Construct the correct sequence of events for meiosis I, starting at the top.
1. Separated homologues cluster at each pole.
2. Paired homologues align at the equator, microtubules attach to kinetochores of sister chromatids.
3. Microtubules shorten, chiasmata are broken, homologous chromosomes are pulled to opposite poles.
4. Nuclear envelope re-forms around each daughter nucleus.
5. Chromosomes condense, forming of spindle apparatus begins, homologous chromosomes pair and crossing over occurs.

Answers

Answer 1

The sequence of events in meiosis I is first 'chromosomes condense and crossing over occurs', second 'paired homologues align at the equator', third 'chromosomes are pulled to opposite poles', fourth 'separated homologues cluster at each pole' and fifth 'nuclear envelope re-forms around each daughter nucleus'.

Meiosis is a reductional cell division by which a parent cell produces four daughter cells with half of the genetic material.

Meiosis can be divided into meiosis I and meiosis II.

During prophase I (meiosis I),

Chromosomes condenseBegins the formation of the spindle apparatus from cytoskeleton present in the cytoplasmThe homo-logous chromosomes pair and crossing over occurs. Crossing over refers to the interchange of genetic material between non-sister chromatids.

During metaphase I,

The homo-logous chromosomes align at the equator plate of the cellThe microtubules attach to the kinetochores of sister chromatids

During anaphase I,

The microtubules shortenThe chiasmata, which link homo-logous chromosomes together until anaphase I, are brokenThe homo-logous chromosomes are pulled to opposite poles, thereby, one chromosome of each pair randomly moves to one pole of the cell and the homologous chromosome to the other.

During telophase I,

The separated homologous chromosomes cluster at each pole of the new cellsThe nuclear envelope is formed around each cell nucleus.

Learn more in:

https://brainly.com/question/2095046?referrer=searchResults


Related Questions

which muscle group relates best with the term midline?

Answers

The oblique is the muscle group that best relates with the term midline.

The anterolateral abdominal wall contains a muscle group in which there are flat muscles whose fibers originate in the posterolateral part, pass forward and become an aponeurosis towards the midline:

The external oblique muscle is the thickest and most superficial of the three muscles on the lateral wall of the abdomen.

It follows an inferomedial direction and the muscle-tendon limit descends in such a way that, towards the midline and also below the height of the anterior superior iliac spine, it is completely transformed into an aponeurosis.

The aponeurosis of the external oblique joins that of the internal oblique and passes in front of the rectus abdominis; its fibers intersect in the midline with those on the opposite side and contribute to the linea alba.

Therefore, we can conclude that the oblique is the muscle group that best relates with the term midline.

Learn more here: https://brainly.com/question/19486604

list three ways that organisms use energy

Answers

Answer + Explanation:

Organisms use energy to survive, grow, respond to stimuli, reproduce, and for every type of biological process. The potential energy stored in molecules can be converted to chemical energy, which can ultimately be converted to kinetic energy, enabling an organism to move.

tumors can coerce the formation of blood vessels to serve the cancer cells within the tissue. what is this process called?

Answers

Answer:

Such tumors, unless they secrete hormones, cause few problems. However, most tumors induce the formation of new blood vessels that invade the tumor and nourish it, a process called angiogenesis.

Explanation:

in an otherwise normal cell, what happens if one mistake is made during dna replication?

Answers

Answer:

Most mistakes are corrected, and if they are not, they may result in a mutation, defined as a permanent change in the DNA sequence. Mutations can be of many types, such as substitution, deletion, insertion, and trinucleotide repeat expansions. Mutations in repair genes may lead to serious consequences such as cancer.

Explanation:

How does thermal energy impact the lower layers of atmosphere?

Answers

Answer:

Explanation:

Land and water absorb most of the solar radiation from the sun. Some of this solar energy from land and water is then transferred to the lower atmosphere which is in contact with the continents and oceans. From Land, this occurs mostly as heat energy or infrared radiation. Water usually transfers this energy through the evaporation of water into the atmosphere

why do multicellular organisms have emergent properties

Answers

Answer:

They have more genes than unicellular organisms.

Explanation:

They show properties that can only result from the interaction of many cells.

what is the transfer of energy in the form of electromagnetice waves

Answers

Answer: Electromagnetic radiation.

Explanation: The transfer of energy by electromagnetic waves is called electromagnetic radiation. Electromagnetic waves can transfer energy through matter or across empty space.

Plz help:
b. Compare dominant and recessive traits –
c. Compare pure and hybrid offspring –

Answers

Answer:

b. What is the difference between dominant and recessive traits? Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

c. In the simplest possible terms, purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

Explanation:

Answer:

b. Dominant traits are always expressed when the connected allele is dominant, even if only one copy of the dominant trait exists. Recessive traits are expressed only if both the connected alleles are recessive.

Explanation:

c. purebreds are the offspring that result from mating between genetically similar parents while hybrids are the offspring that are the result of mating between two genetically dissimilar parents.

what are some reasons implicit stereotypes might differ from explicit stereotypes?

Answers

Answer:

Implicit stereotypes are automatically activated and operate indirectly, and thus individuals may not be aware that they possess such beliefs. In contrast, explicit stereotypes are accessible to conscious awareness and are what individuals report when asked about group differences.

Explanation:

Please rate, thank me, have a good day

Implicit stereotypes operate automatically and indirectly, so people may not realize they have them. When asked about group differences, people report explicit stereotypes.

What are stereotypes?

A stereotype is a preconceived notion or combination of traits that many people hold to be indicative of a certain kind of person or object. Stereotypes are traits that society automatically ascribes to particular groups of people in order to categorize them according to factors like age, weight, occupation, skin tone, gender, etc.

Since implicit stereotypes function subtly and automatically, people may not even be aware that they hold such beliefs. Conversely, explicit stereotypes are cognizable and are what people report when questioned about group differences.

Learn more about stereotypes, here:

https://brainly.com/question/2070574

#SPJ2


Please help




I don't know which one is the answer :(​

Answers

Answer:

I believe that your answer is C.

Explanation:

Keep in mind that Steve is working with crops (wheat specifically) and Devan has helped him repair his machinery so that Steve can harvest the wheat properly.

I need some help summarizing the following topics
•Biology Foundations
•Cells
•Energy and Transport
• Reproduction and Cell Division
• Classical Genetics
• Molecular Genetics
• Human Body Systems
• Ecology

Answers

Answer:

guess we were in the same boat I have

Explanation:

Chris to ryx Dr and decor is nuryslam is a day at a retirement party and I have to go to khow about the election results and I we are and decor and I have a lot earlier today

Glycogen is a complex carbon hydrates found in animals true or false?

Answers

Answer:

true

Explanation:

Explanation:

i think true i think please mark me brainlist thank you

which high grade, foliated metamorphic rock has visible crystals?

Answers

Answer:

Gneiss

Explanation:

Gneiss forms at the highest pressures and temperatures and has crystals large enough to see with the unaided eye. Gneiss features minerals that have separated into bands of different colors. The bands of colors are what define foliation within gneiss.

Hope this helps! : )

Gneiss crystals are large enough to be seen without magnification. Gneiss has color-banded minerals. Color bands define gneiss foliation.

What is Gneiss?

The metamorphic rock known as gneiss is quite common and can be found all over the world. It is produced when procedures of high temperature and high pressure metamorphism are applied to formations that are made up of rocks that are either igneous or sedimentary in nature.

Gneiss is formed at temperatures and pressures that are higher than those required to make schist. Gneiss almost always has a banded texture that is defined by alternating darker and lighter colored bands and does not have a clear cleavage. Gneiss may also lack a distinct cleavage.

Gneisses are frequently found in the crust of continental shields that formed in the distant past. Gneisses like the Acasta Gneiss are among the oldest rocks on Earth and are classified as Proterozoic.

Learn more abut Gneisses, here:

https://brainly.com/question/22489042

#SPJ5

what is the name of the tiny air sacs in your lungs?

Answers

Answer:

alveoli

Explanation:

plz answer correctly. thank you.

Answers

Answer:

Mitosis and cytokinesis

Explanation:

Answer:

see below

Explanation:

1) A- Interphase and mitosis

2) Interphase

Help this is due in an hour….

Answers

Answer:

I'm sure it's A

Explanation:

whats the answer ugh

Answers

Answer:

Phalanges: long bones

Sternum: flat bone

Vertebrae: Irregular bone

In recent years, poaching in Africa has declined. Will the decrease of poaching lead to a return of more elephants with tusks in future generations?

Answers

Yes, reducing poaching will help increase the elephant population

Which of the following elements is not a metalloid?

Answers

Answer:

gallium

Explanation:

what hormones are responsible for inducing and regulating labor

Answers

there is one hormone that is responsible for inducing and regulating labor which is Oxytocin

Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

Answers

Answer:

y is there so much letters?

_____ is the process by which energy is stored in inorganic molecules is used to produce carbohydrate food molecules

Answers

Answer:

Chemosynthesis

Chemosynthesis is used to produce food using the chemical energy stored in inorganic molecules.

that is the answer

Photosynthesis is the process by which energy stored in inorganic molecules is used to produce carbohydrate food molecules.

What is photosynthesis?

Photosynthesis is the primary process by which plants, algae, and some bacteria capture and store energy from the sun.

During photosynthesis, light energy is absorbed by pigment molecules in the chloroplasts of plant cells. This energy is then used to convert carbon dioxide (CO2) and water (H2O) into glucose (C6H12O6) and oxygen (O2). The glucose produced during photosynthesis is used by the plant as a source of energy and is also stored as a carbohydrate reserve. The oxygen produced during photosynthesis is released into the atmosphere as a byproduct.

Learn more about photosynthesis, here:

https://brainly.com/question/29764662

#SPJ5

when two strains of bacteria with genotypes abcd and abcd are grown together in the lab, a small number of bacteria with the genotype abcd eventually arise. how does this likely occur?

Answers

Answer:

These enzymes work in two ways. Some are pre-replicative and search the DNA for nucleotides with unusual structures

Explanation:

This happened through a lateral transfer of genes.

We can arrive at this answer because:

Lateral gene transfer is a system for exchanging genetic material between unrelated bacteria.Bacteria are beings that reproduce without the exchange of genetic material, but in some cases, this can be done with the lateral transmission of genes.This transmission can be done through the process of conjugation, translation, or transformation.

The result is that new bacteria are created with a mixture of genes from two unrelated bacteria.

More information:

https://brainly.com/question/848637?referrer=searchResults

A spacecraft can travel 20km/s how many km can this spacecraft travel in 1 hour?

Answers

Answer:

This spacecraft can travel

[tex]72000km[/tex]

These types of consumer relationships can affect the size of prey and plant populations in a community and determine the places these prey and plant species live. For example, certain plants only grow in steep hillside in a habitat because they are eaten near the stream in the valley, or deer live in the forest to better hide from wolves in the open fields.
a. Parasitism and Commensalism
b. Mutualism and Herbivory
c. Predation and Parasitism
d. Predation and Herbivory

Answers

I think the answer is b because the plant would grow on the side of the land because of mulualiam and that is the spreading of seeds in a plant that was left behind

What does costal cartilage connect?

Answers

Answer:

a. Ribs to the sternum

Explanation:

Answer:

Ribs to the sternum

Explanation:

easy question - giving brainly if correct !!​

Answers

Answer:

i think its  C

Explanation:

i would go with c

cells only keep a small amount of _____ on hand and regenerate it as needed using energy stored in carbohydrates and other molecules.

Answers

Answer:

ATP is your answer

Explanation:

what are the two major anatomical subdivisions of the nervous system?

Answers

Answer: The nervous system has two main parts:

The central nervous system is made up of the brain and spinal cord.

The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

Explanation:

Give me an example of seedless vascular plants...​

Answers

Mosses,Hornworts,Liverworts

Explanation:

Seedless vascular plants embrace ferns,Horsetails and club mosses.

Answer:

mosses,liverworts

Explanation:

Other Questions
Can I have help i went someone to answer for me all the questions Based on the excerpt above, what was most likely true about this time in the nations history? Whaling was the most profitable industry for African Americans. Ships were the primary means of transporting goods for African Americans. African Americans were performing the same duties as others without the same rights. More industries were created by African Americans during this period than any other time in our nations history. What step ends translation?A. addition of an amino acid into the growing peptide chainB. separation of mRNA from the ribosome when a stop codon is reachedC. detachment of tRNAs from the ribosomeD. connection of tRNA anticodons with codons on mRNA Complete the second sentences so that it has asimilar meaning to the first one Name the following ionic compounds that contain transition metals. Use the periodic table providedand a chart that lists the possible charges of transition metals, found here.Cucicopper(1) chlorideOcopper chloridecopper(ll) chlorideDONE what is the organ responsible for the production of bile PLS HELP ME ASAPNO LINKS1.What is the probability of rolling an odd number on a 6 sided die2.Eric and 3 friends took turns riding the Beast with each other at Kings Island. If they rode with all others exactly once, how many times did they ride it?3. What is the area of a circle with a radius of 4mm? Use 3.14 for pi.4. Find the median of the following data set.6.2, -5.9, 2.4, 1.8, 8.75. What is the slope from (-1,2) to (2,-2)?6. How many different ways can you write the letters a, b and c in order from left to right? Examine 6 regulatory and supervisory role the Bank of Ghana plays in ensuring that there is sanity in the financial sector of Ghana. plz help i will give brainlyest example of this Negroes placed under the direction or supervision of any other person than a Catholic, are liable to confiscation. Let f(x)=5x^4 and g(x)=e^2x+x. If h is the function defined by h(x)=f(g(x)), which of the following gives a correct expression for h(x)? Tarek will spend at most $26 on gifts. So far, he has spent $14. What are the possible additional amounts he will spend?Use c for the additional amount (in dollars) Tarek will spend.Write your answer as an inequality solved for c. Nucleus is found in...A. prokaryotic cells.B. eukaryotic cells.C. all cells. Whats the answer? ( BRANLIEST ) 5/7 divided by 2/7. Divide Explain how determanating the meaning of a prefix helps to ndrstand the meaning of a word. Whats active and passive sentences? 1. Which of the following deals with the aspects of health and safety in the workplace? A. Mental health B. Occupational health C. Physical health D. Psychosocial health 2. It pertains to an event that may cause harm to an individual, such as chemicals, electricity, open drawers, and inadequate ventilation. A. Disease B. Disorder C. Hazard D. Risk 3. What refers to the possibility of being exposed to dangers, harm, or loss? A. Disease B. Disorder C. Hazard D. Risk 4. What hazard comes from exposure to animals, people, or infectious materials? A. Biological B. Chemical C. Physical D. Psychological 5. Which of the following is NOT an effect of chemical hazards? A. Allergic reactions B. Low self-esteem C. Skin irritation D. Skin or eye burns 6. Which of the following is a life-threatening effect of a psychological hazard? A. Depression B. Deterioration of performance C. Loss of concentration at work D. Loss of self-confidence how many eighths are in 1/3? will mark brainliest Please help, Ill mark your answer as brainliest!