compare the structure of a striated muscle cell with that of a
smooth muscle cell and a cardiac muscle cell.

Answers

Answer 1

The structure of a striated muscle cell differs from that of a smooth muscle cell and a cardiac muscle cell in several ways.

Striated muscle cells, also known as skeletal muscle cells, have a cylindrical shape and are multinucleated. They have a banded appearance due to the presence of sarcomeres, which are the functional units of muscle contraction. These sarcomeres are made up of thick and thin filaments, which are responsible for the striated appearance of the cell.

Smooth muscle cells, on the other hand, have a spindle shape and are uninucleated. They do not have sarcomeres and therefore do not have a striated appearance. Instead, they have a network of actin and myosin filaments that are responsible for contraction.

Cardiac muscle cells are similar to striated muscle cells in that they have sarcomeres and a striated appearance. However, they are branched and have only one or two nuclei. They also have intercalated discs, which are specialized junctions that allow for the coordinated contraction of the heart.

In summary, striated muscle cells have a cylindrical shape, multiple nuclei, and sarcomeres, while smooth muscle cells have a spindle shape, one nucleus, and no sarcomeres. Cardiac muscle cells have a branched shape, one or two nuclei, sarcomeres, and intercalated discs.

You can learn more about striated muscle cell at

https://brainly.com/question/13018987

#SPJ11


Related Questions

Is the lysogenic cycle pathway of gene transduction beneficial
for the virus that induces it? How could this pathway benefit both
the virus and the host bacteria?

Answers

The lysogenic cycle is a pathway of gene transduction that can be beneficial for the virus that induces it. In the lysogenic cycle, the viral DNA is integrated into the host cell's genome and is replicated along with the host cell's DNA. This allows the virus to remain dormant in the host cell for a long period of time, without causing any damage to the host cell. This is beneficial for the virus because it can avoid detection by the host's immune system and can be replicated whenever the host cell replicates.
The lysogenic cycle can also be beneficial for the host bacteria. When the viral DNA is integrated into the host cell's genome, it can provide the host cell with new genetic information that can help the host cell survive in its environment. For example, the viral DNA may contain genes that provide resistance to antibiotics, which can help the host bacteria survive in an environment with high levels of antibiotics. Therefore, the lysogenic cycle can be beneficial for both the virus and the host bacteria.

Read more about microbiology here:https://brainly.com/question/13022613

#SPJ11

during exercise, an individual's stroke volume increases to 140ml
and their heart rate increases to 160 beats min. calculate their
cardiac output to one decimal place in litres.

Answers

During exercise, an individual's stroke volume increases to 140ml and their heart rate increases to 160 beats min. The individual's cardiac output during exercise is 22.4 L/min to one decimal place.

Cardiac output is the amount of blood pumped by the heart in one minute. It is calculated by multiplying stroke volume (the amount of blood pumped by the heart in one beat) by heart rate (the number of beats per minute).
In this case, the stroke volume is 140 mL and the heart rate is 160 beats per minute. To calculate cardiac output, we simply multiply these two values:
Cardiac output = Stroke volume x Heart rate
Cardiac output = 140 mL x 160 beats/min
Cardiac output = 22,400 mL/min
To convert this value to litres, we divide by 1000:
Cardiac output = 22,400 mL/min ÷ 1000
Cardiac output = 22.4 L/min

For more such questions on Cardiac output, click on:

https://brainly.com/question/30762841

#SPJ11

Choose the best definition of catalytic efficiency . A ) kcat B )
Km / kcat C ) kcat /Km

Answers

The best definition of catalytic efficiency is: kcat/km. The correct option is C. Catalytic efficiency refers to the efficiency of enzymes or catalysts to convert a substrate into a product.

It is also defined as the ability of an enzyme to convert a substrate into a product in a unit time. In other words, catalytic efficiency is the ability of an enzyme to convert a substrate into a product per unit time or per enzyme molecule.

Therefore, it is often used to compare the efficiency of different enzymes.The most common way to measure catalytic efficiency is to determine the Michaelis constant (Km) and the catalytic rate constant (kcat).

Michaelis constant is defined as the concentration of substrate required to reach half-maximal velocity (Vmax/2) while catalytic rate constant is defined as the number of substrate molecules converted into product per unit time by a single enzyme molecule.

The catalytic efficiency of an enzyme is determined by calculating the ratio of kcat to Km (kcat/Km). The higher the value of kcat/Km, the greater the catalytic efficiency of the enzyme. This is because the enzyme will be able to convert more substrate into product in a unit time at a lower substrate concentration. Therefore, kcat/Km is often used to compare the catalytic efficiencies of different enzymes.

To know more about enzymes refer here:

https://brainly.com/question/14953274#

#SPJ11

When comparing channel proteins to carrier proteins? a).carrier proteins are more specific but transport solutes at a slower rate b) carrier proteins are more specific and move solutes at higher rates c) channel proteins move solutes based on passive diffusion, while carrier proteins require energy d) channel proteins require energy, while carrier proteins move solutes based on passive diffusion

Answers

The correct answer is channel proteins move solutes based on passive diffusion, while carrier proteins require energy. The correct answer c.

Channel proteins are integral membrane proteins that form channels to allow specific molecules or ions to pass through the membrane by passive diffusion. This means that they do not require energy to transport the solutes.

On the other hand, carrier proteins are also integral membrane proteins, but they bind to specific molecules or ions and transport them across the membrane using energy, in a process called active transport. Therefore, carrier proteins are more specific than channel proteins, but they require energy to transport solutes.

Learn more about passive diffusion:

https://brainly.com/question/28496142

#SPJ11

How do scientist separate the different substances in air?

Answers

Answer:

Explanation:

The method that is used to separate the components of air is called as fractional distillation. This process involves distribution of liquid air through fractional distillation column. This process involves separation of atmospheric air into its primary components like nitrogen and oxygen.

After completing the Animal Genetics Labster, review the Genetic Engineering Animals Article and the videos provided.
As you have learned, double mass cows are products of a mutation as well as selective breeding. Explain how selective breeding has caused this mutation to become more prominent in specific cow breeds. Is selectively breeding cows the same as genetically engineered cows? Explain. Do not rely on your opinion, you should use resources to back up your answers.

Answers

Double muscling in cows is caused by a gene mutation which is further enhanced through selective breeding. This is done by selecting cows which have the gene mutation, and selectively breeding them with other cows that also have the mutation, increasing the chances of the offspring expressing the gene.

This type of breeding is not the same as genetically engineered cows. Genetically engineered cows are artificially created by manipulating the genetic makeup of the cow, while selective breeding relies on the natural genes of the cows.


Genetically engineered cows are created by inserting a gene from one organism into another, which is a process known as recombinant DNA technology. The gene inserted into the cow is either from a different species or from a cow that has been genetically modified to produce the desired trait.

Selective breeding does not involve the manipulation of the cow's DNA, and instead relies on the natural gene pool of the cows being bred to produce the desired result.


Selective breeding has been used for centuries to enhance the desired characteristics of livestock, and this is still a commonly used method today. By selectively breeding cows that have the gene mutation which causes double muscling, the percentage of cows expressing this gene has increased over time, creating cows with double muscling.  

To know more about gene refer here:

https://brainly.com/question/8832859#

#SPJ11

If
I require 19.5 IU / g of an enzyme, does this mean I require 19.5
umol of enzyme to catalyse 1 g of substrate?

Answers

No, 19.5 IU/g of an enzyme does not mean that you require 19.5 umol of enzyme to catalyse 1 g of substrate.

IU stands for International Units, and it is a unit of measurement used to express the activity or potency of a substance, such as an enzyme. One IU is defined as the amount of a substance that produces a specific biological effect under specified conditions.

On the other hand, umol is a unit of measurement used to express the amount of a substance, in this case, an enzyme. Therefore, 19.5 IU/g of an enzyme refers to the activity or potency of the enzyme required to catalyse 1 g of substrate, not the amount of enzyme required.

To know more about unit of measurements click here:

https://brainly.com/question/8240794

#SPJ11

Please identify all of the tissues on the following list that fall under the category of nervous tissue. a. nervous tissue b. smooth muscle c. skeletal muscle d. cardiac muscle e. simple squamous epit

Answers

The tissues that fall under the category of nervous tissue are 'a. nervous tissue.

A tissue can be described as a group of cells with similar structures and functions. For example, nervous tissue consists of nerve cells and associated cells known as glial cells. Epithelial tissues include surface tissues such as the skin, as well as secretory and absorptive tissues such as those that line the digestive system. Connective tissues provide support, fill spaces, and protect organs, whereas muscle tissues have the capability to contract and allow for movement.

Learn more about nervous tissues at brainly.com/question/17161555

#SPJ11

A cross between a 3-eyed alien and a 1-eyed alien produces offspring that have two eyes. If two two-eyed aliens cross, what is the percent chance of having a two eyed offspring? (use E and e)

Answers

If you cross 2 two-eyed aliens using Ee for each you will get this in the Punnett Square:
There will be a 50% of a two eyed alien when two heterozygous aliens cross :)

When a solute is filtered but is neither reabsorbed nor secreted, its concentration in urine can be correlated with the renal processing of a volume of plasma referred to as?

Answers

When a solute is filtered but is neither reabsorbed nor secreted, its concentration in urine can be correlated with the renal processing of a volume of plasma referred to as the glomerular filtration rate (GFR).

The filtration fraction is the portion of plasma that is filtered through the glomerulus and into the nephron to become urine. It is calculated by dividing the glomerular filtration rate (GFR) by the renal plasma flow (RPF).

Filtration fraction = GFR / RPF
The filtration fraction is an important measure of kidney function, as it indicates how much plasma is being filtered and how efficiently the kidneys are working. A higher filtration fraction indicates that a larger portion of plasma is being filtered, while a lower filtration fraction indicates that a smaller portion of plasma is being filtered.

Here you can learn more about glomerular filtration rate (GFR)

https://brainly.com/question/28234212#

#SPJ11

How do microorganisms contribute to the process of decomposition?

-:---:--

Responses

They break down organic matter into smaller molecules.
They break down organic matter into smaller molecules.

They release oxygen into the environment.
They release oxygen into the environment.

The convert inorganic matter into organic matter.
The convert inorganic matter into organic matter.

They attract other decomposers to the site.

Answers

They break down organic matter into smaller molecules

Characteristics of transformed cells can include all of the
following EXCEPT:
A) ability to differentiate into different cell types.
B) tight junctions.
C) aneuploidy.
D) presence of integrated viral

Answers

The characteristics of transformed cells can include all of the following EXCEPT the ability to differentiate into different cell types.

The correct answer is option A.

Cells that have changed irreversibly, resulting in unrestricted cell proliferation, invasion, and metastasis, as well as other modifications such as increased rates of DNA synthesis, reduced cell-to-cell communication, and modified cell surface properties, are known as transformed cells. They're generally tumorigenic and capable of forming tumors when injected into animals or cultured in vitro. Transformed cells' features can include a wide range of characteristics, such as aneuploidy, the presence of integrated viral DNA, and the ability to grow without attachment to a substrate, among others.

The correct option from the given choices is option A because the ability to differentiate into different cell types is not a characteristic of transformed cells. In the process of differentiation, stem cells become distinct cell types with specialized functions, such as muscle cells, bone cells, and nerve cells, among others. Transformed cells, on the other hand, can no longer differentiate into different cell types due to the alterations that have occurred in their genomes.

Learn more about transformed cells at https://brainly.com/question/27795628

#SPJ11

Depending on environmental conditons, aphids may develop wings
and be able to fly, or remain wingless for life. This indicates
that wing development/non-development in aphids is... select all
that app

Answers

Depending on environmental conditions, the indications that aphids may develop wings and be able to fly, or remain wingless for life is a developmental plasticity and a polyphenic trait.

Thus the correct answers are a developmental plasticity (A) and a polyphenic trait (D).

Aphids have the ability to develop wings or remain wingless for life implying that aphid wing development is a polygenic trait because it is determined by the interplay of many genes.  An aphid can only fly if it has wings, so the development of wings in aphids is influenced by both genetic and environmental factors.

Therefore, wing development/non-development in аphids is а polyphenic trаit becаuse it is аn exаmple of one genotype producing multiple phenotypes depending on environmentаl conditions. It is аlso а developmentаl plаsticity becаuse the phenotype is not fixed but cаn chаnge during development in response to environmentаl cues.

Your question is incomplete, but most probably your options were

A. a developmental plasticity

B. an acclimation

C. phenotypic modulation

D. polyphenic trait

Thus, the correct options are A and D.

For more information about developmental plasticity refers to the link: https://brainly.com/question/7205966

#SPJ11

Number the steps in the order in which they occur, showing the responses of the endocrine and
nervous systems to dehydration.
10. ADH travels in the blood to the kidneys.
11. ADH bonds to receptors on kidney cells.
12. The water in urine decreases; the water in the blood increases.
13. The kidneys reabsorb more water.
14. The hypothalamus releases ADH.
15. The water level in the body is low.

Answers

The correct order of the steps in the response of the endocrine and nervous systems to dehydration is:

1. The water level in the body is low. (15)
2. The hypothalamus releases ADH. (14)
3. ADH travels in the blood to the kidneys. (10)
4. ADH bonds to receptors on kidney cells. (11)
5. The kidneys reabsorb more water. (13)
6. The water in urine decreases; the water in the blood increases. (12)

Therefore, the correct order of the steps is: 15, 14, 10, 11, 13, 12.

It is important to note that the endocrine and nervous systems work together to maintain homeostasis in the body. In the case of dehydration, the endocrine system releases the hormone ADH, which signals the kidneys to reabsorb more water and increase the water level in the blood. The nervous system also plays a role in this process, as the hypothalamus is responsible for releasing ADH in response to low water levels.

Learn more about endocrine and nervous systems at: https://brainly.com/question/20910888

#SPJ11

Sodium Nitrite A. Amutation that reversos a loss-offunction mutation, thereby restoring that Acridine Orange furction. Spontaneous mutation rate Q. Used to determine if a substance is contaminated with prototrophic Methyl Methanesulfonate (MMS) bacteria. To prepare this plate, no top agar (aka no supplemental Dimethyl Sulfoxide (DMSO) growth compounds/no amino acids) is added before adding the substance of interest. Sterility Control Plate C. The plates to which no mutagenic substance is added, such as the Negative Control Plate plates with only water or only DMSO. These plates show the spontaneous mutation rates. Reverse mulation D. The rate of mutations that occur in the absence of a mutagen, such as the number of colonies on the negative control plate. E. A substance that is known to cause mutations. Because it is a known mutagen, it is used on the positive control plate. F. Changes the identity of a nucleotice at a single point. In other words, this substance induces point (also called base pair substitution) mutations. 6. A substance that is miscible in a variety of organic solvents as well as water. It will be used to dissolve any substances that are insoluble in water. H. Causes insertions and/or deletions in the dsDNA helix. In other words, this substance induces frameshift (also called indel) mutations.

Answers

A. Spontaneous mutation: The rate of mutations that occur in the absence of a mutagen, such as the number of colonies on the negative control plate.
B. Methyl Methanesulfonate (MMS): A substance that is known to cause mutations. Because it is a known mutagen, it is used on the positive control plate.
C. Negative Control Plate: The plates to which no mutagenic substance is added, such as the plates with only water or only DMSO. These plates show the spontaneous mutation rates.
D. Reversion: A mutation that reverses a loss-of-function mutation, thereby restoring that function.
E. Acridine Orange: Used to determine if a substance is contaminated with prototrophic bacteria. To prepare this plate, no top agar (aka no supplemental growth compounds/no amino acids) is added before adding the substance of interest.
F. Sodium Nitrite: A substance that is miscible in a variety of organic solvents as well as water. It will be used to dissolve any substances that are insoluble in water.
G. Point mutation: Changes the identity of a nucleotide at a single point. In other words, this substance induces point (also called base pair substitution) mutations.
H. Frameshift mutation: Causes insertions and/or deletions in the dsDNA helix. In other words, this substance induces frameshift (also called indel) mutations.

More terms on mutation: https://brainly.com/question/13254694

#SPJ11

6
Explain how fossils provide information about extinct
pecies. List 5-8 specific facts to support this claim.



HELP PLEASE (I will give brainleist) (middle school work)

Answers

ANSWER:

Fossils are the remains or traces of plants and animals that live a long time ago. Fossils help scientists understand what life was like millions of years ago. Some fossils provide evidence of living things that have gone extinct, which means they no longer found alive anywhere on earth today.

HOPE THIS IS HELP FULL <3

Fantastic Beasts Genetic Workshop

Answers

The evolutionary analysis toolkit BEAST for dna sequence variation is strong and adaptable.

What is DNA of a beast?

A cross-platform application called BEAST uses MCMC to perform Bayesian analysis on molecular sequences. It is completely focused on rooted, time-measured phylogenies deduced from either rigid or flexible molecular clock models.

What is phylogenetics for beasts?

Software for doing Bayesian phylogenetic & phylodynamic analyses is available under the name Bayesian Evolutionary Analysis through Sampling Trees (BEAST). BEAST uses the Monte Carlo (MCMC) algorithm to sample from the probability density for trees (or networks) with parameters given given input data.

To know more about Beasts Genetic visit:

https://brainly.com/question/30812121

#SPJ1

What enzyme (or chemical method) was used on Protein Example #1 to make the B fragments?
a. trypsin
b. chymotrypsin
c. V8 protease
d. asp-N-protease
e. pepsin
f. cyanogen bromide
"B" Fragments – Protein #1
B-1) D
B-2) A L E
B-3) Y G A E
B-4) V L S P A D
B-5) L H A H K L R V D
B-6) A L T N A V A H V D
B-7) F T P A V H A S L D
B-8) M P N A L S A L S D
B-9) K F L A S V S T V L T S K Y R
B-10) K T N V K A A W G K V G A H A G E
B-11) L S H G S A Q V K G H G K K V A D
B-12) R M F L S F P T T K T Y F P H F D
B-13) P V N F K L L S H C L L V T L A A H L P A E

Answers

The enzyme Trypsin was used to make the "B" fragments of Protein Example #1.

Trypsin is a protease enzyme that specifically cleaves peptide bonds between the carboxyl side of the amino acids lysine and arginine. It works by hydrolyzing the peptide bonds and splitting the protein into smaller peptides, which are then known as the "B" fragments.

The Trypsin enzyme breaks down the peptide bonds at these amino acids, which then releases the "B" fragments from Protein #1, which are listed as DB-2 through DB-13 in the question.

To know more about enzymes, refer here:

https://brainly.com/question/14953274#

#SPJ11

Consider a study testing whether birds were equally likely to rest on each streetlight. Researchers surveyed 30 randomly chosen streetlights in a city known to have many birds and counted the number of birds resting on each streetlight Data on the number of birds seen on the lights are shown. (Note: No lights had more than three birds.) What is the mean number of birds observed on each light? Number Number birds of lights 0 3 1 12 2 9 23 6 O 1.60 O 2.00 O 1.40 1.80

Answers

The mean number of birds observed on each light is 1.6.

To find the mean number of birds observed on each light, we need to use the formula for the mean, which is the sum of all the observations divided by the number of observations. In this case, the observations are the number of birds seen on each light and the number of observations is the number of lights.

First, we need to find the sum of all the observations. We can do this by multiplying the number of birds by the number of lights for each observation and adding them together:

0 birds * 3 lights = 0
1 bird * 12 lights = 12
2 birds * 9 lights = 18
3 birds * 6 lights = 18

Sum of observations = 0 + 12 + 18 + 18 = 48

Next, we need to divide the sum of the observations by the number of observations. In this case, the number of observations is the number of lights, which is 30:

Mean = 48 / 30 = 1.6

To know more about mean number click on below link:

https://brainly.com/question/21800892#

#SPJ11

1. Describe the following experiments, AND the specific contribution of each experiment towards identifying DNA as the genetic material (THIS IS NOT A MULTIPLE CHOICE QUESTION):
(a) Griffiths
(b) Avery, McCarty, and MacLeod
(c) Hershy and Chase
(d) Meselson and Stahl
(e) Nuremberg and Matthei

Answers

a) Griffiths' experiment demonstrated that the genetic material responsible for the transformation of one strain of bacteria to another was contained in a certain group of proteins. He studied two strains of the bacteria Streptococcus pneumoniae, one of which was virulent and caused death, and the other was harmless.

He heat-killed the virulent strain, and then injected it into the harmless strain. The harmless strain was then transformed into the virulent strain. This experiment demonstrated that a certain group of proteins contained the genetic material responsible for the transformation.


b) Avery, McCarty, and MacLeod's experiment studied the same two strains of Streptococcus pneumoniae studied by Griffiths. They used a technique called bacterial extract fractionation to isolate and study the components of the bacteria's extract. They found that the genetic material responsible for transformation was DNA, not proteins, as Griffiths had suggested. This experiment identified DNA as the genetic material.

c) Hershey and Chase's experiment studied bacteriophages, which are viruses that infect bacteria. They used radioactive sulfur and phosphorus to trace the movement of the genetic material within the infected bacteria. The results demonstrated that the genetic material was DNA, not proteins.

d) Meselson and Stahl's experiment studied E. coli bacteria and studied how DNA replicated. They used a technique called density-shift centrifugation to separate the newly replicated DNA from the original DNA. The results demonstrated that DNA replicated semi-conservatively, meaning that the new strands of DNA contained both strands of the original strand.

e) Nuremberg and Matthei's experiment studied bacteria and studied the mechanism of genetic recombination. They found that genetic recombination was mediated by a process called homologous recombination, which is when strands of DNA pair up and exchange sections of their sequences. This experiment demonstrated the role of DNA in genetic recombination.

To know more about genetic refer here:

https://brainly.com/question/12985618#

#SPJ11

Carbon dioxide containing carbon- 14 is intorduced into a balanced aquarium ecosystem after several weeks carbon,- 14 will most likely be present in

Answers

Answer:

In an aquarium ecosystem, carbon dioxide is taken up by photosynthetic organisms such as plants and algae, which use it to build organic molecules. These organisms are then consumed by other organisms in the food chain, leading to a transfer of carbon through the ecosystem.

If carbon dioxide containing carbon-14 is introduced into the ecosystem, it will be taken up by the photosynthetic organisms just like any other carbon dioxide. As these organisms build organic molecules, they will incorporate carbon-14 into their tissues. When these organisms are consumed by other organisms, the carbon-14 will be transferred up the food chain.

After several weeks, it is likely that carbon-14 will be present in all levels of the aquarium ecosystem, from the photosynthetic organisms at the base of the food chain, to the highest level predators. However, the exact amount and distribution of carbon-14 within the ecosystem will depend on factors such as the rates of photosynthesis and respiration, the turnover rates of the different organisms, and the overall structure of the food web.

Explanation:

Why does respiration involves going from highly reduced to
highly oxidized carbon compounds. And Why do C-H bonds have more
potential energy than C-O bonds?

Answers

Respiration involves the oxidation of organic compounds, meaning that the molecules are broken down from a highly reduced state (with many hydrogen atoms present) to a highly oxidized state (with few or no hydrogen atoms present). This oxidation process releases energy that can be used by cells to carry out other functions.

The potential energy of a C-H bond is higher than a C-O bond because the carbon-hydrogen bond is more covalent (sharing electrons more equally) and therefore more stable than the carbon-oxygen bond. This means that when breaking the carbon-hydrogen bond, more energy is released than when breaking the carbon-oxygen bond.

Here you can learn more about Respiration

https://brainly.com/question/18024346#

#SPJ11

What challenges would one face when funding and implementing a
public health program such as for climate change and funding to
fight fast food? How would we deal with those challenges?

Answers

When funding and implementing a public health program such as for climate change and funding to fight fast food, the main challenges are the amount of resources available and finding a way to implement the program that will be effective.

To deal with these challenges, it is important to have a well-thought out plan that is cost-effective and will maximize the impact of the program.

It is also important to have stakeholders that are involved in the program and can provide feedback to ensure that the program is successful.

Additionally, it is important to consider potential obstacles that could arise and how to address them.

To know more about climate change click on below link:

https://brainly.com/question/28779953#

#SPJ11

The Hardy-Weinberg model makes the following assumptions for a population that is in equilibrium: (check any/all that are correct).
Please answer for a good rating
A. gene flow / migration is happening between populations
B. no new mutations occur to change frequencies of existing alleles
C. no natural selection occurs
D. mating is random with respect to one individual versus another
E. the population is so large that allele frequencies do not change by chance (no genetic drift is happening)
F. mechanisms of evolutionary change are affecting the population
G. evolutionary mechanisms are not acting on the population
H. gametes combine randomly with one another with respect to any given allele to produce offspring

Answers

The Hardy-Weinberg model assumes the following for a population that is in equilibrium:
A. gene flow / migration is happening between populations
B. no new mutations occur to change frequencies of existing alleles
C. no natural selection occurs
D. mating is random with respect to one individual versus another
E. the population is so large that allele frequencies do not change by chance (no genetic drift is happening)

In other words, the Hardy-Weinberg model assumes that evolutionary mechanisms (F) are not acting on the population (G) and that gametes combine randomly with one another with respect to any given allele to produce offspring (H).

Here you can learn more about Hardy-Weinberg model

https://brainly.com/question/30799821#

#SPJ11

7. Identify Molecules X, Y, and Z. Describe how each molecule contributes to the

development of an organism.

MM

Molecule X

a) Name of Molecule X

b) Name of Molecule Y

c) Name of Molecule Z

d) Function of Molecule X

e) Function of Molecule Y

f) Function of Molecule Z

Molecule Y

Molecule Z

8. How are genes involved in the production of proteins?

Answers

8. Genes provide the genetic code or instructions for the production of proteins in cells.

How are genes involved in the production of proteins?

The genetic code is a sequence of nucleotides (A, T, C, and G) that make up the DNA molecule. This code is transcribed into a messenger RNA (mRNA) molecule by a process called transcription. The mRNA carries the genetic code from the nucleus to the ribosomes in the cytoplasm, where the process of translation occurs.

During translation, the genetic code carried by the mRNA is used to synthesize a specific sequence of amino acids, which are then linked together to form a protein. The sequence of amino acids determines the shape, function, and properties of the protein. The genetic code is read in sets of three nucleotides called codons, with each codon corresponding to a specific amino acid. There are 20 different amino acids that can be combined in different ways to form proteins with diverse functions.

Read more on genes here:https://brainly.com/question/1480756

#SPJ1

list 15 genetically modified crops that are approved and cultivated
in the USA, and please explain what traits are modified for each
crop.

Answers

15 genetically modified crops that are approved and cultivated in the USA,

1. Corn: Modified for herbicide tolerance, insect resistance, and increased yield.
2. Soybeans: Modified for herbicide tolerance, increased yield, and improved oil profile.
3. Cotton: Modified for herbicide tolerance, insect resistance, and increased yield.
4. Canola: Modified for herbicide tolerance and improved oil profile.
5. Sugar beets: Modified for herbicide tolerance and increased sugar content.
6. Alfalfa: Modified for herbicide tolerance and increased yield.
7. Papaya: Modified for virus resistance.
8. Squash: Modified for virus resistance and improved shelf life.
9. Potatoes: Modified for insect resistance, virus resistance, and improved shelf life.
10. Apples: Modified for improved shelf life and reduced browning.
11. Eggplant: Modified for insect resistance.
12. Rice: Modified for increased yield, drought tolerance, and improved nutrient content.
13. Tomatoes: Modified for improved shelf life, disease resistance, and improved nutrient content.
14. Sweet peppers: Modified for insect resistance and improved nutrient content.
15. Plums: Modified for virus resistance.

For such more questions on  genetically modified:

brainly.com/question/9530929

#SPJ11

Read the AMA Code of Ethics created in 1847 and the current AMA Code of Ethics. Focus on the ART. I. Duties of the profession to the public (1847) & Physicians & the Health of the Community (Current AMA) & Compare and contrast. Write one paragraph.

Answers

The AMA Code of Ethics from 1847 and the current AMA Code of Ethics both focus on the duties of the profession to the public and the health of the community.

However, there are some notable differences between the two codes. The 1847 Code of Ethics emphasizes the importance of maintaining the "dignity and honor" of the profession, and includes specific guidelines for physicians to follow in their relationships with patients, colleagues, and the public. The current AMA Code of Ethics, on the other hand, places a greater emphasis on the role of physicians in promoting public health and addressing social determinants of health. It also includes more detailed guidelines for ethical conduct in areas such as research, medical education, and business practices. Overall, the current AMA Code of Ethics reflects the evolving role of physicians in modern healthcare and the need for ethical guidance in a complex and rapidly changing medical landscape.

Learn more about Physicians & the Health here:https://brainly.com/question/30026755

#SPJ11

Pectoralis MajorConcentrically accelerates shoulder flexion (clavicular fibers), horizontal adduction, and internal rotationEccentrically decelerates shoulder extension, horizontal abduction, and external rotationIsometrically stabilizes the shoulder girdle

Answers

The Pectoralis Major is a large muscle located in the upper chest, responsible for many movements in the shoulder joint. It is composed of two parts: the clavicular fibers, which are located on the top of the muscle, and the sternal fibers, which are located on the bottom.

During concentric contraction, the Pectoralis Major is responsible for accelerating shoulder flexion (clavicular fibers), horizontal adduction, and internal rotation. This means that the muscle is shortening as it contracts, allowing for these movements to occur.
During eccentric contraction, the Pectoralis Major is responsible for decelerating shoulder extension, horizontal abduction, and external rotation. This means that the muscle is lengthening as it contracts, allowing for these movements to occur in a controlled manner.
During isometric contraction, the Pectoralis Major is responsible for stabilizing the shoulder girdle. This means that the muscle is contracting without any change in length, allowing for the shoulder girdle to remain stable during movement.
For more such questions on Pectoralis major, click on:

https://brainly.com/question/13780760

#SPJ11

1. Explain why the higher temperature results in greater absorption?
2. Make a hypothesis on how the pH of the solution would affect membrane fluidity.
3. What cholera is and how it could cause someone to die?
4. Explain at the cellular level how the cholera bacterium causes diarrhea ?

Answers

1. When the temperature is higher, the rate of absorption of particles is also higher, as molecules move around faster in higher temperatures.

2. It is hypothesized that as the pH of the solution increases, the membrane fluidity of the cell increases as well.

3. Cholera is an infectious disease caused by a bacterium called Vibrio cholerae can cause dehydration and diarrhea, leading to death if left untreated.

4. Cholera bacterium produces a toxin that disrupts the cell's ability to regulate water and ion concentrations in the intestinal lining which leads to excessive water loss from the body, resulting in diarrhea.

Cholerа is аn аcute diаrrhoeаl infection cаused by ingestion of food or wаter contаminаted with the bаcterium Vibrio cholerаe. Cholerа remаins а globаl threаt to public heаlth аnd аn indicаtor of inequity аnd lаck of sociаl development.

Cholerа is аn extremely virulent diseаse thаt cаn cаuse severe аcute wаtery diаrrhoeа. It tаkes between 12 hours аnd 5 dаys for а person to show symptoms аfter ingesting contаminаted food or wаter. Cholerа аffects both children аnd аdults аnd cаn kill within hours if untreаted.

For more information about cholerа refers to the link: https://brainly.com/question/15871014

#SPJ11

What are all of the products going into a Glycosome of African
trypanosomes and what are all the products going out of a
Glycosome?

Answers

Al the products going in and out of glycosome of African trypanosomes are as: The products going into a Glycosome of African trypanosomes include glucose and other sugars, while the products going out of a Glycosome include ATP, pyruvate, and other metabolites.

What is a Glycosome? A glycosome is a specialized type of peroxisome that is found in some unicellular eukaryotic organisms, such as trypanosomes. It is a vital structure for trypanosomes, as it is responsible for their energy production. Glycosomes play a significant role in the breakdown of glucose by glycolysis, which generates ATP. The Glycosomes of Trypanosomes are where the glycolytic pathway takes place, in which glucose is converted into ATP, which is the primary source of energy for cells. The breakdown of glucose occurs in the cytoplasm, which is a much more complicated process than merely converting glucose to ATP.

Glucose is converted to pyruvate in a series of biochemical reactions known as glycolysis, which takes place in the cytoplasmic matrix. After that, pyruvate is then metabolized in the mitochondrial matrix to generate ATP by oxidative phosphorylation. However, in trypanosomes, the entire process takes place within the glycosome. Glycosomes are believed to be the primary source of ATP for trypanosomes. They are also involved in the synthesis of many other critical metabolites, including amino acids and fatty acids.

Learn more about Glycosomes at brainly.com/question/13989523

#SPJ11

Other Questions
what was john tagg main idea in why we learn Write the equation. The Iowa candidate got 6 times as many votes as the Ohio candidate. The Ohio candidate got 850 votes. How many votes did the Iowa candidate get? Record yourself giving a performance of as much of "Chatter at a Royal Ball" as you cminutes if you need, and when you are ready, just click on the record button. You canREPLAY.*Note: This is a practice activity. Completing this activity will not only prepare you forimportantly, it will enhance your language ability. This activity will not count towards yo The U.S. Defense Authorization Act was released shortly after a video meeting between U.S. President Joe Biden and Russian President Vladimir Putin. As far as China is concerned, the bill includes $7.1 billion in funding for the Pacific Deterrence Program and a so-called statement by the U.S. Congress to "support Taiwan's defense." A spaceship traveling at 0. 5 relative to Earth is 45 m long as measured by its crew. How long is the spaceship as measured by the mission control in Texas? Can someone help me to answer these 4 questions in order pleasehere is the picture 5) If x-3a+x-3b=x-3c then prove that x = (a+b+c) 2a + b + c-ab-bc-ca Determine the number of solutions to the system of linear equations shown on the graph.coordinate plane with one line that passes through the points negative 1 comma 4 and 0 comma 1 and another line that passes through the points 0 comma negative 1 and 2 comma negative 3 One solution at (1, 2) One solution at (2, 1) Infinitely many solutions No solution EASY MATH POINTS!Answer from the screenshot below :) 4+-2=5 what is the answer A deli uses rye bread for (4)/(5) of the sandwiches ordered. Of those, (1)/(3) are ham sandwiches. What fraction of all the sandwiches that the deli makes is a ham sandwich on rye bread? Discuss 6 ways a promoter can avoid personal liability for contracts entered into the company coming into existence. Converting feet and inches 4 feet and 11 inchespls help me Explain primary data. Why would a marketer utilize this form ofdata? Provide a few examples of primary data sources. Suppose that (Yi, Xi) satisfy the least squares assumptions in Key Concept 4. 3 and, in addition, ui is N(0, 2 u) and is independent of Xi. A sample of size n = 30 yields = 43. 2 + 61. 5X, R2 = 0. 54, SER = 1. 52, (10. 2) (7. 4) where the numbers in parentheses are the homoskedastic-only standard errors for the regression coefficients. a) Construct a 95% confidence interval for 0. b) Test H0: 1 = 55 vs. H1 : 1 55 at the 5% level. c) Test H0: 1 = 55 vs. H1 : 1 > 55 at the 5% level 2. (a) Analyze What motivation fuels Martin's initial feelings aboutGrandpa? (b) Assess How does it affect his behavior? (c) AnalyzeWhat events occur that change Martin's motivation and behavior?3. (a) Analyze What conflict does Martin face? (b) How does he resolvethis conflict?4. (a) Analyze What does Martin come to realize in this story? Explain.(b) Interpret What theme, or insight about life, do Martin's conflictand the story's resolution help to convey? Explain. CO(g) + Cl (g) = COCh2 (g)If Ke 5.0 at 600 K for this reaction, what are the equilibrium partial pressures of the three gasesif a reaction vessel initially contains a mixture of the reactants in which Pco = Pc2=0.265 atmand there is no COCl? A stretch of DNA thought to be involved with cancer suppression is sequenced and compared amongst people who have succumbed to cancer and those that have not. It is believed that the region encodes a protein of some sort. Identify the type of mutation and its effect on the protein.Normal individual : (wild type) 5'CACATGAACGAGCCCTTTGCGAGTGACTA3'Cancer patient 1 5' CACATGAACGAGCCTTTTGCGAGTGACTA 3'Cancer patient 2 5' CACATGAACGAGCCCTTTTGAGAGTGACTA 3' What is the fluid found within the body's cells called? Why was the acquisition of land so critical for the newly freed slaves?A. Without land, freedmen were not allowed to hold officeB. Without land, freedmen were not allowed to voteC. Without land, freedmen would be unable to generate their own incomeD. Without land, freedmen could only enter the economy as laborers or craftsmen