countries like argentina and australia protect agriculture less heavily than other agricultural producers because

Answers

Answer 1

Argentina and Australia protect agriculture less heavily than other agricultural producers because they have a comparative advantage in other industries. Both countries have rich natural resources, making them major exporters of minerals and energy products.

The importance of agriculture in these countries' economies has declined over the years due to the rise of other industries. In Argentina, the government has reduced agricultural protectionism due to the economic benefits of liberalization. The country has an excellent climate and fertile land, making it a significant producer of soybeans, corn, and wheat.

However, over time, agriculture has struggled due to natural disasters, currency devaluations, and trade restrictions. Consequently, the government has decreased its protection of agriculture to encourage economic diversification and growth.

In Australia, agriculture has also declined in importance, accounting for only a small percentage of GDP. The country has instead prioritized the mining industry, which accounts for a significant percentage of its exports. However, despite this, the government still offers some protection to farmers to ensure their survival in a competitive global market.

In conclusion, countries like Argentina and Australia have shifted their focus from agriculture to other industries due to their comparative advantage. As a result, they have decreased their protection of agriculture, preferring to prioritize economic diversification and growth.

Learn more about agriculture:

https://brainly.com/question/14533586

#SPJ11


Related Questions

the original rock from which a metamorphic rock formed.

Answers

Answer:

crustaline

Explanation:

it is the original rock

_________ make up about _______ percent of Muslims around the world.

Answers

Over the world, Sunni Muslims make up around 85–90% of the Muslim population, while Shia Muslims make up about 10%. The Ibadi, Ahmadiyya, and Sufi Muslims are only a few examples of the tiny sects that make up Islam.

How many Muslims are there in the world?

The second-largest religious group in the world today is made up of Muslims. More than 24% of the world's population, or approximately 1.8 billion people, identify as Muslims.

Where do the roughly 30% of Muslims originate?

91% of the people in the Middle East and North Africa (MENA), 89% in Central Asia, 40% in Southeast Asia, 31% in South Asia, 30% in Sub-Saharan Africa, 25% in Asia-Oceania, about 6% in Europe, and 1% in the Americas identify as Muslims.

To know more about  Muslims visit:-

brainly.com/question/1462956

#SPJ1

irish immigrants to the united states typically settled in what areas?

Answers

Answer: Irish Emigration to America Irish men and women first settled in the United States during the 1700s. These were predominantly Scots-Irish and they largely settled into a rural way of life in Virginia, Pennsylvania and the Carolinas.

Explanation:

what action broke off us negotiations with japan? japan’s war with china japan’s invasion of indochina japan’s pact with germany and italy japan’s pact with indochina

Answers

The action that broke off negotiations between Japan and the United States was Japan's signing of the Tripartite Pact with Germany and Italy in 1940. The correct option is C.

This was an agreement of mutual assistance and aggression between the three Axis powers, which was seen as a direct threat to the security of the United States and its allies in the region.

In response, the US imposed a total embargo on the export of oil and strategic materials to Japan, which resulted in a severe economic crisis for the country. This, combined with the US's continued refusal to negotiate, was the final straw that led to Japan's decision to launch a surprise attack on Pearl Harbor in 1941. The correct option is C.

To know more about Tripartite Pact, click here:

https://brainly.com/question/4300695

#SPJ4

the earth has earthquakes. does the moon have moonquakes?

Answers

Answer:

Yes

Explanation:

when sediment is moved around by wind or water it is called__

Answers

When sediment is moved around by wind or water it is called sedimentation.

Sedimentation can  do in a variety of ways depending on the  terrain, and can be a result of natural processes  similar as  corrosion or be caused by  human conditioning  similar as construction. Sedimentation is important for the  conformation of soil, for the  conservation of  territories, and for the loss of beach and other sediments on  strands.  

Sedimentation caused by wind is called aeolian sedimentation. Aeolian sedimentation occurs when strong winds hit a  face and carry down loose  patches. These  patches,  similar as beach, dust, and soil, can be transported far distances and deposit in areas far down from their source. This process can be seen in  comeuppance, where beach stacks form from the wind- blown  deposition.

To know more about  sediment visit:

https://brainly.com/question/30558930

#SPJ4

for a dream vacation to the south pacific, consult our 10 top hotels and resorts in fiji. which exclusive retreat do we recommend that hosts only 14 couples at any time and where each private villa has a personal concierge?

Answers

The exclusive retreat that we recommend for a dream vacation to the South Pacific, that hosts only 14 couples at any time and where each private villa has a personal concierge is the Likuliku Lagoon Resort.

Likuliku Lagoon Resort is Fiji's only resort with over-water bungalows, and it's ideal for honeymooners and romantic getaways. The resort's guest rooms are referred to as bures, and each bure is located on a wooden walkway that stretches out over the lagoon. Every bure has an ocean view, and some even have glass floors that allow you to see the marine life below.

A personal concierge is an individual who assists you with travel arrangements, dining reservations, and other requests throughout your stay at a hotel or resort. The personal concierge is usually assigned to you upon arrival and is your point of contact for any questions or concerns you may have throughout your stay.

To know more about South Pacific, refer here:

https://brainly.com/question/8157981#

#SPJ11

which numbered area on this geologic map of north america consists of recently added tectonic terranes?

Answers

Area 1 on this geological map of North America consists of the recently added tectonic terranes, extending from Alaska south to the Pacific Coast.

The numbered area on this geologic map of North America which consists of recently added tectonic terranes is 1. A tectonic terrane is a fault-bounded block of the earth's crust, which has been accreted to or displaced from a continent by tectonic forces. As the location in question is Southern Alaska, it can be noted that this region has experienced multiple tectonic terranes addition over time, and these tectonic terranes are an integral part of the current geological structure of the region.

Learn more about tectonic terranes at https://brainly.com/question/28259981

#SPJ11

metamorphism brings changes in mineral arrangement and the texture of rocks, but it never leads to new mineral assemblages. group of answer choices true false

Answers

The given statement "metamorphism brings changes in mineral arrangement and the texture of rocks, but it never leads to new mineral assemblages" is FALSE because metamorphism brings changes in mineral arrangement and the texture of rocks, and it can indeed lead to new mineral assemblages.

Metamorphism is the process in which rocks undergo changes due to high heat, high pressure, or chemical alteration. The original rock is altered, but its chemical composition remains the same. The process can take place due to changes in temperature, pressure, or chemical reactions within a rock.

When rocks undergo metamorphism, they often exhibit changes in mineral arrangement and texture. Additionally, new mineral assemblages may be formed. Metamorphic rocks are formed from other rock types that are subjected to high heat, high pressure, and/or chemical alteration.

The process of metamorphism changes the physical and chemical properties of the original rock, and the resulting rock often has a different mineral composition and texture than the original rock.

For such more question on metamorphism:

https://brainly.com/question/31149725

#SPJ11

hich of these four images would accurately demonstrate the path seismic rays would take through the interior if the interior of earth was made of uniform materials?

Answers

As an AI language model, I don't have the ability to display images. However, I can describe which image would accurately demonstrate the path seismic rays would take through the interior if the interior of the Earth was made of uniform materials.

If the interior of the Earth was made of uniform materials, seismic rays would travel in straight lines through the Earth's interior. Therefore, the image that would accurately demonstrate the path seismic rays would take through the Earth's interior would be an image of straight lines passing through the center of the Earth, as opposed to an image with curved or angled lines.

Learn more about AI language model at: https://brainly.com/question/25523571

#SPJ11

What are global wind patterns called?a. a local winds b. prevailing winds c. el ninod, la niña

Answers

Global wind patterns are called prevailing winds (30-60 degrees)

What type of rock might contain evidence of past life?what material is this?

Answers

Sedimentary rocks can contain evidence of past life. These rocks are formed from the accumulation of sediment, which can include organic material such as the remains of plants and animals.

Over time, these remains become compacted and lithified into sedimentary rock. Fossils are the most common type of evidence of past life found in sedimentary rocks. Fossils are not only the preserved remains of an organism, but can also include traces such as tracks and burrows, as well as chemical evidence.

Fossilized shells, bones, and teeth are often found in sedimentary rock, providing evidence of life in the past. Additionally, sedimentary rocks may contain evidence of past life in the form of stromatolites, which are layered structures formed by the trapping, binding, and cementation of sediment by microbial mats. Other types of sedimentary rocks such as coal and oil shale can also contain evidence of past life in the form of preserved plant and animal remains.

To know more about Sedimentary rocks, click here:

https://brainly.com/question/10709497

#SPJ4

which of the factors listed below make the pacific northwest particularly vulnerable to damage from debris flows? multiple select question. heavy annual precipitation volcanic activity high elevation, steep slopes folded and fractured rocks

Answers

The factors listed below that make the Pacific Northwest particularly vulnerable to damage from debris flows are A.  heavy annual precipitation, volcanic activity, high elevation, and steep slopes.

Debris flows are rapid downhill movements of rocks, sediment, and water that move down channels and other paths in the landscape. Debris flows can be caused by landslides, volcanic activity, or heavy rainfall and it more likely to occur in areas with steep slopes, high elevations, and loose soil or rock. Heavy annual precipitation, the Pacific Northwest receives a large amount of precipitation every year, which can trigger landslides and debris flows. Rainfall increases the likelihood of debris flows because water can carry more sediment and increase the weight of the material moving down the slope.

Volcanic activity the pacific northwest is home to a number of active volcanoes, including Mount Rainier, Mount Hood, and Mount St. Helens. Volcanic activity can create unstable slopes and loose soil and rock, which can lead to debris flows.High elevation and steep slopesThe Pacific Northwest has a number of high-elevation mountains and steep slopes, which are susceptible to landslides and debris flows. Steep slopes are more prone to landslides and debris flows because they are more likely to be unstable and contain loose sediment and rock.Folded and fractured rocksThe presence of folded and fractured rocks can contribute to landslides and debris flows. However, this factor is not specific to the Pacific Northwest and is not unique to this region.

Learn more about debris flows at:

https://brainly.com/question/13096450

#SPJ11

What shape do we call the Moon when we can only see a small sliver or less than a 1 4 of the Moon?

Answers

Crescent moon is the Moon when we can only see a small sliver or less than a 1/4th of the Moon.

It is the most common of the three lunar phases that can be seen from Earth, the other two being the full moon and the gibbous moon. A crescent moon appears when the Moon is in its waxing phase, meaning it is between a new moon and a half moon.

We can only see a crescent moon when we are looking at less than a quarter of the illuminated side of the Moon, with the rest of it being in the shadow of the Earth. The crescent shape can vary greatly in size, ranging from a thin sliver to a wide arc. It is a beautiful sight to behold in the night sky, and many cultures have associated the crescent moon with the goddess of the moon.

To know more about Crescent moon, click here:

https://brainly.com/question/2846319

#SPJ4

The question is-

What shape do we call the Moon when we can only see a small sliver or less than a 1/4th of the Moon?

Why do sciences use index fossils

Answers

Index fossils are used to define geological periods. These fossils can be defined as "commonly found, widely distributed fossils that are limited in time span.

2.highlight the letter of each sentence that is true about mid-ocean ridges. a. mid-ocean ridges are mountain ranges on the ocean floor. b. mid-ocean ridges sometimes form islands. c. mid-ocean ridges are found only in the atlantic ocean.

Answers

The letter of the sentence that is true about mid-ocean ridges is A. Mid-ocean ridges are mountain ranges on the ocean floor. This statement is true about mid-ocean ridges.

What are mid-ocean ridges?

Mid-ocean ridges refer to the places where the seafloor spreads apart and magma wells up to the surface. Mid-ocean ridges are the longest continuous mountain range on Earth, with their peaks extending 23,000 feet above the seafloor. They stretch over 40,000 miles around the planet and circle the Earth like seams on a baseball.

What are the characteristics of mid-ocean ridges?

A mid-ocean ridge is a long and narrow volcanic mountain system that is found on the ocean floor. These ridges form a chain of mountains, mountains that run the length of the ocean basin, and can extend up to 1,000 kilometers long. The ridges are 2 to 3 kilometers high, however, they are around 20 kilometers wide.

To know more about mountain ranges, refer here

https://brainly.com/question/22017546#

#SPJ11

what is radiometric dating? group of answer choices the process of determining the age of a fossil from radioactive isotopes the process of determining the age of a fossil using radio waves the mineralization process by which living things are turned into fossils the process of determining the age of a fossil based on its location in layers of rocks

Answers

In radiometric dating, the relative abundance of specific radioactive isotopes and their decay products are used to calculate the age of a sample or specimen, typically a rock or mineral.

Because specific isotopes decay over time at a predictable rate, this method is frequently used to date rocks, minerals, fossils, and other organic remains.

Scientists can determine when the sample was created or when the organism died by calculating the ratio of parent and daughter isotopes in a sample. This enables them to establish the sample's age and, consequently, the age of the fossil or other organic material that it contains.

Learn more about radiometric dating

https://brainly.com/question/14799339

#SPJ4

in which of the following ways may earthquakes be generated within a continental plate? multiple select question. intrusions of magma transform faults flow of material within the asthenosphere movement of groundwater within cave systems continental rifting and normal faulting movement of preexisting faults subjected to new stresses

Answers

Earthquakes may be generated within a continental plate by the movement of groundwater within cave systems, continental rifting and normal faulting, and the movement of preexisting faults subjected to new stresses. Therefore, the correct option is:

a. Movement of groundwater within cave systems.b. Continental rifting and normal faulting.c. Movement of preexisting faults subjected to new stresses.

The following are ways in which earthquakes can be generated within a continental plate:

The movement of groundwater within cave systems is one of the ways in which earthquakes can be generated within a continental plate. The flow of water within the ground and the dissolution of rock by water can produce a void or cavity in the rock, which can then cause the rock to become unstable and potentially generate an earthquake.

Continental rifting and normal faulting is another way in which earthquakes can be generated within a continental plate. Tensional forces within the Earth's crust can cause a continent to break apart, creating normal faults that can produce earthquakes.

The movement of preexisting faults subjected to new stresses is a third way in which earthquakes can be generated within a continental plate. A fault that has been inactive for a long period of time can be reactivated by new stresses, leading to an earthquake.

Learn more about Earthquakes: https://brainly.com/question/248561

#SPJ11

Sort the following characteristics by the type of volcano they are associated with.1) pillow basalt2) lahars3) strombolian eruption4) pyroclastic flow5) flank eruptions6) fire fountain7) felsic lavecinder cone volcano :shield volcano :stratovolcano :

Answers

The following characteristics can be sorted by the type of volcano they are associated with:

cinder cone volcano - flank eruptions; strombolian eruptionshield volcano - pillow basalt; fire fountainstratovolcano - pyroclastic flow; lahars; felsic lava

Pillow basalt, which is typically seen in oceanic intraplate volcanic islands, is associated with shield volcanoes. Shield volcanoes are formed by the accumulation of fluid basaltic lava that slowly spreads out, creating a broad and gentle-sloping volcano.

Strombolian eruptions are the least powerful volcanic eruptions, and they are most commonly associated with cinder cone volcanoes. The volcanic eruption sends lava in short bursts through the volcano's vent, sending lava hundreds of meters into the sky before it falls back to the ground.LaharsLahars are a type of volcanic mudflow that can occur on both cinder cone and stratovolcanoes. They form when volcanic ash, mud, and debris combine with water, melting snow, or ice and rush down the slopes of the volcano.

Pyroclastic flows are most commonly associated with stratovolcanoes. A pyroclastic flow is a high-velocity stream of hot ash, rock fragments, and gas that flows down the side of a volcano.

Flank eruptions, which can occur on both shield and stratovolcanoes, refer to volcanic eruptions that occur on the side of a volcano, rather than at the volcano's summit.

Fire fountains are typically seen in cinder cone volcanoes. They are brief, intermittent eruptions of lava that can rise hundreds of feet in the air before collapsing back onto the volcano's cone.

Felsic lava, which is high in silica and viscous, is typically associated with stratovolcanoes. Stratovolcanoes are steep-sided cones that are made up of alternating layers of lava and ash.

Learn more about volcanoes at https://brainly.com/question/824390

#SPJ11

What happens after the helium flash in the core of a star?A) The core quickly heats up and expands.B) The star breaks apart in a violent explosion.C) The core suddenly contracts.D) The core stops fusing helium.E) The star starts to fuse helium in a shell outside the core.

Answers

After the helium flash in the core of a star, the core suddenly contracts. This occurs due to the rapid fusion of helium. Answer.c

What is a helium flash?

Helium flash is the term used to describe the ignition of helium fusion in a star's core. It happens when a low-mass star evolves to the point that its helium core becomes degenerate. As a result of the increased temperature in the core, it undergoes a helium flash.

This will make the star shrink and cause it to expand again after the flash has ended. It ignites the nuclear fusion of helium into carbon, which provides additional heat and pressure to counteract gravity. As a result, the star will become more stable and will not collapse.

What happens after the helium flash in the core of a star?

After the helium flash in the core of a star, the core suddenly contracts. This occurs due to the rapid fusion of helium. As the core heats up, it expands until helium fusion occurs, and then it cools and contracts.

When the core contracts, the temperature and density rise again, allowing helium fusion to proceed at a faster rate. The newly generated energy causes the outer layers to expand once more, and the cycle repeats. Therefore, option C, "The core suddenly contracts," is the correct answer.

To know more about ignition refer here: https://brainly.com/question/6605272#
#SPJ11

What are the Lesser Antilles?
a. The smaller islands of the Greater Antilles.
b. A region in the Caribbean.
c. A part of the South American continent.
d. None of the above.

Answers

Answer:

b. A region in the Caribbean.

76. What regional effects influence continental interiors?
a)rises and falls in sea level related to changes in global climate
b)stresses transmitted from distant plate boundaries and mountain belts
c)preexisting fault that can be activated by stresses, causing faulting and folding
d)all of these

Answers

Answer:  

Continental interiors are influenced by many factors

so it could be all of the above im not sure

Explanation: hope its right sorry if it isnt

The regional effects that influence continental interiors are:Rises and falls in sea level related to changes in global climate, stresses transmitted from distant plate boundaries and mountain belts and preexisting fault that can be activated by stresses, causing faulting and folding. The correct option is (d).

These three regional effects influence continental interiors, and all of them are discussed in detail below.

Rises and falls in sea level related to changes in global climate : The sea level changes due to the variations in the global climate that occur over long periods. When the climate gets colder, the sea level lowers, and when it gets warmer, the sea level increases.Stresses transmitted from distant plate boundaries and mountain belts.Stresses caused by movements in distant plate boundaries and mountain belts can influence continental interiors: When these stresses occur, the force is transmitted through the earth's crust, leading to changes in the earth's surface, such as faulting and folding

.Preexisting faults that can be activated by stresses, causing faulting and folding : Preexisting faults in the continental interiors can be activated by stresses, leading to faulting and folding. When the stresses exceed the rock's strength, the rock will break, leading to faulting and folding.In conclusion, all the regional effects mentioned above can influence continental interiors.

To know more about continental interiors click here

brainly.com/question/14658558

#SPJ11

When it is winter in
North America, the
Northern Hemisphere
is
A. tilted away from the Sun
B. not tilted towards or away from the Sun
C. tilted towards the Sun

Answers

Answer: Option C: The Northern Hemisphere is tilted towards the Sun.

Explanation:

in iceland long, linear _ eruptions composed of low-viscosity, low-volatile lava flows are typical.

Answers

In Iceland, long, linear rift eruptions composed of low-viscosity, low-volatile lava flows are typical.

Iceland is one of the world's most volcanically active countries, with eruptions occurring every five years on average, and these are often fissure eruptions. The high-mountain landscapes of Iceland are a consequence of long periods of volcanic activity, with lava flows, ash clouds, and tephra deposits shaping the land.

Iceland's volcanoes are unique due to the fact that they are situated on the Mid-Atlantic Ridge, a divergent plate boundary where new crust is generated from volcanic activity. An eruptive fissure is a crack or narrow fissure in the ground from which lava and ash may erupt. Most volcanic fissures are found near shield volcanoes, which are formed by slow-flowing lava.

The Volcanic Explosivity Index, or VEI, is used to measure the intensity of volcanic eruptions, ranging from 0 to 8. Fissure eruptions are usually classified as VEI 0 or VEI 1 on this scale, indicating that they are not particularly explosive.

To know more about rift eruptions, refer here:

https://brainly.com/question/29570739#

#SPJ11

what does it mean if airflow in the northern hemisphere is anticyclonic?

Answers

In the northern hemisphere, anticyclonic airflow means that the air is moving in a clockwise direction.

This is the  contrary of  volcanic tailwind, which is when the air moves in a counterclockwise direction. Anticyclonic tailwind  generally occurs in areas of high pressure, which  generally indicates good rainfall and clear skies.

The air is  generally descending as it moves in an anticyclonic pattern, which is why the pressure is high. This pattern of air  stir is also appertained to as a" high" or an" anticyclone." This type of rainfall pattern can  frequently bring fair skies and affable rainfall.

To know more about northern hemisphere visit:

https://brainly.com/question/26841745

#SPJ4

What sedimentary rocks typically form an aquifer?

Answers

Gravel, sandstone, conglomerate, and fractured limestone typically form aquifers.

How did World War II affect Australia’s culture?

Responses

a. The war lowered the population. This changed people’s beliefs about who should immigrate to and live in Australia.
b. The war drained resources. This led Australians to grow and export more of their own crops.
c. The war damaged the economy. This led Australians to want to focus on economic development.
d. The war damaged the infrastructure. This led Australians to support more public works projects.

Answers

The world war 2 affected Australia's culture by lowering its population and changing people’s beliefs about who should immigrate to and live in Australia.

Therefore option a. is correct.

An increasingly recognizable Australian popular culture began to emerge after World War II.

The entrance and continued presence of more than 100,000 American soldiers in Australia starting in 1941 had a significant effect on postwar culture and society.

Which definition of culture is more accurate?

The term "culture" refers to all of a population's passed-down ways of living, such as its institutions, beliefs, and artistic expression. "The manner of life for an entire society" is how some people define culture.

The manners, dress, language, religion, rituals, and art rules are all part of it.

To know more about Culture visit:

https://brainly.com/question/30497684

#SPJ1

Which equation represents a line which is parallel to the line 6x-5y=5

Answers

The equation of the line parallel to 6x-5y=5 that passes through the point (2,4) is y = (6/5)x + 18/5.

How to find the  equation represents a line which is parallel to the line 6x-5y=5

To find an equation that represents a line parallel to the line 6x-5y=5, we need to remember that parallel lines have the same slope.

To find the slope of the line 6x-5y=5, we can rearrange the equation into slope-intercept form, y = mx + b, where m is the slope and b is the y-intercept.

Starting with 6x - 5y = 5, we can subtract 6x from both sides to get:

-5y = -6x + 5

Dividing both sides by -5 gives us:

y = (6/5)x - 1

So the slope of the original line is 6/5.

Now, we can choose any point that we want the new line to pass through and use that point and the slope to write the equation of the new line.

For example, let's say we want the new line to pass through the point (2,4). Using the point-slope form of a line, we have:

y - 4 = (6/5)(x - 2)

Simplifying gives:

y = (6/5)x - 2/5 + 4

y = (6/5)x + 18/5

So the equation of the line parallel to 6x-5y=5 that passes through the point (2,4) is y = (6/5)x + 18/5.

Learn more about slope-intercept form at https://brainly.com/question/22057368

#SPJ1

What landforms help shape life in Bhutan, Maldives, Nepal, and Sri Lanka?

Answers

The landforms help shape life in Bhutan, Maldives, Nepal, and Sri Lanka includes: Himalayan Mountains, Plains, Rivers and Coastal areas

The  landforms that help shape life in Bhutan, Maldives, Nepal, and Sri Lanka

Bhutan, Maldives, Nepal, and Sri Lanka are all countries in South Asia that have diverse landforms that shape the lives of their people in different ways. Some of the major landforms that help shape life in these countries include:

Himalayan Mountains: The Himalayan Mountains run through Bhutan and Nepal, and they play a crucial role in shaping life in these countries. The mountains are a source of water for the rivers that flow through the region, and they also provide important habitats for wildlife. Many people in Bhutan and Nepal rely on agriculture for their livelihood, and the mountains provide fertile soil for growing crops.

Plains: The plains of Nepal and Sri Lanka are important for agriculture and support the growth of crops like rice, wheat, and sugarcane. These plains are also home to a variety of wildlife, including elephants, tigers, and rhinoceroses.

Rivers: The rivers in these countries are a crucial source of water for agriculture, drinking, and other human activities. The rivers also support a rich aquatic ecosystem that includes fish, amphibians, and other species.

Coastal areas: The Maldives and Sri Lanka have extensive coastlines, which have shaped life in these countries in many ways. The coastlines provide important habitats for marine life, and they also support industries like fishing and tourism.

Learn more about  landforms at https://brainly.com/question/28551341

#SPJ1

Io this next part, you will practice lithologic correlation. You need to use the following Ruler . Pencil with eraser (no pen) . Colored pencils (optional) . To correlate the sections. you will use a pencil and a ruler to draw lines connecting geologic contacts between beds as illustrated in Figure 7.16. This is not a matching activity, so do not draw lines to the midpoints of the units. Draw your lines at the contacts. Use a ruler and be as neat as possible. Note that each vertical column is a stratigraphic section. Each different rock type can be regarded as a bed or facies. 1. Correlate the three stratigraphic sections below, Draw lines between the three stratigraphic sections below to connect the geologic contacts between beds. a. How many beds can be correlated across all three sections b. How thick is the thickest stratigraphie section (entire column of rocks)? (Note meters that the scale goes from 0 to 70 meters.) , , c. A bed of coal (black) is present in sections B and C. Draw where it would appear in the blank area of section A. How deep would you have to drill in section A (starting at the top of the section, up near the letter A) to reach the buried coal seam? meters d. What type of unconformity is present? e. Above the unconformity, is there a transgressive sequence or a regressive sequence?

Answers

To practice lithologic correlation, follow these steps:

1. Gather the required materials: a ruler, a pencil with eraser, and colored pencils (optional).

2. Correlate the three stratigraphic sections by drawing lines with a pencil and a ruler to connect geologic contacts between beds as illustrated in Figure 7.16. Remember, this is not a matching activity, so draw lines at the contacts, not the midpoints of the units.

a. The number of beds that can be correlated across all three sections depends on the specific stratigraphic sections provided, which are not included in the question.

b. To determine the thickness of the thickest stratigraphic section, refer to the provided scale (0 to 70 meters) and measure the entire column of rocks in each section. The highest measurement is the thickest section.

c. To locate the bed of coal in section A, examine where it appears in sections B and C, and draw it accordingly in the blank area of section A.

To calculate the depth required to drill in section A to reach the coal seam, measure the distance from the top of section A to the top of the coal bed, using the provided scale.

d. The type of unconformity present depends on the specific stratigraphic sections provided, which are not included in the question.

e. To determine whether the sequence above the unconformity is transgressive or regressive, observe the change in sediment grain size and the sequence's overall trend (i.e., marine or non-marine).

If the sequence shows a progression from coarser to finer-grained sediments and a marine trend, it is transgressive. If the sequence shows a progression from finer to coarser-grained sediments and a non-marine trend, it is regressive.

To learn more about lithologic, refer below:

https://brainly.com/question/3209838

#SPJ11

Other Questions
the alpha level for a hypothesis test defines the critical region the alpha level for a hypothesis test defines the critical region true false Question 3 a) What is the theoretical probability of rolling a sum of 8? b) What is your experimental probability of rolling a sum of 8? c) What are the odds of rolling a sum of 8? the unadjusted trial balance columns of a company's work sheet shows the store supplies account with a balance of $580. the adjustments columns shows a credit of $325 for supplies used during the period. the amount shown as store supplies in the balance sheet columns of the work sheet is: What is an angle that is adjacent to DHC? which of the following is an internal control procedure used to safeguard a company's assets? multiple choice all of these answer choices are correct segregation of duties depositing cash receipts in a bank on a timely basis preparing a bank reconciliation what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does.