise of slavery in the states.As opposed to this, the Union was initially built on the idea of upholding the Union rather than the problem of slavery. Yet as the Civil War wore on, President Abraham Lincoln and other Union officials started to view the eradication of slavery As opposed to this, the Union was initially built on the idea of upholding the Union rather than the problem of slavery.

Yet as the Civil War wore on, President Abraham Lincoln and other Union officials started to regard the abolition of slavery as a crucial step to winning the conflict and reuniting the Union. All slaves in territory controlled by the Confederacy were deemed free according to the 1863 Emancipation Proclamation.

In conclusion, the Union and the Confederate had different perspectives on slavery, with the Union eventually aiming to eliminate it while the Confederacy saw it as a vital institution. Also, their economies were distinct, with the Confederate mainly reliant on agriculture and the slave labour, while the Union had a more diversified economy that encompassed both industry and agriculture.

To learn more about the Union and Confederacy https://brainly.com/question/1408963

#SPJ1


Related Questions

what were the effects of the innovation of the cotton gin?

Answers

The South's economy became dependent on cotton, which necessitated the use of slave labor. The development of the cotton gin stimulated the South's economy.

Farmers grew primarily cotton during the cotton boom that the cotton gin brought about. Some people urged Southerners to concentrate on different businesses and crops.

A gin allowed one slave to perform the tasks that once needed up to twenty. Cotton became the new gold almost suddenly, and there was plenty of lands available. Short-staple cotton could be planted and profitably harvested using slave labor.

To know more about Cotton Gin click here

https://brainly.com/question/11869399

#SPJ4

in the view of confucian historians, the last rulers of any dynastic cycle tended to be group of answer choices economically weak and militarily strong. economically secure yet morally culpable. politically weak and morally culpable. militarily weak and corrupt.

Answers

Question?????????????

what year was softball nationally recognized as an official sport? 1926 1933 1952 1934

Answers

Answer: 1934: The Amateur Softball Association is officially recognized by the National Recreation Congress. Rules were formalized, and the game was truly recognized and dubbed an official sport.

what difficulties did enslaved women face in addition to being separated from their homes and families and having to endure brutal conditions aboard the slave ship

Answers

Enslaved women faced a number of additional difficulties besides being separated from their homes and families and having to endure brutal conditions aboard the slave ship.

These difficulties included being vulnerable to sexual abuse and exploitation by their captors, being forced to work under harsh and dangerous conditions, and being subject to brutal punishment if they disobeyed their captors or tried to escape.

Enslaved women endured a great deal of suffering as a result of their enslavement. One of the most significant challenges they faced was being at risk of sexual abuse and exploitation by their captors. Many enslaved women were forced to work as domestic servants or laborers and were subject to sexual harassment and assault by their owners or overseers. Some women were forced to bear children for their owners, adding to their already heavy burden of work and responsibility.

Another challenge faced by enslaved women was the harsh and dangerous working conditions they were forced to endure. Many women worked in fields or factories for long hours in extreme heat or cold, with little rest or proper nutrition. They were often expected to perform backbreaking labor for little or no pay and were punished severely if they failed to meet their quotas or disobeyed their captors.

Finally, enslaved women were subject to brutal punishment if they tried to escape or resist their captors. They were often whipped, beaten, or even killed if they were caught trying to run away, and were forced to live in constant fear of being caught and punished.

However, despite these challenges many enslaved women were able to find ways to resist their oppression and maintain a sense of dignity and hope in the face of extreme hardship.

Learn more about Slavery at https://brainly.com/question/9331183

SPJ4

Which area of the world was most directly affected by the decisions made at the Berlin Conference? answer choices. South America. India. China.

Answers

None of the answer choices is correct as the Berlin Conference of 1884-85 was focused on the partition and colonization of Africa.

During this conference, European colonial powers such as Great Britain, France, Germany, Portugal, and Belgium agreed on the rules of dividing and claiming territories in Africa, regardless of the continent's cultural and ethnic diversity.

The conference ignored the political and cultural boundaries that existed within Africa, leading to the arbitrary division of the continent into European colonies that ultimately shaped the political, social, and economic landscape of Africa to this day. This partitioning led to the exploitation of African resources and people, causing long-lasting effects such as resource depletion, political instability, and economic underdevelopment. Therefore, the Berlin Conference's decisions had a direct and significant impact on Africa, not South America, India, or China.

Learn more about the Berlin Conference:

brainly.com/question/1913699

#SPJ4

According to the Bible who was Abraham and where did he come from and later move to?

Answers

Answer:

Explanation:Abraham is a significant figure in the Bible and is considered the father of the Jewish people, as well as an important prophet in Islam and Christianity.

According to the Bible, Abraham was born in Ur of the Chaldeans, an ancient city in Mesopotamia (modern-day Iraq) around 2000 BCE. He was married to Sarah and had a nephew named Lot.

At the age of 75, God called Abraham to leave his homeland and travel to a new land that God would show him. Abraham obeyed and, along with his wife and nephew, left Ur and traveled to the land of Canaan (modern-day Israel and Palestine).

In Canaan, God promised Abraham that he would make him the father of a great nation and that his descendants would be as numerous as the stars in the sky. God also promised Abraham that the land of Canaan would belong to his descendants.

Abraham lived in Canaan for the rest of his life and had many descendants, including his son Isaac and his grandson Jacob (who was later renamed Israel). Through his descendants, Abraham's legacy continued, and he became one of the most important figures in the history and religion of the Jewish people.

What were dowager empress cixi’s accomplishments during her reign? check all that apply. she served as the regent for her five-year-old son. a. she controlled the qing dynasty for forty-seven years. b. she modernized the chinese military. c. she put down the boxer rebellion. d. she established the open door policy.

Answers

Option a is correct. Empress Dowager Cixi's achievement during her reign was to rule the Qing Dynasty for 47 years.

Empress Dowager Cixi ruled China for decades, bringing her medieval empire into the modern era.

When she was 16, Xixi was chosen as one of the emperor's many concubines in a national consort selection. When he died in 1861, her five-year-old son inherited the throne. Cixi soon launched a coup against the regent appointed by her husband and became the true ruler of China. Literally behind the throne, separated from the all-male officials by a silkscreen.

In this groundbreaking biography, Jung Chang vividly describes how her Cixi battled the daunting obstacles to transforming China. Under her, the old country acquired almost all the attributes of a modern state.

Industry, railroads, electricity, telegraphs, and an army and navy with the latest weaponry. It was she who lifted her shackles by abolishing cruel punishments such as "death in shreds." She initiated women's emancipation and set out to establish parliamentary elections in China. Chan completely subverts the conventional view of Cixi as a staunch conservative and cruel tyrant.

Based primarily on newly available historical Chinese documents, including court records, official and private correspondence, diaries, and eyewitness testimony, this biography provides an account of a significant period in Chinese and world history. It will revolutionize historical thinking. 

Know more about Empress Dowager Cixi here:

https://brainly.com/question/14324785

#SPJ4

Answer: a b c

Explanation: that's what i am putting on edge :)

who was the first woman to run a successful presidential campaign

Answers

Answer: Victoria woodhull

Explanation: Pretty sure this it correct Brainlyest?

1. How does Fitzerald use weather to set a tone of despair in this excerpt?
-
2. Why do you think Fitzgerald included the detail about a lady with ¨ermine trimmings¨?
-
3. Why do you think Fitzgerald show that his main character, Merlin Grainger, was feeling depressed? Cite evidence from the text to support your answer.
-
4. What does the text tell you about the economy of New York at the time in which the book is set?
-
5. What type of person do you think Carlone will be? Why?
-
6. In what ways is Fitzgerald's writing similar to Wharton´s writing in the previous excerpt?

Answers

Answer:

1. Fitzgerald uses the weather to create a sense of gloom and despair by describing the "grey land" and the "desolate slope" which are covered in snow. The cold and barren landscape reflects the emotional state of the characters, highlighting their feelings of loneliness and hopelessness.

2. - Fitzgerald included the detail about a lady with ermine trimmings to emphasize the extravagance and opulence of the lifestyle of the wealthy characters in The Great Gatsby. This detail also serves to highlight the stark contrast between their luxurious lives and the poverty and struggles of others during the time period.

3.  Fitzgerald portrays Merlin Grainger as a disillusioned and disenchanted character who is struggling to find meaning in his life. This is evident from the passage where Merlin says, "I'm not sure what I want or what I'm doing. Everything seems so pointless."

-

4. The Great Gatsby portrays the economic boom of the 1920s in New York, with lavish parties and extravagant displays of wealth. However, it also highlights the corruption and moral decay that accompanied this era of prosperity.

-

5. Based on Carlone's previous actions and behavior, I predict that he will be a reliable and hardworking individual who takes his responsibilities seriously. However, his tendency to be overly cautious may sometimes hinder his ability to take risks and make bold decisions.

-

6.  Both authors like to explore themes of societal expectations and the consequences of conforming or rebelling against them.

Explanation:

Which statement best describes the result of colonial laws restricting peoples rights based on race?

A. The laws were seen as fair and just by everyone and would only be abolished when slavery ended.

B. The laws protected enslaved African people from harsh conditions and punishments.

C. The laws created a system of racial inequality in the United States.

D. The laws prevented a system of racial inequality from forming in the United States.

Answers

Answer: A

Explanation:

Answer: C

Took the quiz n got it right (apex)

Explanation:

What was M.A. counting on to support her in old age? And why has she lost faith that this will support her?

Answers

Answer:

M.A. was counting on her pension and social security benefits to support her in old age, but due to the economic downturn and changes in government policies, she has lost faith that these sources of income will be enough to sustain her. She is now considering alternative options such as part-time work or downsizing her lifestyle.

Explanation:

How did US labor unions treat Chinese immigrants in the 1800s?
O Labor unions discriminated against Chinese immigrants and did not allow them to join.
© Labor unions helped Chinese immigrants find jobs in factories and mills.
© Labor unions asked employers to pay Chinese immigrants lesser wages than union members.
O Labor unions helped Chinese immigrants form their own unions.
Save and Exit

Answers

Answer:

The correct answer is: Labor unions discriminated against Chinese immigrants and did not allow them to join.

Explanation:

In the late 1800s, many labor unions in the United States were formed to protect the interests of workers and improve their working conditions. However, these unions often excluded Chinese immigrants from their ranks, viewing them as a threat to their own jobs and wages. Chinese immigrants were also subjected to discrimination and violence from other workers, particularly in industries such as mining and railroad construction.

One notable example of labor union discrimination against Chinese immigrants was the Chinese Exclusion Act of 1882, which was supported by many labor unions at the time. The act prohibited Chinese immigrants from entering the United States and denied citizenship to those already in the country. This law remained in effect until 1943.

Overall, labor unions in the 1800s did not treat Chinese immigrants well and actively worked to exclude them from their ranks and limit their employment opportunities.

how did haydn petition his employer to grant his orchestral musicians leave to visit their families?

Answers

By composing a symphonic movement that ends with each musician symbolically dropping out

why did the U.S. move towards a foreign policy of isolationism after losing the vietnam ?

Answers

Explanation:

During the 1930s, the combination of the Great Depression and the memory of tragic losses in World War I contributed to pushing American public opinion and policy toward isolationism. Isolationists advocated non-involvement in European and Asian conflicts and non-entanglement in international politics.

Roosevelt, churchill and stalin discussed the future of europe and the world after the war at the:______.
a. potsdam conference b. council of trent c. versailles conference d. yalta conference

Answers

Option d is correct. Roosevelt, Churchill, and Stalin discussed the future of Europe and the world after the war in yalta conference.

Recognizing that a prolonged war might be necessary, the United States and Great Britain found great strategic advantage in the Soviet Union's participation in the Pacific theater.

At Yalta, Roosevelt and Churchill announced that the Soviet Union would Discussing the terms of participating in the war with Stalin, all three agreed that the Soviets would be given spheres of influence in exchange for potentially significant Soviet participation in the Pacific War. Manchuria after the surrender of Japan. These included southern Sakhalin, leases at Port Arthur (now Port Arthur), part of the Manchurian Railway operations, and the Kuril Islands. This agreement was the most important concrete outcome of the Yalta Conference.

Roosevelt, Churchill, and Stalin not only agreed to include France in Germany's postwar government, but agreed that Germany should bear some, but not all, of the postwar reparations. 

Know more about Yalta conference here:

https://brainly.com/question/29530986

#SPJ4

Answer:

its D

Explanation:

think about the people who lived where you do about 200 years ago. what would you be curious to know about their lives? what questions would you ask them?

Answers

Answer:

hows life :)

Explanation:

The questions I would ask them are "what was the daily life like?" and "what kind of work did they do, and how did they spend the leisure time?".

What is leisure?

In the year 120, leisure time was vastly different from what we know today. For the majority of people, leisure time was a luxury that was only enjoyed by the wealthy and nobility. Common people worked long hours every day, leaving little time for rest or play. However, when people did have free time, they engaged in various activities such as dancing, music, and games. Outdoor activities like hunting and fishing were also popular among the wealthy. Religious celebrations were a significant part of leisure time, and many people attended church festivals, processions, and pilgrimages. People also enjoyed storytelling, which was a form of entertainment and a way to pass on cultural traditions. Overall, leisure time in 120 was limited, but people made the most of it with the resources available to them.

To learn more about leisure, visit:

https://brainly.com/question/30471099

#SPJ1

A major contributing factor to the start of an independence movement in the American
colonies was —
failure of the colonists to follow the British laws
disagreement over the use of enslaved labor
a worsening famine
the lack of representation of the colonists in the British parliament

Answers

I think the answer is D. The lack of representation of the colonists in the British Parliament.
D. The lack of representation of the colonists in the British parliament

Which group of troops trained at kelly field in san antonio during world war i? question 10 options: a. submarine captains nb. avy captains c. pilots d. sailors

Answers

The group of troops that trained at Kelly Field in San Antonio during World War I were pilots.

The correct option is c.

Kelly Field was one of the primary training facilities for the United States Army Air Service during the war.

It was established in 1917 and became a center for aviation training, experimentation, and research. The pilots trained at Kelly Field were responsible for flying and operating the military aircraft used during World War I.

During the war, aviation technology advanced rapidly, and the United States needed to train thousands of pilots to support the war effort. Kelly Field played a crucial role in training pilots and developing new aviation techniques and tactics. In addition to training pilots, Kelly Field also provided support services such as aircraft maintenance, supply, and logistics.

Thus, Kelly Field was an important training facility that helped the United States build a strong military aviation force during World War I.

The correct option is c.

Learn more about the World War:

brainly.com/question/1449762

#SPJ4

why might spain feel threatened by the western explorations of the us?

Answers

Spain might feel threatened by the western explorations of the US due to the potential for territorial expansion and competition for resources.

Spain had previously established colonies in the Americas, and the westward expansion of the US could threaten their territorial claims and economic interests. The US was also becoming a powerful nation and could challenge Spain's influence in the region.

Additionally, the US had a history of supporting revolutionary movements, which could further destabilize Spanish control in the Americas. Spain's concerns were realized during the Spanish-American War in 1898, which resulted in the loss of their remaining colonial territories in the Americas.

Learn more about Western Exploration:

https://brainly.com/question/30540925
#SPJ4

How did the U.S. entry into World War I connect to the social and political developments regarding the civil liberties of ordinary Americans?

Answers

The U.S. entry into World W a r I led to the government restricting civil liberties in the name of patriotism and national security. However, this trend towards limiting individual freedoms was reversed after the war, and several of the restrictions were eventually lifted.

What is the connection?

The U.S. entry into World W a r I had a significant impact on the social and political developments concerning the civil liberties of ordinary Americans. The war was fought for democracy and freedom, which led to the government imposing several restrictions on civil liberties.

Socially, the w a r led to an increase in patriotism and nationalism. People were encouraged to support the war effort by buying war bonds and joining the military. The government wanted to maintain unity and suppress any dissent against the war effort. As a result, people who spoke against the war were labeled as unpatriotic, and their civil liberties were restricted.

Many civil liberties were curtailed during the war. The government imposed censorship on newspapers, limiting what they could publish. The Espionage Act of 1917 and the Sedition Act of 1918 made it illegal to criticize the government or the military. The government also arrested and deported people suspected of being spies or advocating anti-war sentiments.

Politically, the war resulted in the growth of federal power. The government created several agencies to regulate the economy and manage the war effort. These agencies had the power to regulate and control industries, which impacted individual freedoms.

Overall, the U.S. entry into World War I led to the government restricting civil liberties in the name of patriotism and national security. However, this trend towards limiting individual freedoms was reversed after the war, and several of the restrictions were eventually lifted.

learn more about civil liberties: https://brainly.com/question/276885

#SPJ1

Describe the Mukden Incident.

Answers

Answer:

The Mukden Incident, also known as the Manchurian Incident, was a staged event that occurred on September 18, 1931, in Mukden (now Shenyang), a city in northeastern China's Liaoning Province. It was orchestrated by the Imperial Japanese Army as a pretext to invade and occupy Manchuria, a region rich in natural resources and strategic importance.

The incident involved the explosion of a section of the Japanese-controlled South Manchuria Railway, which ran through a zone where both Chinese and Japanese troops were stationed. The Japanese army, claiming that Chinese dissidents were responsible for the explosion, launched a full-scale invasion of Manchuria, which they named Manchukuo, under the pretext of protecting their interests and restoring order.

The Chinese government, weak and divided at the time, was unable to resist the Japanese invasion, which led to the establishment of a puppet state in Manchuria that was controlled by the Japanese government. The incident and subsequent Japanese occupation of Manchuria were widely condemned by the international community, but little was done to stop it.

The Mukden Incident was a significant event in the lead-up to World War II, as it demonstrated Japan's willingness to use military force to achieve its expansionist goals and sparked tensions between Japan and other world powers, particularly the United States.

what was discovered in the great pyramid of giza which could reveal more findings?

Answers

In the Great Pyramid of Giza, the discovery of hidden chambers and shafts could reveal more findings. These hidden passages and rooms could contain significant information about the pyramid and the people who constructed it.

What is the Great Pyramid of Giza?

The Great Pyramid of Giza is the oldest and biggest of the three pyramids in the Giza pyramid complex, which is situated on the outskirts of Cairo, Egypt. The pyramid is believed to have been constructed between 2580 and 2560 BC during the reign of Pharaoh Khufu.

It was built as a tomb for the pharaoh and is one of the world's most well-known landmarks. It is 147 meters high and has a square base that measures 230 meters on each side.

What is the significance of the Great Pyramid of Giza?

The Great Pyramid of Giza is regarded as a world wonder and is one of the most significant structures in the world. It is recognized as an engineering feat since it was built without the aid of modern technology. It has inspired a lot of research into ancient Egyptian history and culture.

The pyramid is also thought to have supernatural abilities and is associated with ancient secrets and knowledge.

What has been discovered in the Great Pyramid of Giza?

Scientists have discovered a lot of secrets in the Great Pyramid of Giza over the years. In 2017, a team of scientists discovered a hidden chamber that had previously been undetected.

This chamber is thought to be situated on the northern side of the pyramid and is believed to contain valuable information regarding the pyramid's construction and function. There are also three unknown shafts in the pyramid that could contain more secrets.

What has been discovered in the Great Pyramid of Giza that could reveal more findings?

In the Great Pyramid of Giza, the discovery of hidden chambers and shafts could reveal more findings. These hidden passages and rooms could contain significant information about the pyramid and the people who constructed it. Experts are still exploring and analyzing these spaces to gain a better understanding of the pyramid's history.

To know more about Great Pyramid of Giza refer here: https://brainly.com/question/13604549#
#SPJ11

In this ruling, the supreme court upheld the constitutionality of which action taken by the federal government during world war ii?

Answers

In this ruling, the supreme court upheld the constitutionality internment camps taken by the federal government during world war ii .

Just two months later, in February 1942, President Roosevelt, acting in his capacity as commander in chief, issued Executive Order 9066, leading to the incarceration of Japanese Americans.

The American Civil Liberties Union helped Korematsu challenge his detention all the way to the Supreme Court, which ruled in 1944 that the existence of Japanese American spies made the internment order legal. The forced relocation of thousands of Japanese Americans to detention camps by the American government began in 1942 and continued throughout World War II.

To know more about federal government visit :

https://brainly.com/question/371257

#SPJ4

how does Legalism’s attitude toward people’s nature differ from that of both Confucianism and Dioism

Answers

Answer:

Legalism, the belief that people were evil by nature and needed to be controlled, was very different from both Confucianism and Daoism. Unlike the other two beliefs, Legalism was a political philosophy without any religious concerns. Instead, it only dealt with government and social control.

One of the Confederacy's major advantages during the early years of the Civil War was having:

A. a more industrialized economy.

B. highly skilled military leaders.

C. a much larger population.

D. alliances with European countries.

Answers

A more industrialized economy due to having more Cotten sales and things like trains made it easier to ship things faster to different place although this was before Sherman destroyed all of it

colonists were mainly english middle and lower classes, seeking economic betterment or religious freedom.truefalse

Answers

The statement "colonists were mainly English middle and lower classes, seeking economic betterment or religious freedom" is True because during the 17th century, most of the English colonists who came to America were from the lower and middle classes and they were searching for economic betterment or religious freedom.

At that time, in England, the vast majority of the population belonged to the working and lower-middle classes. These classes of English people migrated to America for a variety of reasons. In their home country, they faced economic difficulties, religious persecution, and overpopulation. They saw America as a land of opportunity where they could make a new life for themselves and their families. Because of the religious policies of the Anglican Church, many of these English immigrants had to leave their homeland in order to practice their faith as they desired.

Therefore, the statement "colonists were mainly English middle and lower classes, seeking economic betterment or religious freedom" is true.

Learn more about colonists:

https://brainly.com/question/24571554

#SPJ11

What is the mean absolute division of 10 10 9 8 10 5 6 4 8 4

Answers

Answer:

Mean Absolute Deviation (MAD): 2.12

Explanation:

is it valuable to see the faces of people so far back in the past? Or is it wrong to reconstruct their likenesses without their permission?​

Answers

Answer:

There isn't a way for us to ask them permission...they're dead... BUT I believe it is valuable for us to see the faces of people in the past. Seeing them in-real-life and trying to better imagine how they appeared gives them a more human and tangible touch. You can better imagine how they fit into history and helps you understand history isn't just a story-everything really happened and all the people mentioned really existed.

adjectives of osceloas

Answers

Famous or celebrated are some adjectives that work for the word you provided

what countries competed in ancient greece olympics?

Answers

In ancient Greece, only Greek city-states were allowed to compete in the Olympic Games, which include Athens, Sparta, Corinth, Thebes, Delphi, Elis, Nemea, and Olympia itself.

The ancient Olympic Games were a series of athletic competitions held every four years in Olympia, Greece.

The games were held in honor of Zeus, the king of the Greek gods, and were an important part of Greek culture and religion. Athletes from various Greek city-states would compete against each other in events such as running, jumping, wrestling, boxing, and chariot racing.

The winners of these events were considered heroes in their home cities, and were often awarded with prizes such as olive wreaths, fame, and even financial rewards.

Learn more about ancient Greece here:

https://brainly.com/question/12005813

#SPJ11

Other Questions
Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units.