comparative genomics involves which two of the following types of analysis? multiple select question. in silico translation of nucleic acids metabolomics protein-protein sequence comparisons dna-dna sequence comparisons

Answers

Answer 1

Comparative genomics involves DNA-DNA sequence comparisons and protein-protein sequence comparisons.

Comparative genomics is the comparative analysis of genomic sequences across various species. It includes the recognition of similarities and variations in gene sequence and structure among different species.

Comparative genomics can also be used to discover the roles of genes and non-coding regions of DNA, as well as the patterns of genome evolution in various species. The primary focus of comparative genomics is on understanding the molecular basis of differences between species that contribute to functional, structural, and phenotypic diversity.

A DNA-DNA sequence comparison is a technique that is used to identify similarities and differences between DNA sequences from various organisms. It can be used to look for mutations, SNPs, and gene regulatory sequences that are shared among different species.

Protein-protein sequence comparisons are used to determine the evolutionary and functional relationships between proteins from different species. Protein-protein sequence comparisons are used to identify shared domains, regions of structural similarity, and regions of functional similarity.

Know more about genomics here:

https://brainly.com/question/29514980

#SPJ11


Related Questions

Main idea about WWI ( in your own words)

Answers

Answer:World War 1 was known as the Great War and was a global war that started in Europe and would eventually take in many nations throughout the world. It lasted from July 29, 1914, to November 11, 1918, and led to more than 70 million military personnel being deployed throughout the world.

Explanation:

Which of the following clues would tell you whether a cell is prokaryotic or eukaryotic?
A. the presence or absence of a rigid cell wall
B. whether or not the cell is partitioned by internal membranes
C. the presence or absence of ribosomes
D. whether or not the cell contains DNA

Answers

A correct answer is (B) - whether or not the cell is partitioned by internal membranes. Prokaryotic cells do not have internal membranes, while eukaryotic cells do.

Prokaryotic cells are one of the two types of cells that make up living things. Prokaryotic cells are found in bacteria and archaea, two groups of microorganisms. These cells lack a nucleus, and their genetic material is found in a single loop of DNA.

Eukaryotic cells, which are found in plants, animals, fungi, and protists, are the second type of cells. Unlike prokaryotic cells, eukaryotic cells have a nucleus that houses their genetic material (DNA). They are also typically much larger and have more complicated internal structures than prokaryotic cells.

They're much more difficult to break down than prokaryotic cells because they have more robust cell walls, which provide an additional layer of protection against damage.

Know more about internal membranes here :

brainly.com/question/12115540

#SPJ11

if you were to examine a mature ecosystem over the course of 30 years at the same time each year, would you expect the number of species and the population size of each species to be the same from year to year? why or why not?

Answers

Answer: An ecosystem is constantly changing so the number species and the population size of each would change too.

Explanation: There is a delicate balance in an ecosystem. There are many factors that can change the number of species in the area such as natural disasters which in turn can change any effected species population sizes.

can someone help me please

Answers

Answer:

1, cellular respiration

2. Energy for cells

3. Oxygen

4. Mitochondria

5. Chloroplast

6. Sugars/Glucose

7. Carbon Dioxide + Water

8. Oxygen

9. Photosynthesis

10. Energy from sunlight

Explanation:

heavy dna ( n15 dna), hybrid dna, and light dna ( n14 dna) can be separated by centrifugation. if cells containing n15 dna are transferred to a medium with only n14 nh4cl as a nitrogen source, what percent of daughter molecules are composed of hybrid dna after 2 generations?

Answers

The proportion of hybrid DNA after two generations is 25%.

To create hybrid DNA, a culture of E.coli bacteria was grown on media containing NH3 with nitrogen-15 as the only nitrogen source. After only one generation, this culture was shifted to ([tex]NH_{4} Cl[/tex]) -containing media, allowing the nitrogen-15 to be replaced with nitrogen-14. It takes about two generations for the entire population to have 50% hybrid DNA and 50% light DNA.A 50:50 hybrid DNA/light DNA population of E. coli was produced as a result of the initial culture transfer to the lighter nitrogen source ([tex]NH_{4} Cl[/tex]). Because one parent strand in each daughter strand of a hybrid DNA molecule is light (N14) and the other is heavy ([tex]N_{15}[/tex])  ,hybrid DNA can be distinguished from heavy or light DNA by density gradient centrifugation.

The first generation of bacteria that grows in the ([tex]NH_{4} Cl[/tex]) -containing medium contains one heavy ([tex]N_{15}[/tex]) and one light ([tex]N_{15}[/tex]) DNA strand in each cell, with the heavy strand labeled. The second generation will have hybrid DNA, with half of each double helix containing one ([tex]N_{15}[/tex]) and one ([tex]N_{14}[/tex]) strand and the other half containing two  ([tex]N_{14}[/tex]) strands.

Hence, The proportion of ([tex]N_{14}[/tex]) strand DNA at the end of 2nd generation is 75% and that of ([tex]N_{15}[/tex]) is 25%. This means that the proportion of hybrid DNA at the end of 2nd generation is 25%.

To know more about DNA refer here :

https://brainly.com/question/16099437

#SPJ11

what method of attempting to reduce alternate bearing in citrus has not produced positive results? why

Answers

Pruning has not produced positive results in attempting to reduce alternate bearing in citrus.

Alternate bearing is a phenomenon where a fruit tree produces a large crop of fruit one year, followed by a smaller crop or no fruit at all the next year. This can be a problem for citrus growers, as it can lead to fluctuations in yield and income. Various methods have been tried to reduce alternate bearing in citrus, including pruning, which involves removing some of the fruit and branches from the tree.

However, pruning has not produced consistent positive results in reducing alternate bearing, as it can sometimes stimulate new growth and lead to even more fruit the following year. Other methods such as chemical treatments and cultural practices have shown more promise in reducing alternate bearing in citrus.

To learn more about Alternate bearing, here

https://brainly.com/question/2584109

#SPJ4

indicate how the following tissues should be oriented in the molds (embedded:
a. Gall bladder
b. vas deferens
c. fallopian tube
d. colon segment
e. femoral artery

Answers

The Gall bladder, Vas Deference, fallopian tube and femoral artery should be embedded longitudinally, with its longest axis parallel to the long axis of the mold.

The colon segment is embedded transversely, with a cross-section of the colon perpendicular to the bottom of the mold.

a. Gall bladder: The gall bladder should be embedded longitudinally, with its longest axis parallel to the long axis of the mold.

b. Vas deferens: The vas deferens should be embedded longitudinally, with its longest axis parallel to the long axis of the mold.

c. Fallopian tube: The fallopian tube should be embedded longitudinally, with its longest axis parallel to the long axis of the mold.

d. Colon segment: The colon segment should be embedded transversely, with a cross-section of the colon perpendicular to the bottom of the mold.

e. Femoral artery: The femoral artery should be embedded longitudinally, with its longest axis parallel to the long axis of the mold.

Click the below link, to learn more about the Embedment of tissues:

https://brainly.com/question/14728459

#SPJ11

in africa, lake victoria is home to many distinct species of cichlid fish that vary in color from blue to red. cichlid fish species that live in shallow water are blue and prefer to mate with other blue fish, whereas cichlid fish species that live in deep water are red and prefer to mate with other red fish. all of the cichlid fish species evolved from a single ancestrial species and live together in the same habitat. the cichlid fish in lake victoria are an example of which type of speciation? sympatric speciation allopatric speciation parapatric speciation adaptive radiation

Answers

The cichlid fish in Lake Victoria is an example of Sympatric speciation.

Sympatric speciation refers to a type of speciation that occurs when two different species arise from a single ancestral population that lives in the same geographical area. It happens when the two species coexist in the same geographical area and develop a reproductive barrier, preventing interbreeding.

Sympatric speciation, as the term implies, occurs in populations that occupy the same geographical area. Cichlid fish are freshwater fish belonging to the Cichlidae family. They are a large family of fish that are commonly found in freshwater habitats in Africa, South America, and other regions.

They come in a variety of shapes and sizes, and they are known for their bright, vibrant colors. The cichlid fish of Lake Victoria are known for their distinct coloration, which ranges from blue to red.

Cichlid fish that live in shallow water is blue and prefer to mate with other blue fish, while cichlid fish that live in deep water is red and prefer to mate with other red fish. These cichlid fish evolved from a single ancestral species and now live together in the same habitat.

To know about Sympatric speciation, refer here:

https://brainly.com/question/4493180#

#SPJ11

describe the similarities and differences between mitosis and meiosis. explain how the result of meiosis differs from the result of mitosis.

Answers

Mitosis and Meiosis are both processes of cellular division, but have some distinct differences. Mitosis is the process of cell division in which a single cell divides into two identical daughter cells with identical genetic material. Meiosis is the process of cell division in which a single cell divides into four daughter cells with half of the genetic material of the original cell.

Similarities between mitosis and meiosis include the fact that both processes result in the division of a single cell into two or four daughter cells and the daughter cells of both processes contain the same genetic material as the parent cell.

Differences between mitosis and meiosis include the number of daughter cells produced, the amount of genetic material present in each daughter cell, and the purpose of each process. Mitosis results in two daughter cells with identical genetic material, while meiosis results in four daughter cells with half the genetic material of the parent cell. The purpose of mitosis is for cell growth and replacement, while the purpose of meiosis is for producing gametes (sex cells) during reproduction.

The Result of Meiosis vs Mitosis differs in that meiosis produces four daughter cells with half of the genetic material of the parent cell, while mitosis produces two daughter cells with identical genetic material. This difference is important during reproduction because the two daughter cells created during meiosis can combine with two daughter cells from another parent to form an organism with a unique set of genetic material, while the two daughter cells created during mitosis will remain genetically identical to the parent cell.

For more such questions on Mitosis and Meiosis.

https://brainly.com/question/2324741#

#SPJ11

How to avoid injury to a bone muscle or joint?

Answers

In order to avoid injury to a bone, muscle, or joint, it is important to practice proper form when performing any type of physical activity.

This means using correct posture and body alignment, as well as using the correct muscles for the activity. Additionally, it is important to warm up thoroughly before any type of physical activity, and to use a gradual progression when increasing the intensity of an activity.

This will help to ensure that muscles, joints, and bones are properly prepared for the physical activity. Additionally, it is important to use proper equipment when engaging in physical activity.

For example, when running, it is important to wear shoes that are designed specifically for running, and to use a surface that is appropriate for the activity. Furthermore, it is important to listen to the body and to stop physical activity if any pain or discomfort is experienced.

If pain persists, it is important to see a medical professional to determine the cause and to ensure proper treatment. By following these guidelines, it is possible to help prevent injury to bones, muscles, and joints.

Know more about injury here

https://brainly.com/question/445007#

#SPJ11

Inside the chloroplast, where are organic molecules made?
A. stroma
B. thylakoid membrane
C. between the outer and inner membranes
D. inside the thylakoid

Answers

A. The stroma of the chloroplast is where organic compounds are created.

StromaThe thylakoid membranes are enclosed in the fluid-filled stroma in the chloroplasts of plant cells. It is one of the chloroplast's two major compartments; the other is the thylakoid membrane system. The stroma is home to a variety of enzymes and molecular tools needed for the photosynthesis-based production of organic compounds like amino acids and carbohydrates.Pigments found in the thylakoid membranes, such as chlorophyll, collect light energy during photosynthesis. The creation of ATP and NADPH, which are employed in the stroma to change carbon dioxide into organic molecules, is then fueled by this energy.

Ribosomes, DNA, and other elements required for the synthesis of chloroplast proteins are also present in the stroma.

learn more about chloroplast here

https://brainly.com/question/1741612

#SPJ1

What is the process of converting mRNA codons into amino acids?

Answers

Answer: Translation

Explanation: The process converting the mRNA message into a sequence of amino acids on the surface of ribosomes is termed translation.

The DNA code determining the sequence of amino acids is transferred to the site of protein synthesis (ribosomes) through mRNA as DNA does not move out of the nucleus.

which of the three prepared specimens (mushroom, peziza, and mucor mucedo) represent secondary mycelium fruiting structures?

Answers

Among the three specimens mentioned, only the mushroom represents a secondary mycelium fruiting structure.

What is called mycelium?

Mycelium is the mass of branched and tubular filaments (hyphae) of fungi.

Among the three specimens mentioned, only mushroom represents a secondary mycelium fruiting structure. Peziza and Mucor mucedo are not mushrooms and do not have fruiting structures that are the characteristic of secondary mycelium.

Mushrooms are the fruiting bodies of certain types of fungi, specifically those that belong to Basidiomycota and Ascomycota phyla. Secondary mycelium is the vegetative stage that grows after primary mycelium has fused with another compatible mycelium. This secondary mycelium forms  fruiting body or mushroom.

To know more about mycelium, refer

https://brainly.com/question/29005912

#SPJ1

the liquid portion of blood is called and makes up about (percentage) of the total blood volume:

Answers

The liquid portion of the blood plasma is called blood plasma and it makes up about 55 percentage of the total blood volume .

how have human activities impacted biogechemical cycles in the last 100 years? nitrogen concentrations in coastal waters mostly increased global nitrogen fixation decreased phosphorus concentrations in lakes and rivers mostly decreased carbon concentration in the atmosphere decreased

Answers

Human activities have significantly impacted biogeochemical cycles in the last 100 years, leading to changes in the distribution and cycling of elements in the environment.

Nitrogen cycle: Human actions have increased the amount of reactive nitrogen in the environment, such as the use of synthetic fertilisers and the combustion of fossil fuels.

Cycle of phosphorus: Human activities like the usage of fertilisers and detergents that contain phosphorus have increased the amount of phosphorus that is available in the environment.

Carbon cycle: Human actions including the combustion of fossil fuels, deforestation, and changes in land use have led to an increase in the atmospheric concentration of carbon dioxide. Both terrestrial and aquatic ecosystems have been impacted by this rise in carbon dioxide concentrations, which has contributed to global warming and climate change.

These are some biogeochemical cycles affected.

To know more about biogeochemical cycle click here

brainly.com/question/1529784

#SPJ4

the cell membrane protects and regulates what enters and leaves the cell. which organ system is most similar to the cell membrane?

Answers

The organ system that is most similar to the cell membrane in terms of function is the integumentary system.

Just as the cell membrane serves as a barrier between the cell and its environment, the skin of the integumentary system serves as a barrier between the body and the external environment. The skin also regulates the exchange of substances between the body and the environment, just as the cell membrane regulates the exchange of substances between the cell and its surroundings.

Additionally, the skin plays a role in sensory perception, temperature regulation, and immune defense, which are all functions that are related to the cell membrane's role in cellular communication and signaling.

To learn more about  cell membrane refer to:

brainly.com/question/13524386

#SPJ4

What are the 3 characteristics of aquatic biomes?

Answers

The three characteristics of aquatic biomes are salinity, water depth, and water flow. Aquatic biomes are defined as communities of living organisms that are present in water. They are broadly classified into two groups: marine and freshwater biomes.

The saltwater biome is known as the marine biome, while the freshwater biome is known as the freshwater biome. Salinity, water depth, and water flow are the three characteristics of aquatic biomes. The marine biome covers approximately 71% of the Earth's surface, while the freshwater biome covers approximately 3% of the Earth's surface.

Both biomes are distinguished by unique characteristics. Salinity is the salt content of seawater, which is measured in parts per thousand. Marine biomes are defined by their saltwater, which includes oceans, coral reefs, and estuaries. Due to the high salt concentration, life forms that thrive in marine environments have distinct adaptations that allow them to conserve water and survive in high-salt conditions.

know more about aquatic biomes here

https://brainly.com/question/28195811#

#SPJ11

cell body with a single process that divides into two branches and functions as an axon ; only the receptor ends of the peripheral (distal) process function as dendrites

Answers

Cell body with a single process that divides into two branches and functions as an axon; only the receptor ends of the peripheral (distal) process function as dendrites is the definition of a pseudounipolar neuron.

What is a pseudounipolar neuron?

Pseudounipolar neurons are a kind of neuron that has just one extension branching into two different processes. The neuron cell body is located on this single extension. As a result, the pseudounipolar neuron has two axons and no dendrites. The two processes are in fact an axon and a dendrite. The axon conducts impulses away from the cell body, whereas the dendrite conducts impulses toward it.

Pseudounipolar neurons are mostly sensory neurons in vertebrate animals. They are primarily involved in sending signals to the central nervous system (CNS) in response to stimuli. Because the dendrite-like process and the axon-like process are just branches of the same extension, the pseudounipolar neuron can receive information at its periphery while maintaining its central communication role. Pseudounipolar neurons can be found in the ganglia of the spinal cord and sensory ganglia.

Learn more about neurons: https://brainly.com/question/11538106

#SPJ11

in angiosperm embryo seed, how many cells are formed?

Answers

An ovule, which is housed within the ovary of a flower, is where the embryo sac develops. The mature embryo sac is a seven-celled, eight-nucleate structure in the majority of angiosperms.

In the mature embryo sac of angiosperms, also called the female gametophyte, there are a total of 8 haploid nuclei within 7 cells. These cells are arranged in a specific pattern, with three antipodal cells at one end, two synergids at the opposite end, and a central cell with two polar nuclei in the center. The egg cell is one of the two nuclei in the central cell, and the other polar nucleus fuses with a sperm cell to form the endosperm, a nutritive tissue that nourishes the developing embryo. So in the angiosperm embryo seed, there will typically be one fertilized egg cell and two polar nuclei (which have fused with a sperm cell to form the endosperm), for a total of three cells.

To know more about angiosperms

brainly.com/question/29250052

#SPJ4

tobacco/alcohol test spring heath ytiny air sacs in the lungs are destroyed, making breathing extremely difficult, in the disease called.

Answers

Emphysema: This chronic lung disease is often the result of smoking and leads to the destruction of alveoli. It causes air to become trapped in the alveoli, making it more difficult to expel air from the lungs.

What does this change in rock layers tell the geologist about Earth's history in the area where these layers formed

Answers

A change in rock layers can provide valuable insights into the geological history of the area where they were formed. By studying the different layers, geologists can determine the order in which they were deposited and the types of sediment that were present at different times.

This information can provide clues about past environmental conditions, such as changes in sea level, climate, and the presence of ancient water bodies. Additionally, the rock layers can contain fossils that can help geologists understand the evolution of life in the area over time. Changes in the physical properties of the rock layers, such as changes in the angle or orientation of the layers, can also indicate past tectonic activity, such as the movement of tectonic plates, mountain-building processes, or the presence of faults. In summary, changes in rock layers can provide geologists with important information about the Earth's geological history, enabling us to better understand the processes that have shaped our planet over time.

To know more about rock layers click here:

brainly.com/question/2128334

#SPJ4

a complex cell located within the striate cortex would be most activated by a group of answer choices

Answers

A complex cell located within the striate cortex would most likely be activated by visual stimuli such as a moving object or a pattern of light and dark. This is because the striate cortex is located at the very back of the brain and is responsible for processing visual information.

Complex cells in this area are specialized for detecting movement and recognizing specific patterns. When these cells are activated, they send a signal to other areas of the brain to enable the recognition of an object or action.

Thus, when visual stimuli are presented, these complex cells are likely to be activated, allowing for the recognition of movement and patterns.

Know more about Complex cell here

https://brainly.com/question/9376503#

#SPJ11

a transposon is defined as group of answer choices a way to correct errors made by dna polymerase a transcription factor that increases mutations a transcription factor that prevents mutations a movable element made of dna

Answers

A transposon is defined as a movable element made of DNA.

What is a transposon?

A transposon or transposable element is a DNA sequence that can change its position within the genome, occasionally making changes in gene function and leading to a variety of genetic variations. It is commonly known as a "jumping gene." It has the ability to insert in virtually any position where the transposase enzyme used during this process may recognize.

Transposons are found in both prokaryotes and eukaryotes, and they are frequently used in genetic analysis as mutagens and as tools for inserting genes into a host organism's genome. They were first discovered in maize by Barbara McClintock in the 1940s.

Learn more about transposon here: https://brainly.com/question/29835869

#SPJ11

hat is a proto-oncogene? multiple select question. a gene that is part of growth and development signaling pathways in a cell. a gene that, if mutated, can lead to cancer. a gene that produces proteins that typically slow down the cell cycle and repair damaged dna. a gene that encodes proteins that typically speed up the cell cycle.

Answers

A proto-oncogene is a gene that is part of growth and development signaling pathways in a cell and if mutated can lead to cancer. It also encodes proteins that typically speed up the cell cycle.

What is a proto-oncogene?

A proto-oncogene is a normal gene that, when mutated or overexpressed, can lead to the development of cancer. They are the counterparts of oncogenes, which promote uncontrolled cell growth and division, which can contribute to the development of cancer by interfering with normal cell processes.

The Proto-oncogene is a gene that encodes proteins that typically speed up the cell cycle and repair damaged DNA. A proto-oncogene is a gene that is involved in signaling pathways for growth and development within a cell. Mutations in proto-oncogenes may lead to the growth of cancer cells.

Learn more about proto-oncogenes at https://brainly.com/question/15177048

#SPJ11

the layer of cells that selectively allows water and other materials through to the vascular tissue is known as the

Answers

I think it’s the xylem

Duplication of the chromosomes to produce sister chromatids _____.
occurs in both mitosis and meiosis

Answers

Yes, the duplication of chromosomes to produce sister chromatids occurs in both mitosis and meiosis.

During the S (synthesis) phase of the cell cycle, DNA replication occurs, resulting in the duplication of each chromosome. This process results in the formation of two identical sister chromatids joined at a centromere. In mitosis, the sister chromatids separate during anaphase, and each daughter cell receives a complete set of chromosomes.

In meiosis, the sister chromatids separate during the second division, resulting in the formation of four genetically diverse daughter cells with half the number of chromosomes as the parent cell.

To learn more about chromatids refer to:

brainly.com/question/29108845

#SPJ4

supercoiling of dna choose one: a. is an energy-independent process that happens spontaneously. b. is unnecessary to fit the dna into the cell. c. occurs only in prokaryotes. d. may be affected by antibiotics.

Answers

Supercoiling of DNA may be affected by antibiotics. The correct option is (d).

DNA supercoiling refers to the coiling of the DNA strand into a more compact and intricate structure. Supercoiling involves twisting and rotation of the DNA strands to form a helical shape. Supercoiling is essential for compacting DNA within the cells so that it can fit inside the cells. The process of supercoiling of DNA is essential for proper DNA replication and transcription.Supercoiling is affected by antibiotics as it is a complex process involving different enzymes. The antibiotics target specific enzymes involved in the supercoiling process and thus affects the process.

The other given options are incorrect .

a. is an energy-independent process that happens spontaneously: It is incorrect because supercoiling is an energy-dependent process and requires ATP.

b. is unnecessary to fit the DNA into the cell: It is incorrect because supercoiling is essential for compacting DNA within the cells so that it can fit inside the cells.

c. occurs only in prokaryotes: It is incorrect because supercoiling occurs in both prokaryotes and eukaryotes.

Therefore, the statement "may be affected by antibiotics" is correct. Antibiotics like novobiocin and nalidixic acid, target the bacterial DNA gyrase enzyme that is responsible for the supercoiling of DNA. The inhibition of DNA gyrase prevents bacterial replication and results in bacterial death.

To know more about DNA refer here :

https://brainly.com/question/16099437

#SPJ11

rough projection that supports body weight when sitting is called?

Answers

The rough projection that supports body weight when sitting is called is the ischial tuberosity.

What is the ischial tuberosity?

The ischial tuberosity is a vital structure in the pelvic region. It's a bony landmark that's easy to spot, and it's the component that makes up the lowest portion of the pelvis. When seated, this bony area supports the weight of the body. It's likewise an attachment point for various muscles that work to move the legs and hips.

The ischial tuberosity is also known as the "sitting bone." It's an essential part of the body's posture mechanism since it provides a solid base for sitting, and it helps distribute weight evenly throughout the pelvis. Additionally, it connects the pelvic muscles to the lower limbs. The sacrotuberous ligament is also attached to this bone.

Learn more about ischial tuberosity here: https://brainly.com/question/15168033

#SPJ11

if you are studying pathogenesis of a microbe such as v. vulnificus, which type of bioinformatic information would be most useful to you? choose one: a. predicted locations of open reading frames b. calculated percentage of gc content c. numbers, locations, and sequences of trna genes d. numbers, locations, and sequences of rrna genes e. predicted functions of genes

Answers

If you are studying the pathogenesis of a microbe such as V. vulnificus, the most useful bioinformatic information would be numbers, locations, and sequences of rRNA genes. So, option D is correct.

Ribosomal RNA (rRNA) genes are highly conserved and essential for the translation of genetic information into proteins. In addition, rRNA genes are present in multiple copies in the genome, making them easy to identify and sequence. Therefore, analyzing the numbers, locations, and sequences of rRNA genes can provide important information about the evolutionary history, phylogeny, and taxonomy of the microbe, as well as its potential virulence and pathogenicity. This information can be used to develop diagnostic tests, vaccines, and therapeutics targeting the microbe.

To know more about Ribosomal RNA (rRNA)

brainly.com/question/29808153

#SPJ4

if the m checkpoint is not cleared, what stage of mitosis will be blocked?

Answers

If the M checkpoint is not cleared, the cell will be blocked in metaphase stage of mitosis.

The M checkpoint or spindle checkpoint is a phase of mitosis where the cell verifies that all of the chromosomes have been replicated and that they are correctly attached to the spindle fibers. Mitosis is the process by which cells divide and replicate. This process is a key step in a range of different functions, including the development of new cells, tissue repair, and growth, and is also necessary for the replication of organisms.

There are four phases of mitosis: prophase, metaphase, anaphase, and telophase. Each of these phases is characterized by different stages of cell division, and each is necessary for the process to be successful.The M checkpoint occurs in the middle of mitosis, and ensures that chromosomes have properly replicated and are correctly aligned on the spindle fibers. If this checkpoint is not cleared, the cell will be unable to progress to anaphase, and will remain in metaphase until the issue is resolved.

More on mitosis: https://brainly.com/question/13050511

#SPJ11

Other Questions
what is the probability that at least two of the six members of a family are not born in the fall? assume that all seasons have the same probability of containing the birthday of a person selected randomly. willis middle school participates in a school-wide positive behavior supports program. several students have been identified with repeated office referrals and suspensions. these students would fall into which level of the three-tiered model of intervention? Write a program that will read a file (data.txt). The file contains integer values. Theprogram will read the file and create a list. (Python) If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales.